Advertisement

ABSTRACT

Actinobacillus pleuropneumoniae causes porcine pleuropneumonia, an important disease in the pig industry. Accurate and sensitive diagnostics such as DNA-based diagnostics are essential for preventing or responding to an outbreak. The specificity of DNA-based diagnostics depends on species-specific markers. Previously, an insertion element was found within an A. pleuropneumoniae-specific gene commonly used for A. pleuropneumoniae detection, prompting the need for additional species-specific markers. Herein, 12 marker candidates highly conserved (99 – 100% identity) among 34 A. pleuropneumoniae genomes (covering 13 serovars) were identified to be A. pleuropneumoniae-specific in silico, as these sequences are distinct from 30 genomes of 13 other Actinobacillus and problematic [Actinobacillus] species and more than 1700 genomes of other bacteria in the Pasteurellaceae family. Five marker candidates are within the apxIVA gene, a known A. pleuropneumoniae-specific gene, validating our in silico marker discovery method. Seven other A. pleuropneumoniae-specific marker candidates within the eamA, nusG, sppA, xerD, ybbN, ycfL, and ychJ genes were validated by polymerase chain reaction (PCR) to be specific to 129 isolates of A. pleuropneumoniae (covering all 19 serovars), but not to four closely related Actinobacillus species, four [Actinobacillus] species, or seven other bacterial species. This is the first study to identify A. pleuropneumoniae-specific markers through genome mining. Seven novel A. pleuropneumoniae-specific DNA markers were identified by a combination of in silico and molecular methods and can serve as additional or alternative targets for A. pleuropneumoniae diagnostics, potentially leading to better control of the disease.
IMPORTANCE Species-specific markers are crucial for infectious disease diagnostics. Mutations within a marker sequence can lead to false-negative results, inappropriate treatment, and economic loss. The availability of several species-specific markers is therefore desirable. In this study, 12 DNA markers specific to A. pleuropneumoniae, a pig pathogen, were simultaneously identified. Five marker candidates are within a known A. pleuropneumoniae-specific gene. Seven novel markers can be used as additional targets in DNA-based diagnostics, which in turn can expedite disease diagnosis, assist farm management, and lead to better animal health and food security. The marker discovery strategy outlined herein requires less time, effort, and cost, and results in more markers compared with conventional methods. Identification of species-specific markers of other pathogens and corresponding infectious disease diagnostics are possible, conceivably improving health care and the economy.

INTRODUCTION

Porcine pleuropneumonia is an important disease with high economic impact for the swine industry (1, 2). Economic loss from the disease is attributed to pig mortality, reduction in daily weight gain, a longer rearing period, lower feed efficiency, as well as medication and veterinary expenses (1, 2). Porcine pleuropneumonia affects pigs of all ages. The disease can be acute with fibrino-hemorrhagic and necrotizing pneumonia, leading to sudden death (3, 4). Pigs that survive acute infection or recover after remedial treatment may become disease carriers (3, 4). It is therefore important to monitor pigs for pleuropneumonia to ensure that they remain free of the disease to promote animal health, food security, and the economy.
The causative agent of porcine pleuropneumonia is Actinobacillus pleuropneumoniae, a Gram-negative bacterial pathogen of the pig respiratory tract. This species currently consists of 19 serovars (5), which can be distinguished mainly by unique capsular polysaccharide (CPS) antigens, as lipopolysaccharide O-antigens (LPS O-Ags) can be shared by groups of serovars such as 1/9/11, 3/6/8/15 and 4/7 (6, 7). Despite some genomic differences among various serovars, core genes exist (8) and potentially contain species-specific DNA markers.
A. pleuropneumoniae diagnostics are important for surveillance, prevention, and control of porcine pleuropneumonia. Effective diagnostics can guide decisions on antibiotic treatment, quarantine, and vaccine usage. Diagnosis based on clinical signs can be unreliable, as symptoms may be common to various respiratory diseases. The ability to correctly identify and distinguish the species of interest from closely related species is important for guiding an appropriate response to a disease outbreak. DNA-based detection methods such as polymerase chain reaction (PCR) can be highly specific, allowing discrimination of different species when the targeted DNA sequences are sufficiently unique. Amplification of A. pleuropneumoniae-specific DNA in pig-derived samples (e.g., lung tissues, nasal swabs, tonsils, and oral fluids) is therefore exploited for disease diagnosis (912).
Many DNA markers and PCR assays for A. pleuropneumoniae detection have been reported (3, 5, 9, 1315). Some assays, however, have limitations regarding their specificity, as they are unable to distinguish A. pleuropneumoniae from closely related Actinobacillus species (3, 5, 1316). Assays based on the apxIVA gene, encoding a repeats-in-toxin (RTX) family protein, are A. pleuropneumoniae-specific (9), making this gene an excellent target for A. pleuropneumoniae detection. However, mutations within species-specific markers, especially at or within primer binding sites, can lead to diagnostic evasion (5, 1719). An example of serodiagnostic escape in A. pleuropneumoniae is the AP76 strain which contains the ISApl1 insertion element in the apxIVA gene. The insertion element disrupts the gene, ablates ApxIV expression, and prevents ApxIV-based serological detection (Tegetmeyer et al., 2008). Depending on the primers used, such insertions can affect the results of apxIVA-based PCR assays, possibly leading to misinterpretation (5, 17). The availability of multiple species-specific markers is therefore desirable to ensure accurate detection and prevent diagnostic evasion.
Previously, A. pleuropneumoniae-specific markers were discovered empirically by cross-species hybridization or PCR in which DNA fragments that can serve as species-specific markers were identified (13, 15, 16, 20). Now, with growing numbers of genome sequences of various pathogens available in public databases, these genome assemblies can be utilized for identification of new species-specific DNA markers for diagnostic purpose. Using genome sequence data to identify species-specific markers is superior to empirical testing of DNA fragments, since the content of whole genome can be screened comprehensively in silico, covering more putative markers and potentially yielding more species-specific markers. In this study, whole-genome sequences of A. pleuropneumoniae were mined for novel A. pleuropneumoniae-specific markers. The new markers identified can serve as alternative or additional markers in A. pleuropneumoniae-specific diagnostics.

RESULTS

In silico identification of novel A. pleuropneumoniae-specific DNA marker candidates.

