Free access
Research Article
14 April 2016

Nucleic Acid Binding by Mason-Pfizer Monkey Virus CA Promotes Virus Assembly and Genome Packaging

ABSTRACT

The Gag polyprotein of retroviruses drives immature virus assembly by forming hexameric protein lattices. The assembly is primarily mediated by protein-protein interactions between capsid (CA) domains and by interactions between nucleocapsid (NC) domains and RNA. Specific interactions between NC and the viral RNA are required for genome packaging. Previously reported cryoelectron microscopy analysis of immature Mason-Pfizer monkey virus (M-PMV) particles suggested that a basic region (residues RKK) in CA may serve as an additional binding site for nucleic acids. Here, we have introduced mutations into the RKK region in both bacterial and proviral M-PMV vectors and have assessed their impact on M-PMV assembly, structure, RNA binding, budding/release, nuclear trafficking, and infectivity using in vitro and in vivo systems. Our data indicate that the RKK region binds and structures nucleic acid that serves to promote virus particle assembly in the cytoplasm. Moreover, the RKK region appears to be important for recruitment of viral genomic RNA into Gag particles, and this function could be linked to changes in nuclear trafficking. Together these observations suggest that in M-PMV, direct interactions between CA and nucleic acid play important functions in the late stages of the viral life cycle.
IMPORTANCE Assembly of retrovirus particles is driven by the Gag polyprotein, which can self-assemble to form virus particles and interact with RNA to recruit the viral genome into the particles. Generally, the capsid domains of Gag contribute to essential protein-protein interactions during assembly, while the nucleocapsid domain interacts with RNA. The interactions between the nucleocapsid domain and RNA are important both for identifying the genome and for self-assembly of Gag molecules. Here, we show that a region of basic residues in the capsid protein of the betaretrovirus Mason-Pfizer monkey virus (M-PMV) contributes to interaction of Gag with nucleic acid. This interaction appears to provide a critical scaffolding function that promotes assembly of virus particles in the cytoplasm. It is also crucial for packaging the viral genome and thus for infectivity. These data indicate that, surprisingly, interactions between the capsid domain and RNA play an important role in the assembly of M-PMV.

