Entomopathogenic Fungus-Related Priming Defense Mechanisms in Cucurbits Impact Spodoptera littoralis (Boisduval) Fitness
ABSTRACT
Entomopathogenic fungi (EPF) exhibit direct and indirect mechanisms to increase plant resistance against biotic and abiotic stresses. Plant responses to these stresses are interconnected by common regulators such as ethylene (ET), which is involved in both iron (Fe) deficiency and induced systemic resistance responses. In this work, the roots of cucurbit seedlings were primed with Metarhizium brunneum (EAMa 01/58-Su strain), and relative expression levels of 18 genes related to ethylene (ET), jasmonic acid (JA), and salicylic acid (SA) synthesis, as well as pathogen-related (PR) protein genes, were studied by reverse transcription-quantitative PCR (qRT-PCR). Effects of priming on Spodoptera littoralis were studied by feeding larvae for 15 days with primed and control plants. Genes showed upregulation in studied species; however, the highest relative expression was observed in roots and shoots of plants with Fe deficiency, demonstrating the complexity and the overlapping degree of the regulatory network. EIN2 and EIN3 should be highlighted; both are key genes of the ET transduction pathway that enhanced their expression levels up to eight and four times, respectively, in shoots of primed cucumber. Also, JA and SA synthesis and PR genes showed significant upregulation during the observation period (e.g., the JA gene LOX1 increased 506 times). Survival and fitness of S. littoralis were affected with significant effects on mortality of larvae fed on primed plants versus controls, length of the larval stage, pupal weight, and the percentage of abnormal pupae. These results highlight the role of the EAMa 01/58-Su strain in the induction of resistance, which could be translated into direct benefits for plant development.
IMPORTANCE Entomopathogenic fungi are multipurpose microorganisms with direct and indirect effects on insect pests. Also, EPF provide multiple benefits to plants by solubilizing minerals and facilitating nutrient acquisition. A very interesting and novel effect of these fungi is the enhancement of plant defense systems by inducing systematic and acquired resistance. However, little is known about this function. This study sheds light on the molecular mechanisms involved in cucurbits plants’ defense activation after being primed by the EPF M. brunneum. Furthermore, the subsequent effects on the fitness of the lepidopteran pest S. littoralis are shown. In this regard, a significant upregulation was recorded for the genes that regulate JA, SA, and ET pathways. This increased expression of defense genes caused lethal and sublethal effects on S. littoralis. This could be considered an added value for the implementation of EPF in integrated pest management programs.
INTRODUCTION
Entomopathogenic fungi (EPF) are recognized as excellent biocontrol agents to form part of any integrated pest management (IPM) program due to their capacity to infect a wide range of arthropod pests in a unique way of action, by contact (1–7). Also, they can interact with crops and establish mutualistic interactions that not only protect them against arthropod pests but could also bring benefits to the plant such as plant nutrient acquisition improvement, enhancement of growth and development, immunity, and resistance to other biotic and abiotic stresses (8–19). These functions of EPF led to several multitrophic interactions with important roles in biocontrol (20). Indeed, most EPF species are an important component of the soil microbiota and widely used to control soil-dwelling insect pests, and even well-known rhizosphere-competent microorganism, especially Metarhizium spp. (4, 21–25). In addition to the ability of most EPF to endophytically colonize plant tissues, several species have been shown to provide a systemic protection to the plant by the activation of induced resistance (26–28). This indirect effect of EPF has been poorly studied compared to other, nonentomopathogenic microorganisms with a proven ability to confer resistance on plants, for which several references can be found in the literature, such as bacteria (29–32), mycorrhizae (33–35), and especially the genus Trichoderma (36–41), where this indirect effect has been widely studied. In the case of EPF, although some cases of induction of the expression of several genes related to induced resistance have been described, the lethal and sublethal effects shown in these works have been ascribed to the fungus presence in the plant tissues (26, 42); in the case of the Metarhizium genus, the works that can be found in the literature about the induction of systemic resistance are too scarce (42, 43).
Induced resistance refers to the phenomenon that occurs when susceptible plants, as the result of a primary infection by a microbial pathogen, or attack by herbivores or by the interaction with parasitic or nonpathogenic microorganisms, develop defense responses or enhanced genetically programmed resistance to further attack (44–47). Some studies reported upregulation of ethylene (ET), jasmonic acid (JA), salicylic acid (SA), and pathogen-related (PR) genes as endogenous responses of resistant genotypes against phytopathogens such as Phytophthora capsici and Phytophthora melonis (48, 49) or as a result of inoculation/interaction with other microorganisms like bacteria or mycorrhizal fungi (32, 50). Recently, several works have been published that show the effects of EPF on the enhancement of plant defense systems and their lethal and sublethal effects on some pests by direct contact with the fungus strain or by feeding on endophytically colonized tissues (2, 26, 42).
Induced resistance is classified into two types, namely, induced systemic resistance (ISR) and systemic acquired resistance (SAR); SAR is triggered by plant pathogens, and ISR is triggered by root-colonizing mutualistic microbes, generally inhabitants of the rhizosphere (19, 51–54); likewise, when plants are exposed to nonpathogenic microbes, SAR also can be induced (19). Pathogen infection is sensed by innate immune receptors. The binding of conserved microbial molecules (pathogen-associated molecular patterns [PAMPs]) by immune receptors induces PAMP-triggered immunity (PTI), which provides early protection. As a consequence of the coevolution of host and pathogen, PTI is suppressed by pathogen-derived virulence factors (effectors) which are released to host cells to facilitate infection. The recognition of specific pathogen effectors by intracellular nucleotide-binding/leucine-rich-repeat (NLR) receptors activates the effector-triggered immunity (ETI). ETI induces PTI-associated defense pathways, including the production of reactive oxygen species (ROS), mobilization of Ca2+-dependent protein kinase and mitogen-activated protein kinase (MAPK) signaling cascades, generation of the phenolic hormone SA, and transcriptional reprogramming (55).
ISR responses are mainly regulated by ET and JA and typically independent of SA and function without PR gene activation (45, 47, 49, 51, 52, 56–59). In contrast, SAR is associated with pathogen infection, and it is characterized by increased SA levels which, through the redox-regulated protein non-expressor of PR genes 1 (NPR1), activate the expression of a large set of PR genes involved in defense responses (47, 51, 52, 57, 58, 60, 61). SA accumulation can be controlled by some protein regulators, such as enhanced disease susceptibility 1 (EDS1), phytoalexin-deficient 4 (PAD4), EDS4, EDS5, and non-race-specific disease resistance 1 (NDR1); likewise, SA can enhance the expression of EDS1/PAD4/SAG101 through a positive-feedback loop (54).
The cross-communication between these hormone signals permits the plant to finely balance the defense response (62). ET and JA act in an antagonistic way to regulate plant responses against cold, drought, and salinity stress (63, 64); however, against necrotrophic fungi and wounds, ET and JA act synergistically to coordinate plant defense responses (54, 65). SA inhibits the JA/ET pathway by the activation of NPR1. The cross-point between JA and ET signaling pathways occurs at the level of ERF1, an ET response factor. JA can promote the activation of MYC2 transcription factor to induce the JA response signal through the interaction between JAZ, a repressor of JA signaling, and the SCFCOI1 ubiquitin ligase, which results in the ubiquitination of the JAZ protein and its degradation by the 26S proteasome (54). JAZ1 can also interact with DELLA proteins, which result in increased JA signaling and decreased SA (66). The DELLA family proteins are key regulators of GA signaling that repress transcription of GA-responsive genes (67). Low GA hormone levels and high ET levels result in a high abundance of DELLA proteins. An increase in GA hormone levels results in GA binding its receptor GID1, which induces interaction with DELLA proteins. The GA-GID1-DELLA complex interacts with SCFSLY1/GID2, an E3 ubiquitin ligase, targeting it for proteasomal degradation, which results in a decrease of DELLA abundance. This reduction in DELLAs initiates transcription of gibberellin response genes and release of JAZ1, which results in an increase of SA signaling (66).
Induced resistance, including ISR and SAR, is associated with an enhanced ability to resist pathogen attack by stronger activation of cellular defense responses (68–72); this enhanced ability or activation of defense is known as “priming” (46, 68–70, 73, 74). Originally, priming was described as an enhanced resistance in response to natural or synthetic chemical agents (56, 71, 75). Nowadays, priming has been described in response to rhizosphere microbes, EPF, or pathogens (17, 51, 62, 68–70, 76); in this sense, plant defense priming could be used as an integrated pest management strategy for crop protection (27, 28).
Some of these ISR inducer microorganisms also promote plant growth and development (77) and favor Fe acquisition in plants (18, 78–83). This is in part due to the common involvement of ET and nitric oxide (NO) in the regulation of both processes and because of the cross talk among ET and JA signaling pathways (52). The effect of these microorganisms on the improvement of Fe nutrition is related to their ability to upregulate key genes related to Fe acquisition, such as FIT, MYB72, IRT1, and FRO2 (18, 52, 77, 78). On the other hand, MYB72, a key transcription factor (TF) in ISR activation, also participates in the regulation of the Fe deficiency responses through its interaction with FIT TF, a key regulator of Fe deficiency responses.