In order to identify new A. pleuropneumoniae-specific DNA markers, 11 complete A. pleuropneumoniae genome assemblies (Table 1) with sizes ranging between 2.24 – 2.41 Mb covering 7 serovars (serovars 1–5, 7, and 8) were analyzed. A. pleuropneumoniae-conserved sequences of 100 – 400 nucleotides sharing 100% identity among the 11 genomes were identified. Using MegaBLAST searches against the nucleotide collection (nr/nt) database and the WGS database of Pasteurellaceae, which include 34 A. pleuropneumoniae genomes covering 13 serovars, 30 genomes of 13 other Actinobacillus and [Actinobacillus] species, 116 genomes of G. parasuis, and 291 genomes of P. multocida (Table 2), 12 A. pleuropneumoniae-conserved sequences were shown to be specific to A. pleuropneumoniae in silico (Table 3). These 12 sequences are called “A. pleuropneumoniae-specific marker candidates.” Each of the marker candidates are highly conserved among A. pleuropneumoniae genomes (Table 3). Five A. pleuropneumoniae-specific marker candidates are within the apxIVA gene, a known A. pleuropneumoniae-specific marker (9, 20), validating our in silico marker identification method as effective. In addition to the five apxIVA sequences, seven sequences also fit the criteria of being A. pleuropneumoniae-specific marker candidates. These seven sequences are within the eamA, nusG, sppA, xerD, ybbN, ycfL, and ychJ genes (Table 3). Nucleotide sequences of these markers are shown in supplemental material. The presence and specificity of these marker candidates were further validated by PCR.
TABLE 1
TABLE 1 Accession numbers of A. pleuropneumoniae complete genome assemblies used for identification of A. pleuropneumoniae-conserved sequencesa
No.StrainSerovarAccession no.Genome size (Mb)Reference
1ATCC 27088T1CP030753.12.32(47)
2ATCC 27088T1CP029003.12.32(8)
3KL161CP022715.12.37(48)
4CCUG 476572LR134515.12.33 
5JL033CP000687.12.24(49)
6ATCC 333784LS483358.12.34 
7L205bCP000569.12.27(50)
8App65CP026009.12.41 
9AP767CP001091.12.35 
10MIDG23318LN908249.12.34(51)
114058CP078508.12.32 
a
ATCC, american type culture collection; CCUG, culture collection university of gothenburg; T indicates type strain of the species.
TABLE 2
TABLE 2 Number of genome assemblies of selected species from the Pasteurellaceae family or of other pig pathogens in the NCBI databases available for in silico comparisona
SpeciesNo. of total genome assemblies
(in the nr/nt and WGS databases)
No. of complete genome assemblies
(in the nr/nt database)
Actinobacillus capsulatus10
[Actinobacillus] delphinicola11
Actinobacillus equuli33
[Actinobacillus] indolicus31
Actinobacillus lignieresii31
[Actinobacillus] minor20
Actinobacillus pleuropneumoniae3411
[Actinobacillus] porcinus20
[Actinobacillus] porcitonsillarum11
[Actinobacillus] seminis20
[Actinobacillus] succinogenes11
Actinobacillus suis72
Actinobacillus ureae30
Actinobacillus vicugnae10
Aggregatibacter actinomycetemcomitans9712
Bibersteinia trehalosi74
Escherichia coli245291782
Glaesserella parasuis11624
Haemophilus haemolyticus684
Haemophilus influenzae77973
Haemophilus parainfluenzae9916
Influenza A virus130127
Mannheimia haemolytica19685
Pasteurella multocida29181
Salmonella enterica123361066
Streptococcus suis162372
a
E. coli, Influenza A virus, S. enterica, and S. suis are not in the Pasteurellaceae family; therefore, only their complete genomes in the nr/nt database were used for in silico marker specificity test. Species with [Actinobacillus] are not officially included in the Actinobacillus genus, but have not yet been assigned to a new genus (25).
TABLE 3
TABLE 3 A. pleuropneumoniae-specific DNA marker candidates identified in silicoa
No.TargetLocus tag in L20 (CP000569)Predicted functionLength (NTs)Match to 11 complete A. pleuropneumoniae genomesMatch to incomplete A. pleuropneumoniae genomes
% query cover% identityNo. of matches in 23 incomplete A. pleuropneumoniae genomes% query cover% identity
1apxIVA-1APL_0998Toxin38510010051
(match more than 1 contig in a genome)
19-10079.43-100
2apxIVA-2APL_0998Toxin1251001001938-10096.8-100
3apxIVA-3APL_0998Toxin3261001002396-10099.08-100
4apxIVA-4APL_0998Toxin31510010023100100
5apxIVA-5APL_0998Toxin11610010023100100
6eamAAPL_1023EamA family transporter; DMT family transporter2031001002310099.51−100
7nusGAPL_1717Transcription termination/ anti-termination protein13910010023100100
8sppAAPL_1268Signal peptide peptidase, protease IV10510010023100100
9xerDAPL_1542Site-specific tyrosine recombinase14910010022
(absent in contigs of ATCC 33377)
100100
10ybbNAPL_0080Cochaperone YbbN; putative thioredoxin-like protein12710010023100100
11ycfLAPL_0125YcfL family protein; putative periplasmic lipoprotein10110010023100100
12ychJAPL_1658YchJ family protein, hypothetical protein, SEC-C motif containing14010010024
(present twice in strain 4226)
10099.29−100
a
Percent query cover and percent identity after performing MegaBLAST searches against the nr/nt or whole-genome sequence (WGS) databases are shown. No similarity between marker candidates and sequences from other species was found by MegaBLAST.

Molecular validation of novel A. pleuropneumoniae-specific markers.