INTRODUCTION

The retroviral structural polyprotein Gag contains three conserved domains, matrix (MA), capsid (CA), and nucleocapsid (NC). Gag plays the primary role in immature particle assembly and viral genomic RNA (vRNA) recruitment and packaging.
Retroviruses assemble via two different morphogenetic pathways; the first, historically referred to as C-type, wherein particle assembly occurs at the cell membrane, and the second, D-type, assembling in perinuclear regions. The pathogenic human viruses, HIV and human T-cell lymphotropic virus assemble via C-type intermediates, whereas M-PMV is the prototypic D-type retrovirus. The Gag polyprotein of M-PMV is first transported to an intracytoplasmic pericentriolar site, where particle assembly occurs (13). This targeting requires a cytoplasmic targeting/retention signal (CTRS) localized in the MA domain that mediates the interaction of Gag with components of dynein to transport cargo molecules toward the minus ends of the microtubules (4). After assembly, the immature D-type particles are transported to the plasma membrane, where budding occurs.
Gag nucleation and particle assembly is promoted by interactions between CA domains and also by interactions between NC and both cellular and viral RNA. The importance of RNA for assembly is well documented by in vitro assembly studies with various retroviruses, e.g., Rous sarcoma virus (RSV), HIV, murine leukemia virus (MLV), and M-PMV (511). Although cellular RNA is sufficient to promote Gag assembly (12), formation of an infectious retrovirus requires specific packaging of the viral genome (vRNA) into the assembling Gag particle. It is likely that the initial recognition of the genomic nucleic acid is mediated by a few Gag molecules that bring the vRNA to the assembly site (13). It has been well documented both in HIV and in MLV that the selection of vRNA for packaging into retroviral particles is mediated by specific interaction between the highly structured Psi sequence at the 5′-untranslated region of unspliced vRNA and zinc-finger motifs of the NC protein (1417). Nonspecific interactions between RNA and other Gag domains such as MA may also contribute to recognition (18, 19).
The current understanding is that the site at which the initial Gag-vRNA interaction occurs is different for different retroviruses. For HIV, vRNA is exported from the nucleus by the trans-activating factor Rev and subsequently interacts with Gag in the cytoplasm (20). In RSV, it has been proposed that the primary Gag-vRNA interaction may occur in the nucleus. This is supported by several pieces of evidence, including the presence of two nuclear localization signals in NC and MA recognized by different importins (21) and the detection of a large amount of RSV Gag in the nuclei of cells treated with leptomycin B (LMB) (22), a specific inhibitor of the karyopherin CRM1 (chromosome region maintenance 1 receptor) nuclear export pathway. An RSV Gag mutant that bypasses the nucleus packages vRNA less efficiently than the wild type (wt), and both nuclear trafficking and vRNA packaging is restored by the insertion of a heterologous nuclear localization signal (23, 24). It has been suggested that the formation of the RSV Gag-vRNA complex induces a conformational change of Gag, which leads to the exposure of the nuclear export signal, a leucine-rich region within p10 (25). However, whether nuclear Gag triggers the export of the full-length RSV vRNA remains an open question, since even Gag proteins that do not enter the nucleus generated infectious particles (22). The feline immunodeficiency virus (FIV) Gag protein cycles through the nuclei of both human and feline cells, and it has been proposed that encapsidation of FIV vRNA may also initiate in the nucleus (26).
In the case of M-PMV Gag, a small proportion of Gag was observed in nuclei of LMB-treated cells (22), suggesting a possible interaction of Gag with vRNA within the nucleus. However, the M-PMV vRNA contains a stem-loop structural motif, termed the constitutive transport element (CTE), which can mediate nuclear export of incompletely spliced genomic RNA (27, 28) through recognition by a cellular factor called TAP, which specifically binds the CTE (29). The mode of nuclear export and the site of Gag-vRNA interaction therefore remain unclear.
We described previously the local and global organization and arrangements of Gag in in vitro-assembled immature particles of representatives of three retroviral genera, namely, HIV, RSV, and M-PMV, using cryoelectron tomography (30). N-terminal domains of CA were arranged into hexameric rings around large holes with the CA domains forming dimers beneath this layer. In HIV and RSV, strong rod-like densities formed by the spacer peptide descended toward the particle center along the 6-fold axis. In contrast, M-PMV lacks the extended rod-like densities contributed by the spacer region in other retroviruses, and the disordered NC-RNA region is closer to CA than in other retroviruses (3133). The CA domain of M-PMV contains a stretch of three basic residues (RKK) located very close to its C terminus. Two RKK regions provided by two neighboring CA molecules form a basic patch on the underside of the CA layer in immature Gag arrays. We previously proposed that these residues may interact with nucleic acid, explaining the proximity of the nucleic acid layer and CA in M-PMV (30). Structural studies of in vitro-assembled M-PMV tubes show the presence of an extended “nucleic acid-like” filament of density in the vicinity of these residues, suggesting that an organized nucleic acid structure interacts with this motif (3133). Here, we have explored the effects of mutating the RKK to AAA or GPG on assembly, nucleic acid incorporation, structure, and virus production.

MATERIALS AND METHODS

Plasmids and viral constructs.