Due to this cross talk among Fe deficiency responses and ISR in the present work, we aimed to evaluate the ability of Metarhizium brunneum Petch (Hypocreales: Clavicipitaceae) strain EAMa 01/58-Su to induce defense responses in cucumber and melon plants under two nutritional conditions, Fe sufficiency and deficiency, to highlight the cross talk among biotic and abiotic stresses. Relative expression of several genes involved in the JA, SA, and ET synthesis/signaling pathways as well as the induction of PR protein genes was studied. Furthermore, we evaluated the effect of root priming by the EAMa 01/58-Su strain on the survival and development of larvae of the cotton leafworm, Spodoptera littoralis (Boisduval) (Lepidoptera: Noctuidae), a widely distributed, very dangerous polyphagous insect pest that has been previously demonstrated to be susceptible to this fungal strain either by contact or by feeding on endophytically colonized tissues (2).
RESULTS
Genes related to ethylene biosynthesis and transduction pathway.
In cucumber roots and shoots, three genes related to ET biosynthesis were studied, namely, ACO1, ACO3, and ACS7 (Fig. 1). In roots we found significant differences in relative expression levels of the three genes studied under both nutritional conditions at different time points in each case (Fig. 1).
FIG 1
Higher relative expression levels of ACO1 and ACS7 could be observed in primed plant shoots under Fe-sufficient conditions (Fig. 1A and C), and under Fe-deficient conditions in the case of ACO3 (Fig. 1F).
In melon, the studied genes related to ET biosynthesis in roots and shoots were the following: ACO1, ACO3, ACO5, and ACS7. In roots, only ACO3 and ACO5 increased significantly their relative expression under both conditions (Fig. 2B, C, F, and G); significant differences in relative expression levels of ACO1 in roots of primed plants also could be observed under Fe-deficient conditions (Fig. 2E). ACS7 was not detected in roots.
FIG 2
In shoots of primed plants all 4 genes studied showed a significant increment of their relative expression under both conditions at different time points (Fig. 2). ACS7 showed an important increase of its relative expression at different times under both nutritional conditions (Fig. 2D and H).
Besides ET biosynthesis genes, the relative expression of three key genes in the ET transduction pathway was studied in roots and shoots of cucumber (EIN2 and EIN3) and melon (EIN2, EIN3, and the AP2-like ethylene-responsive transcription factor MELO3C019787).
In cucumber EIN2 and EIN3 relative expression significantly increased at several time points in roots and shoots under both nutritional conditions (Fig. 3). In shoots of cucumber, the relative expression values reached were higher under both nutritional conditions than the ones observed in roots. For both EIN2 and EIN3 genes, an induction peak could be observed at 2 days postpriming (dpp) under Fe-sufficient conditions (Fig. 3A and B) and at 4 dpp under Fe-deficient conditions (Fig. 3C and D).
FIG 3
In melon roots of primed plants, EIN2 and EIN3 showed similar relative expression levels under both Fe-sufficient and -deficient conditions (Fig. 4A, B, D, and E). MELO3C019787 was not detected in roots.
FIG 4
In melon shoots of primed plants both genes enhanced significantly their expression in comparison with their respective controls at 2 and 7 dpp only under Fe-deficient conditions (Fig. 4D and E). Finally, MELO3C019787 enhanced its relative expression level in shoots only at 5 and 7 dpp under Fe-sufficient and -deficient conditions, respectively (Fig. 4C and E).
Genes related to JA and SA biosynthesis.
Relative expression of LOX1, LOX2, and PAL was analyzed in cucumber roots and shoots. In roots LOX1 and PAL showed significant increase of their relative expression under both nutritional conditions (Fig. 5A, C, D, and F). LOX2 was not detected in roots.
FIG 5
In cucumber shoots of primed plants significant increment of LOX1, LOX2, and PAL expression could be observed under both nutritional conditions at different times. The relative expression increase of these genes in primed plant shoots under Fe-deficient conditions reached its maximum at 4 dpp (Fig. 5D, E, and F).
In the case of melon, as in cucumber, we analyzed two genes related to JA biosynthesis, LOX2 and MELO3C014632, which encodes linoleate 13S-lipoxygenase 2-1, and a gene related to SA biosynthesis, MELO3C014222, a phenylalanine ammonia lyase, in roots and shoots.
A significant increase of LOX2 and MELO3C014632 relative expression in roots of primed plants was observed under both nutritional conditions (Fig. 6A, B, D, and E). Likewise, MELO3COL4222 was not detected in roots.
FIG 6
In melon shoots of primed plants, a significant increment of LOX2, MELO3C014632, and MELO3COL4222 could be observed under both nutritional conditions at different times. The relative expression increase of LOX2 in primed plant shoots under both Fe-sufficient and -deficient conditions reached its maximum at 6 dpp (Fig. 6A and D). Relative expression of MELO3COL4222 showed a high increase in shoots of primed plants under Fe-sufficient conditions, reaching a maximum relative expression level (165-fold change) at 4 dpp (Fig. 6C).
Pathogen-related genes.
Another important group of genes, PR protein genes, was analyzed in this study. In cucumber we studied PR1-1a, PR3, and CsWRKY20. In roots, PR3 was the only gene detected under our experimental conditions, showing significant difference under both nutritional conditions (Fig. 7B and E).
FIG 7
In cucumber shoots of primed plants, we found significant differences in relative expression of all three genes studied under both nutritional conditions at different time points, except in PR1-1a under Fe-sufficient conditions (Fig. 7A). The relative expression increase of PR3 and CsWRKY20 in shoots of primed plants under Fe-deficient conditions reached its maximum at 4 dpp (Fig. 7E and F).
In the case of melon, the pathogen-related genes studied were PR1 and PR9. PR1 was detected only in shoots while PR9 showed significant differences in roots and shoots under both nutritional conditions (Fig. 8).
FIG 8
The induction of PR9 expression in roots occurred early in primed plants under Fe-deficient conditions while under Fe-sufficient conditions no significant differences were observed until 4 dpp in both roots and shoots (Fig. 8B and D). In shoots, the relative expression of PR9 increased significantly at most of the time points studied under Fe-deficient conditions (Fig. 8D).
Relative expression of genes in shoots after second priming.
On the 8th day the second priming of cucumber plants was carried out, and the relative expression of genes involved in ET biosynthesis (ACO1, ACO3, and ACS7) and signaling (EIN2 and EIN3) and JA (LOX1 and LOX2) and SA (PAL) biosynthesis was studied only in shoots.
ACO1, ACO3, and ACS7 significantly increased their relative expression in primed plants under both nutritional conditions (Fig. 9A to C), except in the case of ACO1, in which no significant differences were observed under Fe-deficient conditions (Fig. 9A). EIN2 and EIN3 relative expression significantly increased in primed plants under both nutritional conditions, reaching the maximum relative expression level under Fe-sufficient conditions at 7 dpp (Fig. 9D and E).
FIG 9
LOX1 relative expression showed a significant increase at 5 dpp under both nutritional conditions, reaching its maximum expression level (506 times) at 7 dpp under Fe-sufficient conditions (Fig. 10A). In the case of LOX2 and PAL, similar results were obtained, and significant differences in relative expression levels were observed in primed plants under both nutritional conditions (Fig. 10B and C).
FIG 10
Finally, the PAL gene showed an early relative expression increase under both nutritional conditions, reaching its maximum relative expression level at 2 dpp under Fe-sufficient and -deficient conditions (5.71 and 3.44, respectively) (Fig. 10C).
Lethal and sublethal effects on S. littoralis.
A significant difference was observed in mortality. A 4% mortality rate was recorded in larvae fed with primed plants under Fe-sufficient conditions [χ2(1) = 2.73, P = 0.0983], while the mortality of larvae fed with primed plants grown under Fe-deficient conditions reached 8% [χ2(1) = 5.39, P = 0.0202]. In the control treatments (plants without priming) under both nutritional conditions, mortality was 0% (Fig. 11A). Abnormality of pupae presented significant differences only in the case that pupae from larvae fed with primed plants grown under Fe-sufficient conditions reached a 24.88% rate of abnormality [χ2(1) = 5.53, P = 0.0186], while pupae from larvae fed with primed plants grown under Fe-deficient conditions reached a 16.94% rate of abnormality [χ2(1) = 2.51, P = 0.1127] versus 4 and 6% in their control, respectively (Fig. 11B).
FIG 11
The time course evolution of the larval weight showed that there were not significant differences at 8 dpp, while at 16 dpp significant differences among treatments under Fe-sufficient (F1,97 = 115.31, P < 0.001) and Fe-deficient (F1,96 = 29.76, P < 0.001) conditions were recorded, in that larvae fed with primed plants from both nutritional conditions were those that gained less body weight (Fig. 12A). On the other hand, the duration of the larval stage was prolonged by 1 day in those specimens that were fed with primed plants under both Fe-sufficient (F1,96 = 39.10, P < 0.001) and Fe-deficient (F1,94 = 36.68, P < 0.001) conditions (Fig. 12B). Also, pupal weight showed a significant decrease of around 7 to 8% relative to control in the case of Fe-deficient treatment (F1,94 = 11.63, P < 0.001) (Fig. 12C).
FIG 12
Detection and quantification of M. brunneum in shoots.
Despite the effects observed in larvae fed with foliage of primed plants by root immersion, as well as the effects observed in pupae, the presence of M. brunneum was not detectable in most of the observation period, although at 6 and 7 dpp, traces of EAMa 01/58-Su DNA could be seen in the collected samples, quantifying minimum concentrations in the range of 0.03 to 0.3 pg from a total of 4 × 104 pg of DNA per PCR. Standard curves generated and other data from quantitative PCR (qPCR) are shown in the supplemental material.
