Open access
Announcement
12 July 2018

Complete Genome Sequence of an Influenza C Virus Strain Identified from a Sick Calf in the United States

ABSTRACT

Influenza C virus (ICV) has been identified for the first time from bovine respiratory disease complex (BRDC) samples in the United States. Here, we report the complete genome sequence of the strain C/bovine/Montana/12/2016, identified from a nasal swab sample collected from a sick calf with clinical signs of respiratory disease in Montana.

ANNOUNCEMENT

Influenza viruses, including influenza A, B, C, and D viruses, are contagious zoonotic pathogens that can cause influenza and may be transmitted among animals and humans (13). Influenza C virus (ICV) was first identified in humans in 1947, and it was originally thought to be exclusively a human pathogen until it was also identified in pigs in China (4, 5). Recently, we identified ICV from bovine respiratory disease complex (BRDC) samples in the United States. A total of 1,525 BRDC diagnostic samples were collected from 2016 to 2018 and screened with an ICV reverse transcription-quantitative PCR (RT-qPCR). Sixty-four ICV-positive samples mainly from the midwestern United States were identified, among which 12 were confirmed by sequencing a 590-bp fragment of the ICV matrix gene using primers ICV-cF (AAAGCCAGCACAGCAATGAA) and ICV-cR (TCAAAAATACCATCATTGGAAAAAGG).
A complete genome sequence has been generated from C/bovine/Montana/12/2016 virus, which was identified from a nasal swab sample collected in Montana in November 2016 from a sick calf with clinical signs of respiratory disease. Viral RNA was extracted from the bovine clinical sample using a QIAamp viral RNA minikit (Qiagen, Valencia, CA). Single-reaction genomic amplification of ICV segments from viral RNA was performed using a SuperScript IV one-step RT-PCR system (Invitrogen/ThermoFisher, Carlsbad, CA) as previously described (6, 7). The primers contain the conserved ICV RNA termini (underlined) and a 5′ tail for efficient amplification of all ICV RNA segments, ICV-3uniPlusF (5ʹ-ACGCGTGATCAGCAGAAGCAGG-3ʹ) and ICV-5uniPlusR (5ʹ-ACGCGTGATCAGCAGTAGCAAG-3ʹ). ICV genes were further amplified with a TaKaRa LA Taq PCR kit (TaKaRa, Mountain View, CA) using ICV gene-specific primers (8, 9). The amplified gene fragments were sequenced at Genewiz (South Plainfield, NJ). The sequences were assembled using CLC Genomic Workbench 9.0.1 (CLC Bio/Qiagen, Cambridge, MA).
The complete coding sequence (CDS) lengths of the seven segments, including polymerase basic 2 (PB2), PB1, polymerase 3 (P3), hemagglutinin-esterase (HE), nucleoprotein (NP), matrix (M), and nonstructural (NS) genes, are 2,325, 2,265, 2,130, 1,944, 1,698, 1,125, and 862 nucleotides, respectively. The 7 genes code for 9 viral proteins, namely PB2, PB1, P3, HE, NP, M1, CM2, NS1, and NS2, with lengths of 774, 754, 709, 647, 565, 242, 139, 246, and 182 amino acids, respectively. Phylogenetic analysis revealed that the C/bovine/Montana/12/2016 virus was most closely related to the human ICV strain C/Mississippi/80, with overall genome sequence identity of 97.1% and specifically 97.0% for the PB2 gene, 97.7% for the PB1 gene, 97.5% for the P3 gene, 96.2% for the HE gene, 96.8% for the NP gene, 96.8% for the M gene, and 97.6% for the NS gene.
This is the first report of full-genome information of an ICV strain identified from bovines. Although interspecies transmission of influenza viruses occurs among animals and humans and a high concentration of ICV was identified in a sick calf, more detailed investigations are needed to confirm if ICV is involved in bovine respiratory disease and to illustrate the zoonotic potential of bovine ICV strains to cause human disease.

Data availability.

The complete genome sequence of the C/bovine/Montana/12/2016 virus was deposited in GenBank as 7 individual segments under consecutive accession numbers from MH348113 to MH348119.

ACKNOWLEDGMENTS

The Kansas State Veterinary Diagnostic Laboratory and the Swine Health Information Center provided funding for this study.