All DNA manipulations were carried out according to standard subcloning techniques, and all plasmids were propagated in Escherichia coli DH5α. All newly created DNA constructs were verified by DNA sequencing. For in vitro assembly assays, the RKK mutations were introduced into pSIT ΔProCANC M-PMV plasmid, which carries the gene for an M-PMV capsid and nucleocapsid fusion protein lacking the N-terminal proline (34) under the T7 promoter. The 201RKK203 to AAA or GPG mutations in pSIT ΔProCANC M-PMV were made by SLIM mutagenesis (35). To introduce mutations in the M-PMV proviral vector pSARM4 (36), we first used a helper vector (MHelppUC19) encoding M-PMV SacI-Eco72I fragment, which was prepared as described previously (37, 38). Mutations RKK/AAA and RKK/GPG were created by two-step PCR mutagenesis using primers carrying appropriate mutations and suitable NotI and XmaI restriction sites, respectively. The obtained PCR products were digested with SacI-NotI/NotI-Eco72I or SacI-XmaI/XmaI-Eco72I, and both fragments were ligated into the MHelppUC19. After sequence verification, the mutated SacI-Eco72I fragments of the MHelppUC19, carrying the appropriate mutation, were inserted into pSARM4 or pSARM-EGFP. For the single-round infectivity assay, the M-PMV Env expression vector pTMO (39) and the pSARM-EGFP vector in which EGFP (enhanced green fluorescent protein) replaces the env gene (40) were used. Further details of the cloning strategy and the full sequences of all PCR primers can be obtained from the authors upon request.

Cell growth and virus production.

HEK 293T cells were grown in Dulbecco modified Eagle medium (DMEM; Sigma) supplemented with 10% fetal bovine serum (Gibco) and 1% l-glutamine (PAA Laboratories). Transfection of the HEK 293T cells was performed using FuGene HD transfection reagent (Roche Molecular Biochemicals) according to the manufacturer's instructions. At 24 or 48 h posttransfection, virions in the culture media were harvested, filtered through a 0.45-μm-pore-size filter, and centrifuged through a 20% sucrose cushion at 200,000 × g for 1 h in a Beckman SW41Ti rotor. M-PMV proteins were detected by Western blotting with a rabbit anti-M-PMV CA polyclonal antibody (41).

Bacterial expression and purification of ΔProCANC, AAA, and GPG mutants.

Luria-Bertani medium supplemented with ampicillin (100 μg/ml) was inoculated with a 0.1% (vol/vol) overnight culture of E. coli BL21(DE3) carrying pSIT ΔProCANC M-PMV or an AAA or a GPG mutant plasmid. The cells were cultivated at 37°C and 250 rpm until the culture reached the exponential growth phase (i.e., an optical density at 600 nm of 0.4 to 0.6). Protein expression was induced by the addition of 0.4 mM (final concentration) IPTG (isopropyl-β-d-thiogalactopyranoside). The cells were harvested at 4 h postinduction by centrifugation at 5,000 × g and stored at −20°C.
The purification of the proteins was performed according to previously published protocols (5, 42). Briefly, a high-salt containing buffer extraction was used to solubilize and release the protein from the cell lysate pellet. The extracted protein was subsequently purified by immobilized metal affinity chromatography on a Zn2+-charged column, followed by ion-exchange chromatography on a phosphocellulose column, to remove contaminating nucleic acids. Finally, the protein was dialyzed against storage buffer (50 mM phosphate, 500 mM NaCl, 1 μM ZnSO4, 0.05% mercaptoethanol [pH 7.5]), concentrated using ultrafiltration on Amicon Ultra-15 Ultracel 10K (Millipore, Ireland) concentrators to ∼1 mg/ml, and stored at −20°C. The protein concentration was determined by using a Bradford protein assay.

Analysis of VLP formation in E. coli.

To determine whether the viral protein assembled inside the bacterial cells during the induced expression process, 1 ml of the cell culture at 4 h postinduction was pelleted, and the cells were resuspended in 350 μl of lysis buffer (50 mM Tris, 100 mM NaCl, 1% [wt/vol] octylthioglucoside, 1 mg/ml lysozyme [pH 8.0]). The suspension was incubated on a rotation mixer for 10 min at room temperature. Using this mild lysis process, the intact virus-like particles (VLPs) were released into the lysate and were subsequently analyzed using transmission electron microscopy (TEM) after negative staining.

In vitro assembly of purified ΔProCANC proteins.