DISCUSSION
The phenomenon of priming is important for the development of new control methods because priming provides resistance against a broad spectrum of harmful agents significantly affecting growth and fruit or seed production (27, 28, 84, 85). Since it has been shown that priming usually involves epigenetic changes, a transgenerational priming phenomenon can occur (27, 86, 87), as has been shown in several works with natural and chemical compounds (86), with microorganisms such as Pseudomonas syringae (88–90), or by herbivore attack (85, 88). Recent works have demonstrated that evolutionary relatives of Metarhizium, such as Trichoderma atroviride, can transmit the priming and the plant growth promotion effect to the next generation (36, 91); however, the inherited priming phenomenon does not always take place, since experimental conditions can be decisive (92). Furthermore, the priming and subsequent induction of resistance and Fe acquisition-related genes are usually interconnected by common regulators such as ET, JA, and NO, and it has even been recently shown that the inoculation of Arabidopsis thaliana plants with Botrytis cinerea activates Fe deficiency and resistance responses to B. cinerea through the induction of ET biosynthesis genes SAM1 and SAM2 (52, 93).
In the case of EPF, priming could be a very interesting strategy as it is an added value for the fungal efficacy when used for pest control. Usually, microorganism inducers of ISR also promote plant growth and development (77) and favor Fe acquisition (18, 78–83). In the present work, we show the ability of the EPF M. brunneum to trigger both SA- and JA/ET-dependent priming in cucumber and melon seedlings with lethal and sublethal effects on S. littoralis fed on primed plants. In other works it is demonstrated that at short times, Trichoderma induces SA-dependent defenses and then later activates JA/ET-dependent defenses (94, 95), similarly to what occurred in our study with M. brunneum. In the case of Trichoderma it is accepted that the plant can modulate Trichoderma-activated priming depending on the pathogen cycle, as is the case with root knot nematodes (RKN) (91, 96), and four timing stages can be identified (38). In addition, the fluctuating defense response is also effective against abiotic stresses and is more evident when the stress is present (97). Other beneficial fungi, such as EPF, can be expected to exert similar positive effects to a greater or lesser extent.
In general, gene expression levels obtained in cucumber and melon were similar, with a clear induction of all SA, JA, ET, and PR protein genes in shoots of both plant species studied at different times after root priming. The results obtained show the cross talk among ISR and the nutritional status of plants since in general we observed higher relative expression levels in shoots of primed plants under Fe-deficient conditions over the 7 days after the first priming. However, after the second priming, the tendency changed and higher relative expression levels of JA, SA, and ET-related genes were observed in shoots of primed plants under Fe-sufficient conditions. Our results demonstrated induction of the expression of ET biosynthesis genes (ACO1, ACO3, and ACS7 from cucumber and ACO1, ACO3, ACO5, and ACS7 in melon) in shoots and roots of primed plants under both nutritional conditions at different times over the 15 monitored days. Besides ET biosynthesis, relative expressions of ET signaling pathway genes, EIN2 and EIN3, two key proteins in the ET signaling pathway, and MELO3CO19787, which encodes an ERF transcription factor, were significantly induced in shoots and roots under both nutritional conditions. These results would indicate that M. brunneum priming affects not only ET biosynthesis but ET signaling, therefore making plants more sensitive to this hormone. These results are in concordance with those of Aparicio et al. (78), who have studied several genes related to ET biosynthesis (ACO1 and ACO3) and signaling (EIN2 and EIN3) in cucumber roots in Fe-sufficient and -deficient plants inoculated with the nonpathogenic strain Fusarium oxysporum FO12 over 4 days and found a significant induction of the genes studied in inoculated plants at different times independently of the nutritional status.
On the other hand, we studied several JA and SA-biosynthesis-related genes in cucumber (LOX1, LOX2, and PAL) and melon plants (LOX2 and MELO3CO14632) with an important and significant increase in shoots of primed plants. However, the relative expression of JA and SA in roots was also enhanced by M. brunneum in comparison with their respective controls. For some genes like MELO3CO14222, which encodes phenylalanine ammonia lyase, an enzyme involved in SA biosynthesis, the expression was detected only in shoots with a high relative expression level reaching 164-fold change at 4 dpp under Fe-sufficient conditions. Similar results were obtained with PR protein-encoding genes PR3, PR1-1a, and CsWRKY20 in cucumber and PR1 and PR9 in melon plants; their relative expression levels were enhanced in roots and shoots of primed plants under both nutritional conditions. It is worth noting that the second priming led to an additional enhancement of expression level, namely, the case of LOX1, whose relative expression values reached more than a 500-fold change at 15 dpp. These results suggest that the optimization of application times would play a very important role in the resistance induction. In general, little is known about the role of EPF as ISR inducers. Some works have revealed that endophytism by Beauveria bassiana, M. brunneum, and Metarhizium robertsii leads to an increase in the relative expression of ET (ERF-1, ACS1, WRKY51), JA (LOX1, LOXF, AOS, AOC, OPR7, MPI, JAZ1-5A) and SA (PR1, PR1-1-like, PR2, PR4, PR5, BGL, PAL, PBS1) pathway-associated genes in grapevine, faba beans, maize, tomato, and wheat (26, 42, 43, 98), whereas the possible impact of such induction on insect survival and fitness remains unknown.
Our study shows lethal and sublethal effects on S. littoralis fed with shoots of primed cucumber plants. Even if mortality rates were not too high (up to 8%), significant sublethal effects were recorded with decreased larval and pupal weight, increased larval development time, and abnormality of pupae. The efficacy of the EAMa 01/58-Su strain of M. brunneum has been demonstrated against noctuid larvae with high mortality values when directly applied to the insect larvae (up to 80%) (5), when larvae were fed with treated plants (up to 50%) (7), and when larvae were fed with or endophytically colonized plants (up to 20%) (2). However, similar to our study, no fungal outgrowth was recorded in any of the dead larvae. In this sense, larval mortality could be explained by the capacity of this strain to produce destruxin toxins (99, 100) or by the ISR-SAR induction as shown in the present work in which larvae were fed with leaves of noncolonized primed plants that showed high relative expression levels of several genes related to ET biosynthesis (ACO1, ACO3, and ACS7) and signaling (EIN2 and EIN3) and JA and SA biosynthesis (LOX1, LOX2, and PAL). In this regard our work shows that the lethal and sublethal effects recorded were a direct consequence of M. brunneum priming. Related studies indicated that the effects on insect pests are outputs of endophytic colonization and the subsequent enhancement of ISR induction (42, 101–103). Likewise, other studies reported upregulation of ET, JA, SA, and PR-related genes as endogenous responses of resistant genotypes against phytopathogens like Phytophthora capsici and P. melonis (48, 49) or as a result of the inoculation/interaction with other microorganisms like bacteria (32) or mycorrhizal fungi (50). Recently, Di Lelio et al. (40) showed very similar lethal and sublethal effects on S. littoralis larvae fed on tomato plants treated by seed coating with Trichoderma afroharzianum. However, these effects were attributed to gut dysbiosis as a result of plant colonization which led to resistance enhancement. In our study, we showed that the ISR-SAR induction is not necessarily related to endophytic colonization and may cause important effects on insect pest fitness.
Conclusions.
Our results evidence the role of the M. brunneum EAMa 01/58-Su strain as an ISR-SAR inducer, by triggering both SA- and JA/ET-dependent priming, and the benefits of this resistance activation for S. littoralis management. Also, the cross talk between the ISR-SAR induction, insect pest control, and the Fe nutritional status of the plant is highlighted. This study contributes to the knowledge of new functions of EPF that could be integrated as innovative IPM strategies.
MATERIALS AND METHODS
Biological material.
Two species of Cucurbitaceae (Cucumis melo L. var. Futuro and Cucumis sativus L. var. Ashley; Semillas Fitó, S.A., Barcelona, Spain) and S. littoralis (Lepidoptera: Noctuidae) were used to study the effects of priming with an entomopathogenic fungus on the responses and expression of both induced and acquired systemic resistance.
Growth conditions.
Plants were grown under controlled conditions as described by García et al. (104). Briefly, seeds of both species were sterilized with 1% sodium hypochlorite for 5 min, with constant stirring, then washed twice with sterilized water and placed on absorbent paper moistened with 5 mM CaCl2, covered with the same paper, and held at 25°C in the dark over 3 days for germination. Then, when the plants sufficiently elongated their stems, they were transferred to a hydroponic system culture that consisted of a thin polyurethane raft with holes on which plants inserted in plastic lids were held floating on the aerated nutrient solution. Plants grew in a growth chamber at 22°C (day)/20°C (night) temperatures, with relative humidity (RH) between 50 and 70%, and a 14-h photoperiod at a photosynthetic irradiance of 300 μmol m−2 s−1 provided by white fluorescent light (10,000 lx).
The nutrient solution used was R&M (105), whose composition is the following: macronutrients, 2 mM Ca(NO3)2, 0.75 mM K2SO4, 0.65 mM MgSO4, 0.5 mM KH2PO4, and micronutrients, 50 μM KCl, 10 μM H3BO3, 1 μM MnSO4, 0.5 μM CuSO4, 0.5 μM ZnSO4, 0.05 μM (NH4)6Mo7O24, and 10 μM Fe-EDDHA [ethylenediaminedi(O-hydroxyphenylacetic) acid].