As the apxIVA gene, whose sequence is unique to A. pleuropneumoniae, is a proven A. pleuropneumoniae-specific marker (7, 9, 10, 17), we did not perform PCR to validate the five marker candidates within the apxIVA gene. The presence of seven other marker candidates in A. pleuropneumoniae and other bacteria was examined by PCR using primers specific to each marker candidate and specific to A. pleuropneumoniae genomes in silico (Table 4). Genomic DNA from reference strains of A. pleuropneumoniae covering all 19 serovars, 108 A. pleuropneumoniae field isolates covering serovars 1, 2, 5, 12, 15, and nontypables, eight other Actinobacillus and [Actinobacillus] species, and seven other bacterial species was used as PCR template. For all seven marker candidates (i.e., those within the eamA, nusG, sppA, xerD, ybbN, ycfL, and ychJ genes), PCR amplicons of expected sizes were detected in all A. pleuropneumoniae strains and isolates but were absent in other species (Table 5). Representative gel electrophoresis results are also shown in supplemental material. As controls, two pairs of previously reported apxIVA primers (9) were tested and shown to be A. pleuropneumoniae-specific, as expected, recognizing all A. pleuropneumoniae strains and isolates tested (Table 5). These results indicate that the seven sequences within the eamA, nusG, sppA, xerD, ybbN, ycfL, and ychJ genes are validated as novel A. pleuropneumoniae-specific DNA markers, can serve as additional or alternative targets for A. pleuropneumoniae detection assays, and are interchangeable with apxIVA. The use of more than one marker can prevent diagnostic evasion.
TABLE 4
TABLE 4 Primers used in this study
Primer no.Primer nameSequence (5′ to 3′)
P228eamA-FCACTTCAAGTCGGCACTGTC
P229eamA-RTCATAATAATTGCAGCGTTAGTGA
P230sppA-FCCAACGACGTAAAGCGAATAA
P231sppA-RCGAACAGACTATCGTCGCT
P240xerD-FATAACGTATCTAAAAACTGTTCG
P241xerD-RTAGAATATCTAGGAATAAAAGTAGC
P242ychJ-FCGGTTATTTTTTCAAAATTCTTTGC
P243ychJ-RCGCCTATTTAGCCTAATCC
P250nusG-FGGCTTTGTGATTTTATAAAATAAG
P251nusG-RGCCGATAAAAAACACTTTGTG
P254ybbN -FTCATTATTACGCCGGTTGGC
P255ybbN -RTCACGGTTGCCAATAAAAATTG
P256ycfL-FACTCAACCAAGGTTGCATCG
P257ycfL-RAATCAAGGCATTACACAAACCAA
 ApxIVA-1LTGGCACTGACGGTGATGA (9)
 ApxIVA-1RGGCCATCGACTCAACCAT (9)
 ApxIVANEST-1LGGGGACGTAACTCGGTGATT (9)
 ApxIVANEST-1RGCTCACCAACGTTTGCTCAT (9)
TABLE 5
TABLE 5 Validation of A. pleuropneumoniae-specific markers by PCRa
SpeciesSerovarStrainNo. of strains testedapxIVAMarker candidate
1L-1R
(422)
NEST 1L-1R
(377)
eamA
(192)
nusG
(117)
sppA
(83)
xerD
(74)
ybbN
(58)
ycfL
(54)
ychJ
(66)
A. pleuropneumoniae1ATCC 27088T,
2 field isolates
3++++++++++++++++++
2ATCC 27089,
1 field isolate
2++++++++++++++++++
3ATCC 270901++++++++++++++++++
4ATCC 333781++++++++++++++++++
5ATCC 33377,
L20,
ATCC 55454,
100 field isolates
103++++++++++++++++++
6ATCC 335901++++++++++++++++++
7WF831++++++++++++++++++
84051++++++++++++++++++
9CVJ132611++++++++++++++++++
10D130391++++++++++++++++++
11561531++++++++++++++++++
128328,
1 field isolate
2++++++++++++++++++
13N-2731++++++++++++++++++
1439061++++++++++++++++++
15HS143,
1 field isolate
2++++++++++++++++++
16A-85/141++++++++++++++++++
1716287-11++++++++++++++++++
1873115551++++++++++++++++++
197213384-11++++++++++++++++++
Nontypable3 field isolates3++++++++++++++++++
A. equuli ATCC 93461---------
[A.] indolicus CCUG 39029T1---------
A. lignieresii ATCC 13372,
CCUG 41384T
2---------
[A.] minor CCUG 38923T1---------
[A.] porcinus CCUG 38924T1---------
[A.] rossi ATCC 270721---------
A. suis ATCC 15557,
ATCC 33415T
2---------
A. ureae ATCC 259761---------
B. trehalosi ATCC 333671---------
G. parasuis ATCC 194171---------
 Field isolates6---------
H. influenzae ATCC 333911---------
M. haemolytica ATCC 296961---------
P. multocida ATCC 431371---------
 ATCC BAA-11131---------
S. Choleraesuis ATCC 70011---------
S. suis ATCC 437651---------
a
++, PCR product of expected size was present; -, no PCR product present; numbers in parentheses are expected PCR product sizes in base pairs (bp). Genomic DNA of various bacterial species/strains was tested for the presence of candidate marker sequences using PCR.