The in vitro assembly of purified wild-type and mutant ΔProCANC M-PMV proteins was performed as previously described (5). Briefly, 60 μg of purified protein in storage buffer was mixed with either MS2 phage genomic RNA or λ phage genomic DNA at a 10:1 or 5:1 (wt/wt) ratio in 100 μl of total reaction volume. This mixture was dialyzed against the assembly buffer (50 mM Tris, 100 mM NaCl, 1 μM ZnSO4 [pH 8.0]) for 2 h at room temperature. When the effect of reducing conditions on the assembly process was studied, the assembly mixture contained 60 mM dithiothreitol (DTT), and the concentration of DTT in the dialysis buffer was 20 mM.

Gradient centrifugation.

The in vitro particle assembly efficiency was determined by gradient centrifugation, followed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). The dialyzed assembly mixture was loaded on top of 10 to 55% linear OptiPrep (Axis-Shield, Oslo, Norway) gradient and centrifuged for 40 min at 215,000 × g. The gradient was fractionated, and the individual fractions were analyzed by SDS-PAGE (12% gel). The gels were blue silver stained (43) and digitized using Uvitec Alliance 4.7 (Uvitec, United Kingdom), and the assembly efficiency was assessed by densitometric analysis of the lanes using the Fiji (ImageJ) software package (44). The protein content in the topmost fraction of the gradient represented the unassembled protein, whereas the protein content in fractions with an OptiPrep density of around 1.15 to 1.27 g/ml (wt/vol), i.e., fractions 6 to 9, represented the assembled VLPs (5, 6, 45).

EMSA.

For the electrophoretic mobility shift assay (EMSA), 5 or 1.7 μg of studied protein was mixed with 165 ng of 1-kb DNA ladder (Promega, USA) in 10 μl of total volume of buffered environment (25 mM Tris, 250 mM NaCl, 0.5 μM ZnSO4 [pH 8.0]), corresponding to a protein/nucleic acid ratios of 30:1 (wt/wt) and 10:1 (wt/wt), respectively. The EMSAs were performed under reducing conditions, where the sample reaction mixture contained 60 mM DTT. The samples were incubated 45 min at room temperature. To prove that the nucleic acid shift was caused by the protein nucleic acid interaction, an equivalent reaction mixture was treated with proteinase K (5 μg/reaction) for 45 min at 37°C. All of the samples were analyzed by agarose gel electrophoresis (1% gel) at 8 V/cm. The gels were stained by ethidium bromide and digitized by UVIdoc HD2 (Uvitec).

Protein expression, radioactive labeling, and quantification of particle release.

The HEK 293T cells transfected with the appropriate DNA construct were grown for 48 h posttransfection, starved for 30 min in methionine- and cysteine-deficient DMEM (Sigma), and then pulse-labeled for 30 min with Tran35S-label (M.G.P., Czech Republic) at 125 μCi/ml. The labeled cells were then chased in complete DMEM for 16 h. The cells from pulse and pulse-chase experiments were washed with phosphate-buffered saline (PBS), lysed in 1 ml of lysis buffer (1% Triton X-100, 1% sodium deoxycholate, 0.05 M NaCl, 25 mM Tris [pH 8.0]) on ice for 30 min, and clarified by centrifugation at 14,000 × g for 2 min. The culture medium of the chased cells was filtered through a 0.45-μm-pore-size filter, and SDS was added to a final concentration of 0.1%. Viral proteins were immunoprecipitated from the cell lysates and culture media with a polyclonal rabbit anti-M-PMV CA antibody (1:1,000 dilution) and separated by SDS-PAGE. Radiolabeled proteins were visualized using a Typhoon 9410 phosphorimager (Amersham Biosciences).
To quantify the particle release, the radiolabeled protein bands of 35S-pulse-labeled Gag (Pr78) and pulse-chase-labeled virion-associated CA (p27) were quantified using ImageQuant TL (Amersham Biosciences). The released viral proteins are shown as relative concentrations of CA correlated to the levels of intracellular Gag in individual samples.

Single-round infectivity assay.