After 10 days and 13 days of growth, for cucumber and melon, respectively, plants were separated into four groups that subsequently constituted the 4 treatments, as described below.
The specimens of S. littoralis used in this work came from a colony established at the insectarium of the Agricultural and Forestry Entomology Laboratory of the University of Córdoba; the growth chamber was maintained under the following conditions: 26 ± 2°C, 70% ± 5% relative humidity (RH), and a photoperiod of 16:8 h (light [L]/dark [D] ratio) (2, 106).
Fungal strain and inoculum preparation.
A Metarhizium brunneum (EAMa 01/58-Su) strain from the culture collection of the Agronomy Department, University of Córdoba (Spain), was used in all experiments (Spanish Type Culture Collection accession number 20764). Detailed information about the fungal strain can be found in the work of García-Espinoza et al. (18). Transient and temporary endophytic colonization of melon plants by this strain has been previously demonstrated in foliar application (5, 6), and the positive effects on growth promotion and response to Fe deficiency of M. brunneum have been described previously (107–109) in several cultivated species. Recently, we unraveled the direct and indirect mechanisms used by this strain for Fe acquisition by cucurbits (18).
To provide an inoculum for experiments, the strain was subcultured from stored slant cultures on potato dextrose agar (PDA) in petri dishes and grown for 15 days at 25°C in darkness. Then, inoculum preparation was carried out by scraping the conidia from the petri plates into a sterile solution of 0.1% Tween 80, followed by sonication for 5 min to homogenize the inoculum and filtration through several layers of cheesecloth to remove any mycelia. A hemocytometer (Malassez chamber; Blau Brand, Wertheim, Germany) was used to estimate conidial concentration, which was finally adjusted to 1 × 107 conidia/mL by adding a sterile solution of distilled water with 0.1% Tween 80.
Root priming.
Melon and cucumber plants with two true leaves were selected and placed in trays with 2.5 L of fungal inoculum suspension, previously adjusted to 1 × 107 conidia/mL. Control plants (nonprimed) were placed in trays with 2.5 L of 0.1% Tween 80. All plants were maintained in continuous agitation for 30 min. After that, EAMa 01/58-Su-primed plants, here called Mb-Primed, and nonprimed plants were transferred to two different nutritional conditions, Fe sufficient (+Fe40μM) and deficient (−Fe), so that finally four treatments were used: Control +Fe40μM (nonprimed), Mb-Primed +Fe40μM, Control −Fe (nonprimed), and Mb-Primed −Fe.
Relative expression of defense mechanism-related genes and effects on S. littoralis fitness.
In a first series of experiments, the relative expression levels of 18 ISR- and SAR-related genes were studied over the 7 days postpriming (dpp) without insect pest presence. For that, samples of roots and shoots, separately, were collected daily from 1 to 7 dpp, frozen immediately with liquid nitrogen, and subsequently stored at −80°C. A total of 42 plants were used for each treatment and plant species (6 plants per day and treatment for each plant species). The whole assay with both species of Cucumis was repeated twice (Fig. 13A).
FIG 13
Based on the gene expression results obtained, C. sativus was chosen for this part of the study. A group of cucumber plants were used to study the impact of root priming by the fungus on S. littoralis fitness. For that, plant roots were primed as previously described, and at 2 dpp, 50 larvae of S. littoralis (L2) were introduced and confined in methacrylate boxes to observe larval development. A second priming was applied to the roots 8 days after the first one. Larvae were fed daily with fragments of leaves of plants from their respective treatment over 15 days. After these 15 days, the larvae were fed with an artificial diet until they reached the pupal stage. Larval mortality and development were monitored daily. The larval stage length, pupal abnormality, and pupal weight were recorded; the larvae were weighed at the beginning of the study and at 8 and 16 dpp. The assay was set up into four treatments, as previously explained, with 5 replicates (10 larvae per replicate). The relative expression of genes was studied only in shoots after the second priming (Fig. 13B).
RNA isolation, cDNA synthesis, and reverse transcription-quantitative PCR (qRT-PCR) analysis.
Real-time PCR analysis was carried out as previously described by García et al. (104). Briefly, roots and leaves were ground to a fine powder with a mortar and pestle in liquid nitrogen. Total RNA was extracted using the Tri reagent solution (Molecular Research Center, Inc., Cincinnati, OH, USA) according to the manufacturer’s instructions. cDNA synthesis was performed by using the iScript cDNA synthesis kit (Bio-Rad Laboratories, Inc, Hercules, CA, USA) from 3 μg of DNase-treated RNA as the template. As an internal control, 18S cDNA was amplified using the QuantumRNA Universal 18S Standards primer set (Ambion, Austin, TX, USA); the thermal cycler program was one initial cycle of 94°C for 5 min, followed by cycles of 94°C for 45 s, 55°C for 45 s, and 72°C for 1 min, with 27 to 30 cycles, all followed by a final 72°C elongation cycle of 7 min (110–113).
The study of gene expression by qRT-PCR was performed in a qRT-PCR Bio-Rad CFX Connect thermal cycler and the following amplification profile: initial denaturation and polymerase activation (95°C for 3 min), amplification and quantification repeated 40 times (94°C for 10 s, 57°C for 15 s, and 72°C for 30 s), and a final melting curve stage of 65°C to 95°C with an increase of 0.5°C for 5 s to ensure the absence of primer dimer or nonspecific amplification products (104). PCR mixtures were set up with 2 μL of cDNA in 23 μL of SYBR green Bio-Rad PCR master mix, following the manufacturer’s instructions. Standard dilution curves were performed for each primer pair to confirm appropriate efficiency of amplification (E = 100% ± 10%). Relative expression levels of ethylene- and jasmonic and salicylic acid-related genes as well as genes that encode PR proteins were studied in roots and shoots of both species, C. sativus and C. melo. Constitutively expressed ACTIN and CYCLO genes were used as reference genes to normalize qRT-PCR results. The relative expression levels were calculated from the threshold cycle (CT) values and the primer efficiencies by the Pfaffl method (114). Each PCR analysis was conducted on three biological replicates, and each PCR was repeated twice.
The primers used in this study are listed in Table 1. Oligonucleotides used to amplify ACO5, ACS2, ACS7, LOX2 (for cucumber), and PAL were designed by using Primer-Design software on the NCBI site (115).
TABLE 1
| Hormone and gene | Gene name/function | Accession no. | Reference | Sequencea | Species |
|---|---|---|---|---|---|
| Ethylene | |||||
| ACO1 | 1-Aminocyclopropane-1-carboxylic acid oxidase 1 | FN544066 | 78 | F: TTTGGTGGCGGAGGAGAAAA R: ATGGCTTCAAACCTCGGCTC | C. melo/C. sativus |
| ACO3 | 1-Aminocyclopropane-1-carboxylic acid oxidase 2 | AF033583 | 78 | F: ACTCAAAACAGTGGAACTGGA R: GGGGTACACTTCCTTCTTCTCC | C. melo/C. sativus |
| ACO5 | 1-Aminocyclopropane-1-carboxylic acid oxidase 5 | XM_008445975.2 | F: AGCAAACCAGGAAGTGGAAGA R: GCTCCTCACATTGCTCTGAC | C. melo | |
| ACS7 | 1-aminocyclopropane-1-carboxylic acid synthase 7 | NM_001328455.1 | F: CTCGCCGGATGTCTAGCTTT R: AGCCTGTCCCGGTTCATTTT | C. melo/C. sativus | |
| EIN2 | Ethylene-insensitive protein 2 | KF245636 | 78 | F: TGCCGACAAGGTTAAATGGG R: TGCTGCTGCACAATAGAAGA | C. melo/C. sativus |
| EIN3 | Ethylene-insensitive protein 3 | KF245636 | 78 | F: GCTTTCTGGGGTTGCGATTT R: CCGAACAGTCTCCCAAAGCA | C. melo/C. sativus |
| MELO3C019787 | AP2-like ethylene-responsive transcription factor | 49 | F: CTTCGTTTTCCTATCTTCCAATCC R: CATCAACAAAGTCAAGTAGCCCTC | C. melo | |
| Jasmonic acid | |||||
| LOX1 | Lipoxygenase 1 | XM_004139124.1 | 48 | F: TCTTTGCTTCAGGGTATCAC | C. sativus |
| R: GCAAATTCTTCATCACTACTCC | |||||
| LOX2 (Cs) | Lipoxygenase 2 | NM_001305766.1 | F: GCACTTTGAGCATGTGGTTG | C. sativus | |
| R: AAGCTACTCTAAAGCACTCTTTTCT | |||||
| LOX2 (Cm) | Lipoxygenase 2 | GQ386815 | 32 | F: GCGTAAGGAATGGGATAGAATATATGA | C. melo |
| R: CGACGAGGATAAGGGAATTGG | |||||
| MELO3C014632 | Linoleate 13S-lipoxygenase 2-1 | 49 | F: AACGCCTTTCGCTGCTT | C. melo | |
| R: TGTAGGACTCTGGTGGTGGA | |||||
| Salicylic acid | |||||
| PAL | Phenylalanine ammonia lyase | NM_001308910.1 | F: TCACTCCGCAACACGAGCA | C. sativus | |
| R: GGAGTGACGTTGTGGTTCAAG | |||||
| MELO3C014222 | Phenylalanine ammonia lyase | 49 | F: ATTTTGTCGGGCATCTTTG | C. melo | |
| R: GCGATCTTGTTTTGGCTTCT | |||||
| PR proteins | |||||
| PR3 | Pathogenesis-related protein 3 | NM_001308904.1 | 48 | F: CACTGCAACCCTGACAACAACG | C. sativus |
| R: AAGTGGCCTGGAATCCGACTG | |||||
| PR1-1a | Pathogenesis-related protein 1-1a | AF475286.1 | 48 | F: CTCAAGACTTCGTCGGTGTCCA | C. sativus |
| R: CGCCAGAGTTCACTAGCCTAC | |||||
| CsWRKY20 | WRKY transcription factor of PR protein | XM_011653112.1 | 48 | F: GAAATAACGTACAGAGGGAAGC R: CAGGTGCTGTTTGTTGGTTATG | C. sativus |
| PR1 | Pathogenesis-related protein 1 | EU556704 | 32 | F: GAGTGGGACAGAATAGTAGCAGGTT | C. melo |
| R: GTGCACTAGCCTACAGTCGTTGA | |||||
| PR9 | Pathogenesis-related protein 9 | AY373372 | 32 | F: GCATCTCGATCGTCCAAATGT | C. melo |
| R: TTGGGCTCAATACCGTGGAT | |||||
| Constitutive genes | |||||
| Actina | Actina | XM_004136807 | 78 | F: AACCCAAAGGCAAACAGGGA | C. melo/C. sativus |
| R: TCCGACCACTGGCATAGAGA | |||||
| Cyclo | Cyclophilin | NM_001280769 | 78 | F: ATTTCCTATTTGCGTGTGTTGTT | C. melo/C. sativus |
| R: GTAGCATAAACCATGACCCATAATA |
a
F, forward; R, reverse.