DISCUSSION

Identifying species-specific markers for A. pleuropneumoniae previously involved individually testing DNA fragments in cross-hybridization or PCR experiments (9, 13, 15, 20). These methods are time-consuming and incomprehensive, as only a limited number of DNA fragments can be tested. Moreover, some of the resulting detection assays are not species-specific and still show cross-reactivity with closely related species (3, 13, 15). Using comparative genome analysis, based on a strict criterion of 100% nucleotide identity across sequences of 100–400 nucleotides conserved in only 11 complete A. pleuropneumoniae genomes, 12 sequences were identified as putatively A. pleuropneumoniae-specific (Table 3). Other highly conserved sequences with less than 100% conservation among the 11 complete genomes were not considered here but may be useful as A. pleuropneumoniae-specific markers and require further investigation.
Even though 11 complete A. pleuropneumoniae genome assemblies covering serovars 1–5 and 7–8 (Table 1) were used for the initial step of A. pleuropneumoniae-conserved sequences identification, the A. pleuropneumoniae-conserved sequences were later tested for their A. pleuropneumoniae-specificity using the nr/nt nucleotide collection database and the WGS database limited to the Pasteurellaceae family, which include 34 complete and incomplete A. pleuropneumoniae genome assemblies covering serovars 1–13, 30 genome assemblies from 13 other Actinobacillus and [Actinobacillus] species, 116 G. parasuis genome assemblies, and 291 P. multocida genome assemblies (Table 2). Since large genome databases can be accessed and utilized, in silico genome analysis is a powerful tool to guide marker discovery. The more genomes of target species and closely related nontarget species become available, the higher accuracy and specificity of in silico marker discovery will be. Molecular validation is still necessary, especially for marker discovery of species with limited genome data. The more bacterial species and isolates that are available for molecular validation, the more accurate and specific the resulting markers will be.
Five marker candidates identified in this study are within apxIVA, previously reported to be an A. pleuropneumoniae-specific gene (9, 20), confirming that our in silico marker identification method is effective. Nonetheless, the five apxIVA sequences (apxIVA-1-5) identified in this study are not identical to those previously described. As there have been reports of atypical A. pleuropneumoniae isolates failing to amplify the predicted target with existing apxIVA-specific primers (5, 21), our new apxIVA targets provide alternative options for molecular confirmation of A. pleuropneumoniae.
Two apxIVA regions (apxIVA-1 and 2) identified herein are in the 3′ part of apxIVA and are in close proximity to the A. pleuropneumoniae-specific region previously identified in hybridization experiments and some previously published primer pairs (Fig. 1A) (7, 9, 20). The 5′ and central parts of the apxIVA gene were originally disregarded as A. pleuropneumoniae-specific because probes from these regions showed weak hybridization signals with A. lignieresii (9, 20). However, later studies identified additional conserved regions within the 5′ (17) and the central part of apxIVA (10) that can be used as targets for A. pleuropneumoniae molecular detection assays (Fig. 1A). Three newly identified marker candidates (apxIVA-3, 4, and 5) are within the central part of apxIVA (Fig. 1), but do not overlap the conserved regions previously reported (10, 17), as these sequences do not match our criteria of being 100% conserved among the 11 complete genomes. These combined results indicate that our marker discovery strategy does not identify all possible markers but is useful for identifying multiple effective species-specific markers simultaneously.
FIG 1
FIG 1 Locations of previously published primer pairs and newly identified apxIVA marker candidates in the genome of the A. pleuropneumoniae serovar 2 strain CCUG 47657 that contains only the apxIVA gene (A), and in the genome of the A. pleuropneumoniae serovar 8 strain MIDG2331 that contains both apxIVA and apxIV-S genes (B). Previously published primer pairs are shown as arrowheads. Green arrowheads denote primers oAPXIVA-TSP1 and oAPXIVA-TSP2 (17). Blue arrowheads denote primers apxIVA-exo-F and apxIVA-exo-R (10). Purple arrowheads denote primers ApxIVA-1L and ApxIVA-1R (9). Black arrowheads denote primers named apxIVA1 and apxIVA3 (7). Gray rectangles represent regions apxIVA-1 to apxIVA-5 identified in this study (Table 3). Region apxIVA-1′ is 90% identical to apxIVA-1. Region apxIVA-2′ is 94 to 98% identical to region 2. Green rectangles indicate homologous regions between apxIVA and apxIV-S.
In addition to apxIVA, some A. pleuropneumoniae strains also contain apxIV-S, a partial duplication of apxIVA that shares approximately 87% identity with apxIVA in the 3′ region (Fig. 1B) (22). In A. pleuropneumoniae genomes with both apxIVA and apxIV-S, the five new apxIVA marker candidates match to different regions but are still A. pleuropneumoniae-specific in silico (Fig. 1B, Table 3). Regions apxIVA-1′ and 2′ with 90% and 94–98% identity to apxIVA-1 and apxIVA-2, respectively, are also present (Fig. 1). Coamplification of apxIVA-1′ and apxIVA-2′ along with apxIVA-1 and apxIVA-2 is possible but does not alter PCR product sizes and thus detection results. The presence of multiple highly homologous regions in one genomic DNA molecule may serve as more targets for PCR, possibly leading to detection assays with higher sensitivity.
Although not encoding an intact ApxIV protein (NCBI accession no. NZ_LR134169), the NCTC 10568 A. lignieresii genome contains sequences (comprising multiple open reading frames) sharing 73% identity over 71% of the A. pleuropneumoniae apxIVA sequence (71% query cover), as determined by BLASTn. Five A. pleuropneumoniae-specific apxIVA marker candidates identified here do not share significant similarity with the apxIVA-like sequences in A. lignieresii, as determined by default parameters of MegaBLAST search against databases which include three complete and incomplete A. lignieresii genomes (Table 3). In short, five A. pleuropneumoniae-specific apxIVA regions are A. pleuropneumoniae-specific despite the presence of apxIVA-like sequences in A. lignieresii. Nonetheless, cross-reactivity with A. lignieresii in pig-derived samples is unlikely, as A. lignieresii is a pathogen of cattle and sheep (23).
In addition to sequences within apxIVA, seven novel marker candidates that map to various genes were identified. Six newly identified A. pleuropneumoniae-specific markers, namely, eamA, nusG, sppA, ybbN, ycfL, and ychJ, share 100% identity among all 11 complete A. pleuropneumoniae genome assemblies and 99.29–100% identity among all 23 incomplete A. pleuropneumoniae genome assemblies, confirming their highly conserved nature among A. pleuropneumoniae genomes. These six sequences are also A. pleuropneumoniae-specific compared in silico with available databases (Table 3) and when tested by PCR with DNA from available bacterial species and strains (Table 5).
The last marker candidate, xerD, shares 100% identity among all 11 complete A. pleuropneumoniae genomes but is found only in 22 out of 23 incomplete A. pleuropneumoniae genomes. The xerD marker candidate is absent in genome contigs of the ATCC 33377 strain (CABEFA01), suggesting that the ATCC 33377 genome may not contain xerD or the contigs that contain whole xerD marker sequence are absent in the genome assemblies. The xerD sequence identified is only 149 nucleotides in length. Assembling contigs to contain this short sequence should not be difficult unless the genome contains multiple sequences homologous to xerD. As seen in the case of apxIVA-2, when performing MegaBLAST searches against the Pasteurellaceae WGS database, only 19 out of 23 matches with A. pleuropneumoniae incomplete genomes (38–100% query cover and 96.8–100% identity) were observed (Table 3). Nonetheless, xerD-specific PCR product was observed when genomic DNA from the ATCC 33377 strain was used as the template (Table 5 and 6), indicating that xerD can also serve as a marker for A. pleuropneumoniae identification.
TABLE 6
TABLE 6 Bacteria used in this studya
Genus and speciesSerovarStrain nameSource/referencec
Actinobacillus pleuropneumoniae1ATCC 27088TATCC (33)
2ATCC 27089ATCC (33)
3ATCC 27090ATCC (33)
4ATCC 33378ATCC (34)
5aATCC 33377ATCC (34, 35)
5bL20(34, 35)
5ATCC 55454ATCC
6ATCC 33590ATCC (36)
7WF83(37)
8405(38)
9CVJ13261(39)
10D13039(40)
1156153(41)
128328Denmark
13N-273(42)
143906(43)
15HS143(44)
16A-85/14(45)
1716287-1(46)
187311555(46)
197213384-1(5)
1 [2]b
2 [1]
5 [100]
12 [1]
15 [1]
Nontypable [3]
Field isolates from Thailand [108]This study
Actinobacillus equuli ATCC 9346ATCC
[Actinobacillus] indolicus CCUG 39029TCCUG
Actinobacillus lignieresii ATCC 13372ATCC
 CCUG 41384TCCUG
[Actinobacillus] minor CCUG 38923TCCUG
[Actinobacillus] porcinus CCUG 38924TCCUG
[Actinobacillus] rossi ATCC 27072ATCC
Actinobacillus suis ATCC 15557ATCC
 ATCC 33415TATCC
Actinobacillus ureae ATCC 25976ATCC
Bibersteinia trehalosi ATCC 33367ATCC
Glaesserella parasuis ATCC 19417ATCC
 Field isolates from Thailand [6]This study
Haemophilus influenzae ATCC 33391ATCC
Mannheimia haemolytica ATCC 29696ATCC
Pasteurella multocida ATCC 43137ATCC
 ATCC BAA-1113ATCC
Salmonella enterica subsp. entericaCholeraesuisATCC 7001ATCC
Streptococcus suis ATCC 43765ATCC
a
ATCC, american type culture collection; CCUG, culture collection university of gothenburg.
b
Numbers in brackets indicate the number of isolates. T indicates type strain of the species. Species with [Actinobacillus] are not officially included in the Actinobacillus genus, but have not yet been assigned to a new genus (25).
c
The Langford laboratory was the source of bacteria (or gDNA) that were not purchased from ATCC or CCUG. The growth and preparation of derived gDNA from these strains was carried out as described previously (5).
The use of multiple targets in a diagnostic assay can reduce false-negative results among A. pleuropneumoniae strains that may evade current detection methods. These novel A. pleuropneumoniae-specific markers could serve as targets for other DNA amplification assays such as isothermal amplification assays, which are more field-ready than PCR.
In conclusion, this study demonstrates how comparative genomics and molecular validation can accelerate species-specific marker discovery, save time, labor, and cost, and result in more markers compared with traditional marker discovery by hybridization or PCR experiments. The marker discovery strategy described herein can be applied to other species with sufficient genome data, leading to novel markers and diagnostic assays for infectious diseases.