Infectivity of M-PMV wt and CA-CTD mutants was determined as described earlier (37, 46). Briefly, HEK 293T cells were cotransfected with either wt or RKK/AAA mutant pSARM-EGFP expression vector, together with the glycoprotein expression vector pTMO. At 48 h posttransfection, the culture supernatants were collected and filtered through a 0.45-μm-pore-size filter, and each sample was normalized for capsid protein content by quantitative Western blotting (37). The volume of culture supernatant used to infect HEK 293T cells was adjusted to 4 ml with complete DMEM, and the cells were incubated for an additional 48 h. The cells were fixed with 4% formaldehyde, and the number of GFP-positive cells was determined using flow cytometry (BD FACSAria).

Viral RNA isolation and quantitative RT-PCR.

Reverse transcription-PCR (RT-PCR) was performed as described previously (37). Briefly, the HEK 293T cells were transfected with wt or RKK/AAA mutant proviral construct. At 48 h posttransfection, the virus-containing medium was filtered and centrifuged, and the M-PMV CA content in the viral pellets was normalized by semiquantitative Western blot analysis. Encapsidated RNA was isolated using the QIAamp viral RNA minikit (Qiagen) according to the manufacturer's instructions. The amount of isolated RNA was quantified by measuring the A260. To specifically quantitate the genomic RNA, RT using RevertAid H Minus M-MuLV reverse transcriptase (Fermentas) of isolated total RNA (of the CA-normalized amount) was performed. Subsequently, 2 μl of each RT product was used for real-time PCR using a Light Cycler 480 II Real-Time PCR system (Roche) and DyNAmo Hot Start SYBR green mix (Finnzymes). Three pairs of MPMV-CA derived primers—CA1ss (GTGGAATCTGTAGCGGACAA) and CA1as (ATTACCGGCTTGTTGGTTTC), CA2ss (GAAACCAACAAGCCGGTAAT) and CA2as (GAGCAAACAATCCTGGATCA), and CA3ss (TATTGGGCCCTCTTATCAGC) and CA3as GCAACACCCTCCTTTCTCTT—were used for each wt and RKK/AAA sample. Three control samples containing (i) total RNA isolated from wt and RKK/AAA mutant, (ii) cDNA prepared from mock-infected cells, and (iii) water were used for real-time quantitative PCR. The viral genomic RNA content in individual samples was determined in three independent experiments.

Nucleus isolation.

HEK 293T cells transiently expressing the wild-type or RKK/AAA mutant M-PMV proviral constructs grown in 100-mm plastic dishes were incubated with leptomycin B (LMB; final concentration, 20 nM) at 24 h posttransfection for 30, 60, and 120 min. The cells were then washed with PBS, and nuclear and cytosolic fractions were isolated using a Nuclei EZ Prep Nuclei Isolation kit (Sigma-Aldrich) according to the manufacturer's protocol. Individual samples of total cell lysate, and nuclear and cytosolic fractions were then analyzed by Western blotting with the following antibodies: rabbit anti-M-PMV CA (the present study), rabbit anti-lamin A (L1293; Sigma-Aldrich), rabbit anti-cyclophilin A (sc-20360; Santa Cruz), and monoclonal anti-β-actin (clone AC-74; Sigma-Aldrich).

TEM sample preparation and analysis.

HEK 293T cells transiently expressing the wild-type or mutant M-PMV proviral constructs grown in 100-mm plastic dishes were washed with PBS, scraped into a microtube, and prefixed with freshly prepared 2.5% glutaraldehyde in 0.1 M cacodylate buffer (pH 7.5). After a washing step with 0.1 M cacodylate buffer (pH 7.5), the cells were postfixed in 1% osmium tetroxide, dehydrated in an ethanol series (30, 50, 70, 80, 90, and 100%), and embedded in fresh Agar 100 epoxy resin. Ultrathin sections (70 nm) of cells were cut with a diamond knife on a Leica UC6 ultramicrotome (Leica Microsystems, Wetzlar, Germany). The thin sections were collected on Parlodion-coated microscopy grids and contrasted using saturated uranyl acetate and lead citrate. For each sample, we analyzed approximately 30 infected cells.
In vitro-assembled VLPs were deposited on carbon-coated copper grids for 3 to 6 min. The grid was washed twice on a drop of deionized water for 20 s and stained with sodium silicotungstic acid (4%, pH 7.4) for 30 s. The excess stain was wicked off using a filtration paper, and the samples were dried in air and analyzed using a JEM-1010 transmission electron microscope (Jeol, Japan) operated at 80 kV and equipped with a Megaview III CCD (charge-coupled device) camera. The images were processed using the AnalySIS software suit (Olympus, Japan).