Detection and quantification of M. brunneum by quantitative PCR. (i) DNA isolation.
For each treatment, namely, Control +Fe40μM (nonprimed), Mb-Primed +Fe40μM, Control −Fe (nonprimed), and Mb-Primed −Fe, samples were collected from remains after feeding and stored at −20°C, from 2 to 7 dpp. After each sampling, vegetal material was surface sterilized with 1% sodium hypochlorite for 2 min, rinsed twice in sterile deionized water for 2 min each, and dried on sterile filter paper (2, 116).
Plant material was ground to a fine powder with a mortar and pestle in liquid nitrogen. Total DNA was isolated using the HigherPurity plant DNA purification kit (Canvax Biotech S.L., Córdoba, Spain) according to the manufacturer’s instructions and resuspended in 100 μL of elution buffer. The concentration and quality of DNA were assessed by determination of absorbance at 260 nm and 280 nm in a NanoDrop 2000 (Thermo Fisher Scientific Inc.). The final concentration was homogenized to 30 ng/μL.
(ii) Quantitative PCR.
The specific primer of the nrr gene (forward, TCA GGC GAT CTC GTG GTA AG; reverse, GGG GTG TAC TTG AGG AAT GGG) for qPCR was used (117). Real-time PCR was performed in a qRT-PCR Bio-Rad CFX Connect thermal cycler, and the appliance was set to the following amplification profile: initial denaturation and polymerase activation (95°C for 3 min), amplification and quantification repeated 40 times (94°C for 10 s, 65°C for 15 s, and 72°C for 30 s), and a final melting curve stage of 65°C to 95°C with an increase of 0.5°C for 5 s to ensure the absence of primer dimer or nonspecific amplification products. PCR mixtures were set up with 1.3 μL of the template (40 ng total) in 18.7 μL of SYBR green Bio-Rad PCR master mix, following the manufacturer’s instructions.
Absolute quantification was carried out according to the work of Bell et al. (118) and Barelli et al. (117). A gradient of 1:4 from 40 ng to 0.61 pg of fungal and plant genomic DNA was used to set up standard curves; absolute quantification was determined by comparing threshold cycle numbers against the standard curve previously generated (117, 118).
Statistical analysis.
All assays were carried out twice, and representative results of both species studied are presented. The values of qRT-PCR represent the mean ± standard error (SE) from three independent technical replicates. Results of relative expression were analyzed using one-way analysis of variance (ANOVA) followed by Dunnett’s test. * (P < 0.05), ** (P < 0.01), or *** (P < 0.001) over the bars in the figures indicates significant differences in relation to the control treatment (GraphPad Prism 9.4.0; GraphPad Software, LLC, San Diego, CA, USA).
Data for mortality and abnormality of pupae, expressed as percentages, were analyzed using a generalized linear mixed model with binomial distribution and logit link function. Significance of the treatment was analyzed with the F test and Tukey’s multiple comparisons (α < 0.05) (JMP 8.0; SAS Institute Inc.). Data for weight of pupae and larval stage duration were analyzed using analysis of variance (ANOVA) followed by a Tukey multiple-range test; different letters over the bars in the figures indicate significant differences (P < 0.05) among treatments (Statistix 9.0; Analytical Software, Tallahassee, FL, USA).
Data availability.
The data of the present study are in the possession of the authors and are available for consultation under the respective request; for any additional information, please contact the corresponding author.
ACKNOWLEDGMENTS
We thank the technician personnel of the Forest and Agricultural Entomology Area and Plant Physiology Area and Rafael Pérez-Vicente and Javier Romera Ruiz for the facilities granted in their labs.
The present study was supported by the grant PID2019-103844RB-I00 from the Spanish Ministry of Science and Innovation. Also, we acknowledge financial support from the Spanish Ministry of Science and Innovation, the Spanish State Research Agency, through the Severo Ochoa and María de Maeztu Program for Centers and Units of Excellence in R&D (reference CEX2019-000968-M). F.G.-E. was partially supported by the Consejo Nacional de Ciencia y Tecnología (CONACYT-México) with a grant (2022-000015-02EXTF-00030) from the Call for Graduate Scholarships Abroad - Doctorates in Sciences and Humanities 2022.
Conceptualization, E.Q.-M., M.Y.-Y., M.J.G., and F.G.-E.; methodology, F.G.-E., M.J.G., and M.Y.-Y.; formal analysis, F.G.-E., M.J.G., and M.Y.-Y.; writing, review and editing, F.G.-E., M.J.G., M.Y.-Y., and E.Q.-M. All authors have read and agreed to the published version of the manuscript.
We declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Supplemental Material
File (aem.00940-23-s0001.docx)
- Download
- 645.48 KB
REFERENCES
1.
Quesada-Moraga E, Yousef-Naef M, Garrido-Jurado I. 2020. Advances in the use of entomopathogenic fungi as biopesticides in suppressing crop insect pests, p 63–98. In Birch NN, Glare T (ed), Biopesticides for sustainable agriculture, 1st ed. Burleigh Dodds Science Publishing, Cambridge, United Kingdom.
2.
Miranda-Fuentes P, Yousef-Yousef M, Valverde-García P, Rodríguez-Gómez IM, Garrido-Jurado I, Quesada-Moraga E. 2021. Entomopathogenic fungal endophyte-mediated tritrophic interactions between Spodoptera littoralis and its parasitoid Hyposoter didymator. J Pest Sci 94:933–945.
3.
Resquín-Romero G, Garrido-Jurado I, Quesada-Moraga E. 2016. Combined use of entomopathogenic fungi and their extracts for the control of Spodoptera littoralis (Boisduval) (Lepidoptera: Noctuidae). Biol Control 92:101–110.
4.
Yousef M, Garrido-Jurado I, Ruíz-Torres M, Quesada-Moraga E. 2017. Reduction of adult olive fruit fly populations by targeting preimaginals in the soil with the entomopathogenic fungus Metarhizium brunneum. J Pest Sci 90:345–354.
5.
Resquín-Romero G, Garrido-Jurado I, Delso C, Ríos-Moreno A, Quesada-Moraga E. 2016. Transient endophytic colonizations of plants improve the outcome of foliar applications of mycoinsecticides against chewing insects. J Invertebr Pathol 136:23–31.
6.
Garrido-Jurado I, Resquín-Romero G, Amarilla SP, Ríos-Moreno A, Carrasco L, Quesada-Moraga E. 2017. Transient endophytic colonization of melon plants by entomopathogenic fungi after foliar application for the control of Bemisia tabaci Gennadius (Hemiptera: Aleyrodidae). J Pest Sci 90:319–330.
7.
Sánchez-Rodríguez AR, Raya-Díaz S, Zamarreño ÁM, García-Mina JM, del Campillo MC, Quesada-Moraga E. 2018. An endophytic Beauveria bassiana strain increases spike production in bread and durum wheat plants and effectively controls cotton leafworm (Spodoptera littoralis) larvae. Biol Control 116:90–102.
8.
Bamisile BS, Dash CK, Akutse KS, Keppanan R, Wang L. 2018. Fungal endophytes: beyond herbivore management. Front Microbiol 9:544.
9.
Bamisile BS, Dash CK, Akutse KS, Keppanan R, Afolabi OG, Hussain M, Qasim M, Wang L. 2018. Prospects of endophytic fungal entomopathogens as biocontrol and plant growth promoting agents: an insight on how artificial inoculation methods affect endophytic colonization of host plants. Microbiol Res 217:34–50.
10.