MATERIALS AND METHODS

The experiments using Actinobacillus and other bacterial species were approved by BIOTEC and Chulalongkorn University Institutional Review Boards on Biosafety and Biosecurity with approval numbers BT-IBC-61-026 and IBC1831058, respectively.

A. pleuropneumoniae isolation from clinical samples.

A. pleuropneumoniae was isolated from lung or pleural fluid samples from pigs with clinical signs of respiratory disease submitted to the Livestock Animal Hospital, Chulalongkorn University, Nakhon Pathom, Thailand during 2017–2018, as per standard techniques (24). Briefly, clinical samples were cultured on blood agar (containing 5% sheep red blood cells) with a Staphylococcus aureus nurse streak and incubated at 37°C with 5% CO2. Hemolytic colonies with a satellite characteristic around the S. aureus streak were further tested by Gram staining, Christie–Atkins–Munch-Peterson (CAMP) reaction with S. aureus, and catalase and oxidase tests. Species validation and molecular serotyping were performed using multiplex PCR targeting apxIVA and cps genes (7).

Bacterial strains and growth conditions.

Bacterial strains used to test the presence of DNA markers in this study are either in the Pasteurellaceae family or are present in pigs as commensal or pathogenic bacteria (Table 6). Bacteria (or genomic DNA) were purchased from the American Type Culture Collection (ATCC) or Culture Collection of University of Gothenburg (CCUG) or obtained from the Langford laboratory as indicated (Table 6). Some [Actinobacillus] species such as [A.] indolicus, [A.] minor, and [A.] porcinus are not officially included in the Actinobacillus genus but have not yet been assigned to a new genus (25). These species are herein described as [Actinobacillus.] Actinobacillus and [Actinobacillus] species, Glaesserella parasuis, Pasteurella multocida, and Haemophilus influenzae were grown on chocolate blood agar supplemented with IsoVitalex (BBL, BD, Franklin Lakes, NJ, USA) at 37°C with 5% CO2. Bibersteinia trehalosi, Mannheimia haemolytica, Salmonella enterica serovar Choleraesuis, and Streptococcus suis were grown on brain heart infusion (BHI) plates at 37°C with 5% CO2.

In silico DNA marker identification.

In the initial step, 11 complete genome assemblies covering serovars 1–5 and 7–8 (Table 1) were selected for analysis in consideration for algorithm efficiency. Sequences of 100 – 400 nucleotides in length that share 100% identity among the 11 complete genomes were selected by a custom script as “A. pleuropneumoniae-conserved sequences.” In the second step, these A. pleuropneumoniae-conserved sequences were used as queries to search for highly similar sequences using MegaBLAST (2628). Searches were performed against the nucleotide collection (nr/nt) database, which contains sequences from GenBank, EMBL, DDBJ, PDB, and RefSeq, but excludes draft whole-genome contigs (WGS). Nineteen A. pleuropneumoniae-conserved sequences were identified to be specific to A. pleuropneumoniae genomes compared with the nr/nt database. In the third step, these 19 A. pleuropneumoniae-conserved sequences were used as queries to search for highly similar sequences in the WGS database containing draft genome contigs, limited to sequences of the Pasteurellaceae family, using MegaBLAST. Twelve A. pleuropneumoniae-conserved sequences remained specific to A. pleuropneumoniae genomes in silico compared with the WGS database and were considered “A. pleuropneumoniae-specific marker candidates.” The number of genome assemblies of selected species (in the same family as A. pleuropneumoniae or also present in pigs) available for in silico comparison is shown in Table 2.

In silico primer design.

BLASTn (26, 27), suitable for identification of more dissimilar sequences, was used to identify sequences of non-A. pleuropneumoniae species that share more than 70% identity with A. pleuropneumoniae-specific marker candidates from the nucleotide collection (nr/nt) database. Multiple alignment of A. pleuropneumoniae-specific marker candidates and similar sequences from other species was performed using Clustal Omega (29, 30). Regions with high mismatch between A. pleuropneumoniae and non-A. pleuropneumoniae species were selected for PCR primer design. Primer BLAST (31) searches against the nr/nt database were used to confirm that the newly designed PCR primers (Table 4) yielded PCR products of expected size only when A. pleuropneumoniae genomes were used as template.