REFERENCES

1.
Lade MK, Sawant DS, Singh MM. 2011. Review on influenza with special emphasis on swine flu. Annu Rev Biochem 52:467–506. https://innovareacademics.in/journal/ijcpr/Issues/Vol3Issue1/278.pdf.
2.
Spickler AR. 2016. Influenza factsheet. Center for Food Security and Public Health. Iowa State University, Ames, IA. http://www.cfsph.iastate.edu/Factsheets/pdfs/influenza.pdf.
3.
Vemula SV, Zhao J, Liu J, Wang X, Biswas S, Hewlett I. 2016. Current approaches for diagnosis of influenza virus infections in humans. Viruses 8:96.
4.
Guo YJ, Jin FG, Wang P, Wang M, Zhu JM. 1983. Isolation of influenza C virus from pigs and experimental infection of pigs with influenza C virus. J Gen Virol 64:177–182.
5.
Yuanji G, Desselberger U. 1984. Genome analysis of influenza C viruses isolated in 1981/82 from pigs in China. J Gen Virol 65:1857–1872.
6.
Zhou B, Donnelly ME, Scholes DT, St George K, Hatta M, Kawaoka Y, Wentworth DE. 2009. Single-reaction genomic amplification accelerates sequencing and vaccine production for classical and swine origin human influenza A viruses. J Virol 83:10309–10313.
7.
Hause BM, Collin EA, Liu R, Huang B, Sheng Z, Lu W, Wang D, Nelson EA, Li F. 2014. Characterization of a novel influenza virus in cattle and swine: proposal for a new genus in the Orthomyxoviridae family. mBio 5:e00031-14.
8.
Mukherjee TR, Mukherjee A, Mullick S, Chawla-Sarkar M. 2013. Full genome analysis and characterization of influenza C virus identified in Eastern India. Infect Genet Evol 16:419–425.
9.
Matsuzaki Y, Sugawara K, Furuse Y, Shimotai Y, Hongo S, Oshitani H, Mizuta K, Nishimura H. 2016. Genetic lineage and reassortment of influenza C viruses circulating between 1947 and 2014. J Virol 90:8251–8265.

Information & Contributors

Information

Published In

cover image Microbiology Resource Announcements
Microbiology Resource Announcements
Volume 7Number 112 July 2018
eLocator: 10.1128/mra.00828-18
Editor: John J. Dennehy, Queens College

History

Received: 6 June 2018
Accepted: 11 June 2018
Published online: 12 July 2018

Contributors

Authors

Hewei Zhang
Kansas State Veterinary Diagnostic Laboratory, College of Veterinary Medicine, Kansas State University, Manhattan, Kansas, USA
State Key Laboratory for Molecular Biology of Special Economic Animals, Institute of Special Economic Animal and Plant Sciences, Chinese Academy of Agricultural Sciences, Changchun, China
Elizabeth Poulsen Porter
Kansas State Veterinary Diagnostic Laboratory, College of Veterinary Medicine, Kansas State University, Manhattan, Kansas, USA
Molly Lohman
Kansas State Veterinary Diagnostic Laboratory, College of Veterinary Medicine, Kansas State University, Manhattan, Kansas, USA
Nanyan Lu
Kansas State Veterinary Diagnostic Laboratory, College of Veterinary Medicine, Kansas State University, Manhattan, Kansas, USA
Lalitha Peddireddi
Kansas State Veterinary Diagnostic Laboratory, College of Veterinary Medicine, Kansas State University, Manhattan, Kansas, USA
Department of Diagnostic Medicine and Pathobiology, College of Veterinary Medicine, Kansas State University, Manhattan, Kansas, USA
Gregg Hanzlicek
Kansas State Veterinary Diagnostic Laboratory, College of Veterinary Medicine, Kansas State University, Manhattan, Kansas, USA
Department of Diagnostic Medicine and Pathobiology, College of Veterinary Medicine, Kansas State University, Manhattan, Kansas, USA
Douglas Marthaler
Kansas State Veterinary Diagnostic Laboratory, College of Veterinary Medicine, Kansas State University, Manhattan, Kansas, USA
Department of Diagnostic Medicine and Pathobiology, College of Veterinary Medicine, Kansas State University, Manhattan, Kansas, USA
Xuming Liu
Kansas State Veterinary Diagnostic Laboratory, College of Veterinary Medicine, Kansas State University, Manhattan, Kansas, USA
Department of Diagnostic Medicine and Pathobiology, College of Veterinary Medicine, Kansas State University, Manhattan, Kansas, USA
Kansas State Veterinary Diagnostic Laboratory, College of Veterinary Medicine, Kansas State University, Manhattan, Kansas, USA
Department of Diagnostic Medicine and Pathobiology, College of Veterinary Medicine, Kansas State University, Manhattan, Kansas, USA

Editor

John J. Dennehy
Editor
Queens College

Notes

Address correspondence to Xuming Liu, [email protected], or Jianfa Bai, [email protected].

Metrics & Citations

Metrics

Note:

  • For recently published articles, the TOTAL download count will appear as zero until a new month starts.
  • There is a 3- to 4-day delay in article usage, so article usage will not appear immediately after publication.
  • Citation counts come from the Crossref Cited by service.

Citations

If you have the appropriate software installed, you can download article citation data to the citation manager of your choice. For an editable text file, please select Medlars format which will download as a .txt file. Simply select your manager software from the list below and click Download.

View Options

Figures and Media

Figures

Media

Tables

Share

Share

Share the article link

Share with email

Email a colleague

Share on social media

American Society for Microbiology ("ASM") is committed to maintaining your confidence and trust with respect to the information we collect from you on websites owned and operated by ASM ("ASM Web Sites") and other sources. This Privacy Policy sets forth the information we collect about you, how we use this information and the choices you have about how we use such information.
FIND OUT MORE about the privacy policy