Branine M, Bazzicalupo A, Branco S. 2019. Biology and applications of endophytic insect-pathogenic fungi. PLoS Pathog 15:e1007831.
11.
Hossain M, Sultana F. 2020. Application and mechanisms of plant growth promoting fungi (PGPF) for phytostimulation, p 1–30. In Das SK (ed), Organic agriculture, 1st ed. IntecOpen, London, United Kingdom.
12.
Hu S, Bidochka MJ. 2021. Root colonization by endophytic insect-pathogenic fungi. J Appl Microbiol 130:570–581.
13.
Kogel KH, Franken P, Hückelhoven R. 2006. Endophyte or parasite - what decides? Curr Opin Plant Biol 9:358–363.
14.
Nosheen S, Ajmal I, Song Y. 2021. Microbes as biofertilizers, a potential approach for sustainable crop production. Sustainability 13:1868.
15.
Quesada Moraga E. 2020. Entomopathogenic fungi as endophytes: their broader contribution to IPM and crop production. Biocontrol Sci Technol 30:864–877.
16.
Barelli L, Moonjely S, Behie SW, Bidochka MJ. 2016. Fungi with multifunctional lifestyles: endophytic insect pathogenic fungi. Plant Mol Biol 90:657–664.
17.
Kumari P, Singh A, Kharwar RN. 2020. Phytostimulation and ISR responses of fungi, p 459–473. In Sharma VK, Shah MP, Parmar S, Kumar A (ed), Fungi bio-prospects in sustainable agriculture, environment and nano-technology. Elsevier, New York, NY.
18.
García-Espinoza F, Quesada-Moraga E, García del Rosal MJ, Yousef-Yousef M. 2023. Entomopathogenic fungi-mediated solubilization and induction of Fe related genes in melon and cucumber plants. J Fungi 9:258.
19.
Dara SK. 2019. Non-entomopathogenic roles of entomopathogenic fungi in promoting plant health and growth. Insects 10:277.
20.
Quesada-Moraga E, Garrido-Jurado I, Yousef-Yousef M, González-Mas N. 2022. Multitrophic interactions of entomopathogenic fungi in biocontrol. BioControl 67:457–472.
21.
Garrido-Jurado I, Resquín-Romero G, Yousef-Naef M, Ríos-Moreno A, Quesada-Moraga E. 2020. Soil drenching with entomopathogenic fungi for control of the soil-dwelling life stages and adults of the same generation of Spodoptera littoralis (Boisd.) (Lepidoptera: Noctuidae). Bull Entomol Res 110:242–248.
22.
Yousef M, Alba-Ramírez C, Jurado IG, Mateu J, Díaz SR, Valverde-García P, Quesada-Moraga E. 2018. Metarhizium brunneum (Ascomycota; Hypocreales) treatments targeting olive fly in the soil for sustainable crop production. Front Plant Sci 9:1.
23.
Jaronski ST. 2010. Ecological factors in the inundative use of fungal entomopathogens. BioControl 55:159–185.
24.
Hu G, St. Leger RJ. 2002. Field studies using a recombinant mycoinsecticide (Metarhizium anisopliae) reveal that it is rhizosphere competent. Appl Environ Microbiol 68:6383–6387.
25.
St. Leger RJ. 2008. Studies on adaptations of Metarhizium anisopliae to life in the soil. J Invertebr Pathol 98:271–276.
26.
Jensen RE, Cabral C, Enkegaard A, Steenberg T. 2020. Influence of the plant interacting entomopathogenic fungus Beauveria bassiana on parasitoid host choice-behavior, development, and plant defense pathways. PLoS One 15:e0238943.
27.
Tiwari M, Singh P. 2021. Plant defense priming: a new tool for sustainable global food security, p 133–153. In Singh Shekhawa G (ed), Agricultural innovations and sustainability. Agrobios Research, Jodhpur, India.
28.
Tiwari M, Pati D, Mohapatra R, Sahu BB, Singh P. 2022. The impact of microbes in plant immunity and priming induced inheritance: a sustainable approach for crop protection. Plant Stress 4:100072.
29.
Djami-Tchatchou AT, Harrison GA, Harper CP, Wang R, Prigge MJ, Estelle M, Kunkel BN. 2020. Dual role of auxin in regulating plant defense and bacterial virulence gene expression during Pseudomonas syringae PtoDC3000 pathogenesis. Mol Plant Microbe Interact 33:1059–1071.
30.
Kong X, Zhang C, Zheng H, Sun M, Zhang F, Zhang M, Cui F, Lv D, Liu L, Guo S, Zhang Y, Yuan X, Zhao S, Tian H, Ding Z. 2020. Antagonistic interaction between auxin and SA signaling pathways regulates bacterial infection through lateral root in Arabidopsis. Cell Rep 32:108060.
31.
Van Loon LC, Bakker PAHM, Pieterse CMJ. 1998. Systemic resistance induced by rhizosphere bacteria. Annu Rev Phytopathol 36:453–483.
32.
García-Gutiérrez L, Zeriouh H, Romero D, Cubero J, de Vicente A, Pérez-García A. 2013. The antagonistic strain Bacillus subtilis UMAF6639 also confers protection to melon plants against cucurbit powdery mildew by activation of jasmonate- and salicylic acid-dependent defence responses. Microb Biotechnol 6:264–274.
33.
Pozo MJ, Azcón-Aguilar C. 2007. Unraveling mycorrhiza-induced resistance. Curr Opin Plant Biol 10:393–398.
34.
Shrivastava G, Ownley BH, Augé RM, Toler H, Dee M, Vu A, Köllner TG, Chen F. 2015. Colonization by arbuscular mycorrhizal and endophytic fungi enhanced terpene production in tomato plants and their defense against a herbivorous insect. Symbiosis 65:65–74.
35.
Zitlalpopoca-Hernandez G, Pozo MJ, Hauser TP, Meyling NV. 2022. Combined effects of root-associated entomopathogenic and mycorrhizal fungi on the foliar pathogen Botrytis cinerea in tomato. Biol Control 175:105034.
36.
Woo SL, Hermosa R, Lorito M, Monte E. 2023. Trichoderma: a multipurpose, plant-beneficial microorganism for eco-sustainable agriculture. Nat Rev Microbiol 21:312–326.
37.
Monte E. 2023. The sophisticated evolution of Trichoderma to control insect pests. Proc Natl Acad Sci USA 120:e2301971120.
38.
Morán-Diez ME, Martínez de Alba ÁE, Rubio MB, Hermosa R, Monte E. 2021. Trichoderma and the plant heritable priming responses. J Fungi 7:318.
39.
Alkooranee JT, Yin Y, Aledan TR, Jiang Y, Lu G, Wu J, Li M. 2015. Systemic resistance to powdery mildew in Brassica napus (AACC) and Raphanus alboglabra (RRCC) by Trichoderma harzianum TH12. PLoS One 10:e0142177.
40.
Di Lelio I, Forni G, Magoga G, Brunetti M, Bruno D, Becchimanzi A, De Luca MG, Sinno M, Barra E, Bonelli M, Frusciante S, Diretto G, Digilio MC, Woo SL, Tettamanti G, Rao R, Lorito M, Casartelli M, Montagna M, Pennacchio F. 2023. A soil fungus confers plant resistance against a phytophagous insect by disrupting the symbiotic role of its gut microbiota. Proc Natl Acad Sci USA 120:e2216922120.
41.
Di Lelio I, Coppola M, Comite E, Molisso D, Lorito M, Woo SL, Pennacchio F, Rao R, Digilio MC. 2021. Temperature differentially influences the capacity of Trichoderma species to induce plant defense responses in tomato against insect pests. Front Plant Sci 12:678830.
42.
Ahmad I, Jiménez-Gasco MDM, Luthe DS, Shakeel SN, Barbercheck ME. 2020. Endophytic Metarhizium robertsii promotes maize growth, suppresses insect growth, and alters plant defense gene expression. Biol Control 144:104167.
43.
González-Guzmán A, Rey M-D, Froussart E, Quesada-Moraga E. 2022. Elucidating the effect of endophytic entomopathogenic fungi on bread wheat growth through signaling of immune response-related hormones. Appl Environ Microbiol 88:e00882-22.
44.
Heil M. 2001. The ecological concept of costs of induced systemic resistance (ISR). Eur J Plant Pathol 107:137–146.
45.
Heil M, Bostock RM. 2002. Induced systemic resistance (ISR) against pathogens in the context of induced plant defences. Ann Bot 89:503–512.
46.
Paré PW, Farag MA, Krishnamachari V, Zhang H, Ryu C-M, Kloepper JW. 2005. Elicitors and priming agents initiate plant defense responses. Photosynth Res 85:149–159.
47.
Walters D, Heil M. 2007. Costs and trade-offs associated with induced resistance. Physiol Mol Plant Pathol 71:3–17.
48.
Hashemi L, Golparvar AR, Nasr-Esfahani M, Golabadi M. 2020. Expression analysis of defense-related genes in cucumber (Cucumis sativus L.) against Phytophthora melonis. Mol Biol Rep 47:4933–4944.
49.
Wang P, Wu H, Zhao G, He Y, Kong W, Zhang J, Liu S, Liu M, Hu K, Liu L, Xu Y, Xu Z. 2020. Transcriptome analysis clarified genes involved in resistance to Phytophthora capsici in melon. PLoS One 15:e0227284.