Genomic DNA purification and PCR amplification.

Genomic DNA of various bacterial species was extracted using a standard DNA purification protocol (32). PCR was performed using Taq DNA polymerase with Standard Taq Buffer (M0273, New England Biolabs, Ipswich, MA, USA) according to the manufacturer’s protocol. Briefly, PCRs were prepared to contain final concentrations of 200 μM dNTPs, 0.2 μM each primer (Table 4), 0.025 U/μl Taq DNA polymerase, and 1 ng/μL of bacterial genomic DNA. Thirty cycles of 95°C for 30 s, 60°C for 1 min, and 68°C for 1 min were performed using a C1000 Touch PCR Thermal Cycler (Bio-Rad, Hercules, CA, USA). PCR products were visualized by agarose gel electrophoresis followed by ethidium bromide staining. Alternatively, Luna qPCR Master Mix (M3003, New England Biolabs) was used according to the manufacturer’s protocol. Briefly, qPCRs were prepared to contain final concentrations of 0.25 μM each primer and 1 ng/μL of bacterial genomic DNA. Forty-five cycles of 95°C for 15 s and 60°C for 30 s were performed using a Bio-Rad CFX96 real-time PCR machine. Fluorescence signals indicative of the presence of PCR products were measured.

ACKNOWLEDGMENTS

This study was funded by grants from National Center for Genetic Engineering and Biotechnology (BIOTEC) (P18-50442), National Science and Technology Development Agency (NSTDA) (P20-50968), Thammasat University Research Fund under the TU Research Scholar, Contract No. TP 2/24/2560, and the UK BBSRC (BB/S002103/1). U.L. was supported by BIOTEC (P16-52034) and NSTDA (P20-50077). We thank Philip J. Shaw for suggestions on the manuscript.

Supplemental Material

File (spectrum01311-21_supp_1_seq4.pdf)
ASM does not own the copyrights to Supplemental Material that may be linked to, or accessed through, an article. The authors have granted ASM a non-exclusive, world-wide license to publish the Supplemental Material files. Please contact the corresponding author directly for reuse.