50.
Fiorilli V, Vannini C, Ortolani F, Garcia-Seco D, Chiapello M, Novero M, Domingo G, Terzi V, Morcia C, Bagnaresi P, Moulin L, Bracale M, Bonfante P. 2018. Omics approaches revealed how arbuscular mycorrhizal symbiosis enhances yield and resistance to leaf pathogen in wheat. Sci Rep 8:9625.
51.
Aswani R, Roshmi T, Radhakrishnan EK. 2022. Induction of plant defense response by endophytic microorganisms, p 89–115. In Radhakrishnan EK, Kumar A, Aswani R (ed), Biocontrol mechanisms of endophytic microorganisms. Elsevier, London, United Kingdom.
52.
Romera FJ, García MJ, Lucena C, Martínez-Medina A, Aparicio MA, Ramos J, Alcántara E, Angulo M, Pérez-Vicente R. 2019. Induced systemic resistance (ISR) and Fe deficiency responses in dicot plants. Front Plant Sci 10:287.
53.
Yu Y, Gui Y, Li Z, Jiang C, Guo J, Niu D. 2022. Induced systemic resistance for improving plant immunity by beneficial microbes. Plants 11:386.
54.
Ding LN, Li YT, Wu YZ, Li T, Geng R, Cao J, Zhang W, Tan XL. 2022. Plant disease resistance-related signaling pathways: recent progress and future prospects. Int J Mol Sci 23:16200.
55.
Cui H, Gobbato E, Kracher B, Qiu J, Bautor J, Parker JE. 2017. A core function of EDS1 with PAD4 is to protect the salicylic acid defense sector in Arabidopsis immunity. New Phytol 213:1802–1817.
56.
Beckers GJ, Conrath U. 2007. Priming for stress resistance: from the lab to the field. Curr Opin Plant Biol 10:425–431.
57.
Doornbos RF, Geraats BPJ, Kuramae EE, Van Loon LC, Bakker PAHM. 2011. Effects of jasmonic acid, ethylene, and salicylic acid signaling on the rhizosphere bacterial community of Arabidopsis thaliana. Mol Plant Microbe Interact 24:395–407.
58.
Grant M, Lamb C. 2006. Systemic immunity. Curr Opin Plant Biol 9:414–420.
59.
Rajan P, Raj R, Mathew S, Cherian E, Remakanthan A. 2022. Improved designing and development of endophytic bioformulations for plant diseases, p 137–166. In Radhakrishnan EK, Kumar A, Aswani R (ed), Biocontrol mechanisms of endophytic microorganisms. Elsevier, London, United Kingdom.
60.
Adeleke BS, Ayilara MS, Akinola SA, Babalola OO. 2022. Biocontrol mechanisms of endophytic fungi. Egypt J Biol Pest Control 32:46.
61.
Pieterse CMJ, van Loon LC. 2004. NPR1: the spider in the web of induced resistance signaling pathways. Curr Opin Plant Biol 7:456–464.
62.
Segaran G, Shankar S, Sathiavelu M. 2022. Biocontrol mechanism of endophytic microorganisms, p 55–73. In Radhakrishnan EK, Kumar A, Aswani R (ed), Biocontrol mechanisms of endophytic microorganisms. Elsevier, London, United Kingdom.
63.
Wang J, Song L, Gong X, Xu J, Li M. 2020. Functions of jasmonic acid in plant regulation and response to abiotic stress. Int J Mol Sci 21:1446.
64.
Yang J, Duan G, Li C, Liu L, Han G, Zhang Y, Wang C. 2019. The crosstalks between jasmonic acid and other plant hormone signaling highlight the involvement of jasmonic acid as a core component in plant response to biotic and abiotic stresses. Front Plant Sci 10:1349.
65.
Liu H, Timko MP. 2021. Jasmonic acid signaling and molecular crosstalk with other phytohormones. Int J Mol Sci 22:2914.
66.
Gilroy E, Breen S. 2022. Interplay between phytohormone signalling pathways in plant defence - other than salicylic acid and jasmonic acid. Essays Biochem 66:657–671.
67.
Yang D-L, Yao J, Mei C-S, Tong X-H, Zeng L-J, Li Q, Xiao L-T, Sun T, Li J, Deng X-W, Lee CM, Thomashow MF, Yang Y, He Z, He SY. 2012. Plant hormone jasmonate prioritizes defense over growth by interfering with gibberellin signaling cascade. Proc Natl Acad Sci USA 109:E1192–E1200.
68.
Conrath U. 2009. Priming of induced plant defense responses, p 361–395. In van Loon LC (ed), Advances in botanical research. Elsevier-Academic Press, New York, NY.
69.
Conrath U. 2006. Systemic acquired resistance. Plant Signal Behav 1:179–184.
70.
Conrath U, Thulke O, Katz V, Schwindling S, Kohler A. 2001. Priming as a mechanism in induced systemic resistance of plants. Eur J Plant Pathol 107:113–119.
71.
Conrath U, Beckers GJM, Langenbach CJG, Jaskiewicz MR. 2015. Priming for enhanced defense. Annu Rev Phytopathol 53:97–119.
72.
Vallad GE, Goodman RM. 2004. Systemic acquired resistance and induced systemic resistance in conventional agriculture. Crop Sci 44:1920–1934.
73.
Gaupels F, Vlot AC. 2012. Plant defense and long-distance signaling in the phloem, p 227–247. In Thompson GA, van Bel AJE (ed), Phloem: molecular cell biology, systemic communication, biotic interactions. John Wiley & Sons, Ltd, Chichester, United Kingdom.
74.
Cachapa JC, Meyling NV, Burow M, Hauser TP. 2021. Induction and priming of plant defense by root-associated insect-pathogenic fungi. J Chem Ecol 47:112–122.
75.
Prime-A-Plant Group, Conrath U, Beckers GJM, Flors V, García-Agustín P, Jakab G, Mauch F, Newman MA, Pieterse CMJ, Poinssot B, Pozo MJ, Pugin A, Schaffrath U, Ton J, Wendehenne D, Zimmerli L, Mauch-Mani B. 2006. Priming: getting ready for battle. Mol Plant Microbe Interact 19:1062–1071.
76.
Martínez-Arias C, Sobrino-Plata J, Gil L, Rodríguez-Calcerrada J, Martín JA. 2021. Priming of plant defenses against Ophiostoma novo-ulmi by elm (Ulmus minor Mill.) fungal endophytes. J Fungi 7:687.
77.
Pieterse CMJ, Zamioudis C, Berendsen RL, Weller DM, Van Wees SCM, Bakker PAHM. 2014. Induced systemic resistance by beneficial microbes. Annu Rev Phytopathol 52:347–375.
78.
Aparicio MA, Lucena C, García MJ, Ruiz-Castilla FJ, Jiménez-Adrián P, López-Berges MS, Prieto P, Alcántara E, Pérez-Vicente R, Ramos J, Romera FJ. 2023. The nonpathogenic strain of Fusarium oxysporum FO12 induces Fe deficiency responses in cucumber (Cucumis sativus L.) plants. Planta 257:50.
79.
Zamioudis C, Korteland J, Van Pelt JA, Hamersveld M, Dombrowski N, Bai Y, Hanson J, Van Verk MC, Ling H, Schulze-Lefert P, Pieterse CMJ. 2015. Rhizobacterial volatiles and photosynthesis-related signals coordinate MYB72 expression in Arabidopsis roots during onset of induced systemic resistance and iron-deficiency responses. Plant J 84:309–322.
80.
Zhou C, Guo J, Zhu L, Xiao X, Xie Y, Zhu J, Ma Z, Wang J. 2016. Paenibacillus polymyxa BFKC01 enhances plant iron absorption via improved root systems and activated iron acquisition mechanisms. Plant Physiol Biochem 105:162–173.
81.
Pii Y, Borruso L, Brusetti L, Crecchio C, Cesco S, Mimmo T. 2016. The interaction between iron nutrition, plant species and soil type shapes the rhizosphere microbiome. Plant Physiol Biochem 99:39–48.
82.
Pii Y, Mimmo T, Tomasi N, Terzano R, Cesco S, Crecchio C. 2015. Microbial interactions in the rhizosphere: beneficial influences of plant growth-promoting rhizobacteria on nutrient acquisition process. A review. Biol Fertil Soils 51:403–415.
83.
Marastoni L, Pii Y, Maver M, Valentinuzzi F, Cesco S, Mimmo T. 2019. Role of Azospirillum brasilense in triggering different Fe chelate reductase enzymes in cucumber plants subjected to both nutrient deficiency and toxicity. Plant Physiol Biochem 136:118–126.
84.
Van Hulten M, Pelser M, Van Loon LC, Pieterse CMJ, Ton J. 2006. Costs and benefits of priming for defense in Arabidopsis. Proc Natl Acad Sci USA 103:5602–5607.
85.
Rasmann S, De Vos M, Casteel CL, Tian D, Halitschke R, Sun JY, Agrawal AA, Felton GW, Jander G. 2012. Herbivory in the previous generation primes plants for enhanced insect resistance. Plant Physiol 158:854–863.
86.
Aranega-Bou P, de la O Leyva M, Finiti I, García-Agustín P, González-Bosch C. 2014. Priming of plant resistance by natural compounds. Hexanoic acid as a model. Front Plant Sci 5:488.
87.
Luna E, Ton J. 2012. The epigenetic machinery controlling transgenerational systemic acquired resistance. Plant Signal Behav 7:615–618.
88.
Pieterse CMJ. 2012. Prime time for transgenerational defense. Plant Physiol 158:545.
89.
Slaughter A, Daniel X, Flors V, Luna E, Hohn B, Mauch-Mani B. 2012. Descendants of primed Arabidopsis plants exhibit resistance to biotic stress. Plant Physiol 158:835–843.
90.
Luna E, Bruce TJA, Roberts MR, Flors V, Ton J. 2012. Next-generation systemic acquired resistance. Plant Physiol 158:844–853.
91.
De Medeiros HA, De Araújo Filho JV, De Freitas LG, Castillo P, Rubio MB, Hermosa R, Monte E. 2017. Tomato progeny inherit resistance to the nematode Meloidogyne javanica linked to plant growth induced by the biocontrol fungus Trichoderma atroviride. Sci Rep 7:40216.
92.
Yun SH, Noh B, Noh YS. 2022. Negative evidence on the transgenerational inheritance of defense priming in Arabidopsis thaliana. BMB Rep 55:342–347.
93.
Lu CK, Liang G. 2023. Fe deficiency-induced ethylene synthesis confers resistance to Botrytis cinerea. New Phytol 237:1843–1855.
94.
Malmierca MG, Cardoza RE, Alexander NJ, McCormick SP, Hermosa R, Monte E, Gutiérrez S. 2012. Involvement of Trichoderma trichothecenes in the biocontrol activity and induction of plant defense-related genes. Appl Environ Microbiol 78:4856–4868.
95.
Salas-Marina MA, Silva-Flores MA, Uresti-Rivera EE, Castro-Longoria E, Herrera-Estrella A, Casas-Flores S. 2011. Colonization of Arabidopsis roots by Trichoderma atroviride promotes growth and enhances systemic disease resistance through jasmonic acid/ethylene and salicylic acid pathways. Eur J Plant Pathol 131:15–26.
96.
Martínez-Medina A, Fernandez I, Lok GB, Pozo MJ, Pieterse CMJ, Van Wees SCM. 2017. Shifting from priming of salicylic acid- to jasmonic acid-regulated defences by Trichoderma protects tomato against the root knot nematode Meloidogyne incognita. New Phytol 213:1363–1377.
97.
Rubio MB, Quijada NM, Pérez E, Domínguez S, Monte E, Hermosa R. 2014. Identifying beneficial qualities of Trichoderma parareesei for plants. Appl Environ Microbiol 80:1864–1873.
98.
Rondot Y, Reineke A. 2019. Endophytic Beauveria bassiana activates expression of defence genes in grapevine and prevents infections by grapevine downy mildew Plasmopara viticola. Plant Pathol 68:1719–1731.
99.
Ríos-Moreno A, Garrido-Jurado I, Raya-Ortega MC, Quesada-Moraga E. 2017. Quantification of fungal growth and destruxin A during infection of Galleria mellonella larvae by Metarhizium brunneum. J Invertebr Pathol 149:29–35.
100.
Ríos-Moreno A, Garrido-Jurado I, Resquín-Romero G, Arroyo-Manzanares N, Arce L, Quesada-Moraga E. 2016. Destruxin A production by Metarhizium brunneum strains during transient endophytic colonisation of Solanum tuberosum. Biocontrol Sci Technol 26:1574–1585.
101.
Sari JMP, Herlinda S, Suwandi S. 2022. Endophytic fungi from South Sumatra (Indonesia) in seed-treated corn seedlings affecting development of the fall armyworm, Spodoptera frugiperda J.E. Smith (Lepidoptera: Noctuidae). Egypt J Biol Pest Control 32:103.
102.
Kuzhuppillymyal-Prabhakarankutty L, Ferrara-Rivero FH, Tamez-Guerra P, Gomez-Flores R, Rodríguez-Padilla MC, Ek-Ramos MJ. 2021. Effect of Beauveria bassiana-seed treatment on Zea mays L. response against Spodoptera frugiperda. Appl Sci 11:2887.
103.
Vinha FB, Rojas LAC, Ramos Sales C, Monteiro Lima NS, Nascimento JD, De Carvalho LAL, Lemos EGDM. 2023. Negative effects on the development of Chrysodeixis includens and Spodoptera cosmioides fed by peanut plants inoculated with entomopathogenic fungi. Front Fungal Biol 3:968528.
104.
García MJ, Angulo M, Romera FJ, Lucena C, Pérez-Vicente R. 2022. A shoot derived long distance iron signal may act upstream of the IMA peptides in the regulation of Fe deficiency responses in Arabidopsis thaliana roots. Front Plant Sci 13:971773.
105.
Römheld V, Marschner H. 1981. Iron deficiency stress induced morphological and physiological changes in root tips of sunflower. Physiol Plant 53:354–360.
106.
Miranda-Fuentes P, Quesada-Moraga E, Aldebis HK, Yousef-Naef M. 2020. Compatibility between the endoparasitoid Hyposoter didymator and the entomopathogenic fungus Metarhizium brunneum: a laboratory simulation for the simultaneous use to control Spodoptera littoralis. Pest Manag Sci 76:1060–1070.
107.
Raya-Díaz S, Sánchez-Rodríguez AR, Segura-Fernández JM, Del Campillo MDC, Quesada-Moraga E. 2017. Entomopathogenic fungi-based mechanisms for improved Fe nutrition in sorghum plants grown on calcareous substrates. PLoS One 12:e0185903.
108.
Raya DS. 2017. Los hongos entomopatógenos endófitos mejoran la nutrición férrica y el crecimiento vegetal. Ph.D. thesis. Universidad de Córdoba, Córdoba, Spain.
109.
Raya-Díaz S, Quesada-Moraga E, Barrón V, del Campillo MC, Sánchez–Rodríguez AR. 2017. Redefining the dose of the entomopathogenic fungus Metarhizium brunneum (Ascomycota, Hypocreales) to increase Fe bioavailability and promote plant growth in calcareous and sandy soils. Plant Soil 418:387–404.
110.
García MJ, Lucena C, Romera FJ, Alcántara E, Pérez-Vicente R. 2010. Ethylene and nitric oxide involvement in the up-regulation of key genes related to iron acquisition and homeostasis in Arabidopsis. J Exp Bot 61:3885–3899.
111.
García MJ, Suárez V, Romera FJ, Alcántara E, Pérez-Vicente R. 2011. A new model involving ethylene, nitric oxide and Fe to explain the regulation of Fe-acquisition genes in Strategy I plants. Plant Physiol Biochem 49:537–544.
112.
García MJ, Romera FJ, Stacey MG, Stacey G, Villar E, Alcántara E, Pérez-Vicente R. 2013. Shoot to root communication is necessary to control the expression of iron-acquisition genes in Strategy I plants. Planta 237:65–75.
113.
Lucena C, Waters BM, Romera FJ, García MJ, Morales M, Alcántara E, Pérez-Vicente R. 2006. Ethylene could influence ferric reductase, iron transporter, and H+-ATPase gene expression by affecting FER (or FER-like) gene activity. J Exp Bot 57:4145–4154.
114.
Pfaffl MW. 2001. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 29:e45.
115.
NCBI. 2023. Basic Local Alignment Search Tool. The National Center for Biotechnology Information, Bethesda, MD. https://blast.ncbi.nlm.nih.gov/Blast.cgi.
116.
González-Mas N, Sánchez-Ortiz A, Valverde-García P, Quesada-Moraga E. 2019. Effects of endophytic entomopathogenic Ascomycetes on the life-history traits of Aphis gossypii Glover and its interactions with melon plants. Insects 10:165.
117.
Barelli L, Moreira CC, Bidochka MJ. 2018. Initial stages of endophytic colonization by Metarhizium involves rhizoplane colonization. Microbiology (Reading) 164:1531–1540.
118.
Bell AS, Blanford S, Jenkins N, Thomas MB, Read AF. 2009. Real-time quantitative PCR for analysis of candidate fungal biopesticides against malaria: technique validation and first applications. J Invertebr Pathol 100:160–168.
Information & Contributors
Information
Published In
Applied and Environmental Microbiology
Volume 89 • Number 8 • 30 August 2023
eLocator: e00940-23
Editor: Irina S. Druzhinina, Royal Botanic Gardens
PubMed: 37439674
Copyright
© 2023 García-Espinoza et al. This is an open-access article distributed under the terms of the Creative Commons Attribution 4.0 International license.
History
Received: 6 June 2023
Accepted: 25 June 2023
Published online: 13 July 2023
Keywords
Contributors
Editor
Irina S. Druzhinina
Editor
Royal Botanic Gardens
Metrics & Citations
Metrics
Note:
- For recently published articles, the TOTAL download count will appear as zero until a new month starts.
- There is a 3- to 4-day delay in article usage, so article usage will not appear immediately after publication.
- Citation counts come from the Crossref Cited by service.
Citations
Citation
2023.
Entomopathogenic Fungus-Related Priming Defense Mechanisms in Cucurbits Impact Spodoptera littoralis (Boisduval) Fitness. Appl Environ Microbiol
89:e00940-23.
If you have the appropriate software installed, you can download article citation data to the citation manager of your choice. For an editable text file, please select Medlars format which will download as a .txt file. Simply select your manager software from the list below and click Download.