REFERENCES

1.
Stygar AH, Niemi JK, Oliviero C, Laurila T, Heinonen M. 2016. Economic value of mitigating Actinobacillus pleuropneumoniae infections in pig fattening herds. Agric Sys 144:113–121.
2.
Losinger WC. 2005. Economic impacts of reduced pork production associated with the diagnosis of Actinobacillus pleuropneumoniae on grower/finisher swine operations in the United States. Prev Vet Med 68:181–193.
3.
Gottschalk M. 2015. The challenge of detecting herds sub-clinically infected with Actinobacillus pleuropneumoniae. Vet J 206:30–38.
4.
Sassu EL, Bossé JT, Tobias TJ, Gottschalk M, Langford PR, Hennig-Pauka I. 2018. Update on Actinobacillus pleuropneumoniae-knowledge, gaps and challenges. Transbound Emerg Dis 65 Suppl 1:72–90.
5.
Stringer OW, Bossé JT, Lacouture S, Gottschalk M, Fodor L, Angen Ø, Velazquez E, Penny P, Lei L, Langford PR, Li Y. 2021. Proposal of Actinobacillus pleuropneumoniae serovar 19, and reformulation of previous multiplex PCRs for capsule-specific typing of all known serovars. Vet Microbiol 255:109021.
6.
Dubreuil JD, Jacques M, Mittal KR, Gottschalk M. 2000. Actinobacillus pleuropneumoniae surface polysaccharides: their role in diagnosis and immunogenicity. Anim Health Res Rev 1:73–93.
7.
Bossé JT, Li Y, Fernandez Crespo R, Lacouture S, Gottschalk M, Sárközi R, Fodor L, Casas Amoribieta M, Angen Ø, Nedbalcova K, Holden MTG, Maskell DJ, Tucker AW, Wren BW, Rycroft AN, Langford PR, BRaDP1T consortium. 2018. Comparative sequence analysis of the capsular polysaccharide loci of Actinobacillus pleuropneumoniae serovars 1–18, and development of two multiplex PCRs for comprehensive capsule typing. Vet Microbiol 220:83–89.
8.
Xu Z, Chen X, Li L, Li T, Wang S, Chen H, Zhou R. 2010. Comparative genomic characterization of Actinobacillus pleuropneumoniae. J Bacteriol 192:5625–5636.
9.
Schaller A, Djordjevic SP, Eamens GJ, Forbes WA, Kuhn R, Kuhnert P, Gottschalk M, Nicolet J, Frey J. 2001. Identification and detection of Actinobacillus pleuropneumoniae by PCR based on the gene apxIVA. Vet Microbiol 79:47–62.
10.
Li R, Wang J, Liu L, Zhang R, Hao X, Han Q, Wang J, Yuan W. 2019. Direct detection of Actinobacillus pleuropneumoniae in swine lungs and tonsils by real-time recombinase polymerase amplification assay. Mol Cell Probes 45:14–18.
11.
Gonzalez W, Gimenez-Lirola LG, Holmes A, Lizano S, Goodell C, Poonsuk K, Sitthicharoenchai P, Sun Y, Zimmerman J. 2017. Detection of Actinobacillus pleuropneumoniae ApxIV toxin antibody in serum and oral fluid specimens from pigs inoculated under experimental conditions. J Vet Res 61:163–171.
12.
Stringer OW, Bossé JT, Lacouture S, Gottschalk M, Fodor L, Angen Ø, Velazquez E, Penny P, Lei L, Langford PR, Li Y. 2021. Rapid detection and typing of Actinobacillus pleuropneumoniae serovars directly from clinical samples: combining FTA card technology with multiplex PCR. Front Vet Sci 8:728660.
13.
Sirois M, Lemire EG, Levesque RC. 1991. Construction of a DNA probe and detection of Actinobacillus pleuropneumoniae by using polymerase chain reaction. J Clin Microbiol 29:1183–1187.
14.
Gram T, Ahrens P. 1998. Improved diagnostic PCR assay for Actinobacillus pleuropneumoniae based on the nucleotide sequence of an outer membrane lipoprotein. J Clin Microbiol 36:443–448.
15.
Chiers K, Van Overbeke I, Donne E, Baele M, Ducatelle R, De Baere T, Haesebrouck F. 2001. Detection of Actinobacillus pleuropneumoniae in cultures from nasal and tonsillar swabs of pigs by a PCR assay based on the nucleotide sequence of a dsbE-like gene. Vet Microbiol 83:147–159.
16.
Hernanz Moral C, Cascon Soriano A, Sanchez Salazar M, Yugueros Marcos J, Suarez Ramos S, Naharro Carrasco G. 1999. Molecular cloning and sequencing of the aroA gene from Actinobacillus pleuropneumoniae and its use in a PCR assay for rapid identification. J Clin Microbiol 37:1575–1578.
17.
Tegetmeyer HE, Jones SC, Langford PR, Baltes N. 2008. ISApl1, a novel insertion element of Actinobacillus pleuropneumoniae, prevents ApxIV-based serological detection of serotype 7 strain AP76. Vet Microbiol 128:342–353.
18.
Turni C, Blackall PJ. 2011. An unusual strain of Haemophilus parasuis that fails to react in a species-specific polymerase chain reaction assay. J Vet Diagn Invest 23:355–358.
19.
Metzgar D. 2011. Adaptive evolution of diagnostic resistance. J Clin Microbiol 49:2774–2775.
20.
Schaller A, Kuhn R, Kuhnert P, Nicolet J, Anderson TJ, Maclnnes JI, Segers R, Frey J. 1999. Characterization of apxIVA, a new RTX determinant of Actinobacillus pleuropneumoniae. Microbiology 145:2105–2116.
21.
Sievers F, Wilm A, Dineen D, Gibson TJ, Karplus K, Li W, Lopez R, McWilliam H, Remmert M, Soding J, Thompson JD, Higgins DG. 2011. Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega. Mol Syst Biol 7:539.
22.
Ye J, Coulouris G, Zaretskaya I, Cutcutache I, Rozen S, Madden TL. 2012. Primer-BLAST: a tool to design target-specific primers for polymerase chain reaction. BMC Bioinformatics 13:134.
23.
Wilson K. 1997. Preparation of genomic DNA from bacteria, Current Protocols in Molecular Biology. John Wiley & Sons, Inc.
24.
Bossé JT, Li Y, Angen Ø, Weinert LA, Chaudhuri RR, Holden MT, Williamson SM, Maskell DJ, Tucker AW, Wren BW, Rycroft AN, Langford PR, BRaDP1T consortium. 2014. Multiplex PCR assay for unequivocal differentiation of Actinobacillus pleuropneumoniae serovars 1 to 3, 5 to 8, 10, and 12. J Clin Microbiol 52:2380–2385.
25.
Li Y, Cao S, Zhang L, Yuan J, Zhao Q, Wen Y, Wu R, Huang X, Yan Q, Huang Y, Ma X, Han X, Miao C, Wen X. 2019. A requirement of TolC1 for effective survival, colonization and pathogenicity of Actinobacillus pleuropneumoniae. Microb Pathog 134:103596.
26.
Markey B, Leonard F, Archambault M, Cullinane A, Maguire D. 2013. Clinical Veterinary Microbiology. Elsevier Health Sciences, Edinburgh, Scotland.
27.
Blackall PJ, Turni C. 2020. Actinobacillus, p 1–14. In Trujillo ME, Dedysh S, DeVos P, Hedlund B, Kämpfer P, Rainey FA, Whitman WB (ed), Bergey's Manual of Systematics of Archaea and Bacteria. John Wiley & Sons, Inc.
28.
Rycroft AN, Garside LH. 2000. Actinobacillus species and their role in animal disease. Vet J 159:18–36.
29.
Morgulis A, Coulouris G, Raytselis Y, Madden TL, Agarwala R, Schaffer AA. 2008. Database indexing for production MegaBLAST searches. Bioinformatics 24:1757–1764.
30.
Boratyn GM, Camacho C, Cooper PS, Coulouris G, Fong A, Ma N, Madden TL, Matten WT, McGinnis SD, Merezhuk Y, Raytselis Y, Sayers EW, Tao T, Ye J, Zaretskaya I. 2013. BLAST: a more efficient report with usability improvements. Nucleic Acids Res 41:W29–33.
31.
Camacho C, Coulouris G, Avagyan V, Ma N, Papadopoulos J, Bealer K, Madden TL. 2009. BLAST+: architecture and applications. BMC Bioinformatics 10:421.
32.
Sievers F, Higgins DG. 2021. The clustal omega multiple alignment package. Methods Mol Biol 2231:3–16.
33.
Nicolet J. 1971. [Haemophilus infection in pigs. 3. Serological studies on Haemophilus parahaemolyticus]. Zentralbl Bakteriol Orig 216:487–495.
34.
Gunnarsson A, Biberstein EL, Hurvell B. 1977. Serologic studies on porcine strains of Haemophilus parahaemolyticus (pleuropneumoniae): agglutination reactions. Am J Vet Res 38:1111–1114.
35.
Nielsen R. 1986. Serology of Haemophilus (Actinobacillus) pleuropneumoniae serotype 5 strains: establishment of subtypes a and b. Acta Vet Scand 27:49–58.
36.
Nielsen R. 1985. Haemophilus pleuropneumoniae (Actinobacillus pleuropneumoniae). Serotypes 8, 3 and 6. Serological response and cross immunity in pigs. Nord Vet Med 37:217–227.
37.
Rosendal S, Boyd DA. 1982. Haemophilus pleuropneumoniae serotyping. J Clin Microbiol 16:840–843.
38.
Nielsen R, O'Connor PJ. 1984. Serological characterization of 8 Haemophilus pleuropneumoniae strains and proposal of a new serotype: serotype 8. Acta Vet Scand 25:96–106.
39.
Nielsen R. 1985. Serological characterization of Haemophilus pleuropneumoniae (Actinobacillus pleuropneumoniae) strains and proposal of a new serotype: serotype 9. Acta Vet Scand 26:501–512.
40.
Nielsen R. 1985. Serological characterization of Haemophilus pleuropneumoniae (Actinobacillus pleuropneumoniae) strains and proposal of a new serotype: serotype 10. Acta Vet Scand 26:581–585.
41.
Kamp EM, Popma JK, Van Leengoed LA. 1987. Serotyping of Haemophilus pleuropneumoniae in the Netherlands: with emphasis on heterogeneity within serotype 1 and (proposed) serotype 9. Vet Microbiol 13:249–257.
42.
Fodor L, Varga J, Molnar E, Hajtos I. 1989. Biochemical and serological properties of Actinobacillus pleuropneumoniae biotype 2 strains isolated from swine. Vet Microbiol 20:173–180.
43.
Nielsen R, Andresen LO, Plambeck T, Nielsen JP, Krarup LT, Jorsal SE. 1997. Serological characterization of Actinobacillus pleuropneumoniae biotype 2 strains isolated from pigs in two Danish herds. Vet Microbiol 54:35–46.
44.
Blackall PJ, Klaasen HL, van den Bosch H, Kuhnert P, Frey J. 2002. Proposal of a new serovar of Actinobacillus pleuropneumoniae: serovar 15. Vet Microbiol 84:47–52.
45.
Sárközi R, Makrai L, Fodor L. 2015. Identification of a proposed new serovar of Actinobacillus pleuropneumoniae: serovar 16. Acta Vet Hung 63:444–450.
46.
Bossé JT, Li Y, Sárközi R, Fodor L, Lacouture S, Gottschalk M, Casas Amoribieta M, Angen Ø, Nedbalcova K, Holden MTG, Maskell DJ, Tucker AW, Wren BW, Rycroft AN, Langford PR, BRaDP1T consortium. 2018. Proposal of serovars 17 and 18 of Actinobacillus pleuropneumoniae based on serological and genotypic analysis. Vet Microbiol 217:1–6.
47.
Dona V, Perreten V. 2018. Comparative genomics of the first and complete genome of “Actinobacillus porcitonsillarum” supports the novel species hypothesis. Int J Genomics 2018:5261719.
48.
Park BS, Han J, Shin DJ, Jeong YJ, Lee N. 2017. Complete genome sequence of Actinobacillus pleuropneumoniae strain KL 16 (serotype 1). Genome Announc 5:e01025-17.
49.
Xu Z, Zhou Y, Li L, Zhou R, Xiao S, Wan Y, Zhang S, Wang K, Li W, Li L, Jin H, Kang M, Dalai B, Li T, Liu L, Cheng Y, Zhang L, Xu T, Zheng H, Pu S, Wang B, Gu W, Zhang XL, Zhu GF, Wang S, Zhao GP, Chen H. 2008. Genome biology of Actinobacillus pleuropneumoniae JL03, an isolate of serotype 3 prevalent in China. PLoS One 3:e1450.
50.
Foote SJ, Bossé JT, Bouevitch AB, Langford PR, Young NM, Nash JH. 2008. The complete genome sequence of Actinobacillus pleuropneumoniae L20 (serotype 5b). J Bacteriol 190:1495–1496.
51.
Bossé JT, Chaudhuri RR, Li Y, Leanse LGF, Crespo R, Coupland P, Holden MT, Bazzolli DM, Maskell DJ, Tucker AW, Wren BW, Rycroft AN, Langford PR. 2016. Complete genome sequence of MIDG2331, a genetically tractable serovar 8 clinical isolate of Actinobacillus pleuropneumoniae. Genome Announc 4:e01667-15.

Information & Contributors

Information

Published In

cover image Microbiology Spectrum
Microbiology Spectrum
Volume 10Number 123 February 2022
eLocator: e01311-21
Editor: Sandeep Tamber, Health Canada

History

Received: 23 August 2021
Accepted: 2 December 2021
Published online: 5 January 2022

Peer Review History

Download review history as PDF.

Permissions

Request permissions for this article.

Keywords

  1. species-specific DNA markers
  2. Actinobacillus pleuropneumoniae
  3. porcine pleuropneumonia
  4. diagnostics
  5. marker discovery

Contributors

Authors

Gun Srijuntongsiri
School of Information, Computer, and Communication Technology (ICT), Sirindhorn International Institute of Technology, Thammasat University, Pathum Thani, Thailand
Atiwat Mhoowai
National Center for Genetic Engineering and Biotechnology (BIOTEC), National Science and Technology Agency (NSTDA), Pathum Thani, Thailand
Sukuma Samngamnim
Department of Veterinary Medicine, Faculty of Veterinary Science, Chulalongkorn University, Bangkok, Thailand
Pornchalit Assavacheep
Department of Veterinary Medicine, Faculty of Veterinary Science, Chulalongkorn University, Bangkok, Thailand
Section of Paediatric Infectious Disease, Department of Infectious Disease, Imperial College London, London, United Kingdom
Section of Paediatric Infectious Disease, Department of Infectious Disease, Imperial College London, London, United Kingdom
Navaporn Posayapisit
National Center for Genetic Engineering and Biotechnology (BIOTEC), National Science and Technology Agency (NSTDA), Pathum Thani, Thailand
Ubolsree Leartsakulpanich
National Center for Genetic Engineering and Biotechnology (BIOTEC), National Science and Technology Agency (NSTDA), Pathum Thani, Thailand
National Center for Genetic Engineering and Biotechnology (BIOTEC), National Science and Technology Agency (NSTDA), Pathum Thani, Thailand

Editor

Sandeep Tamber
Editor
Health Canada

Reviewer

Jinlin Liu
ad hoc peer reviewer
College of Life Science, Central China Normal University

Notes

The authors declare no conflict of interest.

Metrics & Citations

Metrics

VIEW ALL METRICS

Citations

If you have the appropriate software installed, you can download article citation data to the citation manager of your choice. Simply select your manager software from the list below and click Download.

View Options

View options

PDF/ePub

PDF/ePub

Get Access

Buy Article
Microbiology Spectrum Vol.10 • Issue 1 • ASM Journals Pay Per View, PPV 25
Journal Subscription
Microbiology Spectrum
ASM members can purchase subscriptions to journals.
Join or renew

Figures and Media

Figures

Media

Tables

Share

Share

Share the article link

Share with email

Email a colleague

Share on social media

American Society for Microbiology ("ASM") is committed to maintaining your confidence and trust with respect to the information we collect from you on websites owned and operated by ASM ("ASM Web Sites") and other sources. This Privacy Policy sets forth the information we collect about you, how we use this information and the choices you have about how we use such information.
FIND OUT MORE about the privacy policy