Cryoelectron tomography and subtomogram averaging.

In vitro-assembled mutant ΔProCANC M-PMV RKK/AAA was diluted in PBS containing 10-nm colloidal gold and transferred to glow-discharged C-Flat 2/2 Holey carbon grids in a high-humidity chamber. Cryogrid preparation was performed using a manual plunging device (EMBL, Heidelberg, Germany). Grids were blotted from the back, frozen in liquid ethane, and then stored under liquid nitrogen conditions until imaging.
Data acquisition and image processing were performed as previously described (32). In brief, tilt series were imaged on a FEI Titan Krios electron microscope operated at 200 keV, with a GIF2002 post-column energy filter (using a slit width of 20 eV) and a 2k×2k Gatan Multiscan 795 CCD camera. Low-magnification montages for search and navigation were acquired using SerialEM (47). Tilt series were then acquired at appropriate positions using FEI tomography software version 4 in automated batch mode. The nominal magnification was 33,000, giving a calibrated pixel size of 2.87 Å. The tilt range was from −45° to +60° in 3° steps, collecting first from 0° to −45° and then from 3° to 60°, with a total dose of ∼40 e Å−2 being applied to each tilt series. Defoci ranged between −1.5 and −3.5 μm. Tomograms were reconstructed using the IMOD software suite (48).
Subtomogram averaging was performed as described previously (32) using MATLAB scripts derived from the TOM (49) and AV3 (50) packages. The Dynamo software package was used for generation of masks and for FSC (Fourier shell correlation) calculations (51). Initial alignment was performed on 3× binned data. Processing was carried out entirely independent for two half data sets. Each half data set contained roughly the same number of tubes and an equal distribution of defoci. To obtain an initial structure, one tomogram with a defocus of −3.5 μm was chosen for each half-data set. Extracted subtomograms from this tomogram were assigned initial angles based only upon the geometry of the tubes and were averaged to generate a smooth starting reference. The subtomograms from this tomogram were then iteratively aligned and averaged in six dimensions against the reference as described previously (50). After the structure stabilized it was used as starting reference for its respective half-data set. Subsequently, all subtomograms within each half-data set were aligned and averaged against their respective independent starting reference for six iterations. After the first two iterations, a cross-correlation-based cleaning was performed to remove subtomograms that contained no density corresponding to the M-PMV ΔProCANC protein layer. No symmetry was applied in the alignments performed with binned, non-CTF-corrected data.
The defocus of each tomogram was measured by fitting theoretical contrast transfer function (CTF) curves to averaged power spectra from 512 square pixel tiles generated from all images in a tilt series using MATLAB scripts. CTF correction was performed using the program “CTF phase flip” implemented in IMOD (52).
Subvolumes with a size of 310 Å3 were extracted from unbinned, CTF-corrected tomograms at the positions determined in the 3× binned alignments. The subtomograms were subjected to two further alignment iterations in which an additional 2-fold symmetry was applied. The two final references were aligned, averaged, and multiplied with a Gaussian filtered mask. Subsequent comparison of the two final references (averaged from 52,566 and 53,038 asymmetric units in each of the half-data sets, respectively) by FSC indicated a resolution of 10.9 Å. The final structure was sharpened applying a negative B-factor of −1,500 Å2, while filtering to the resolution determined at the 0.143 FSC threshold. The wt M-PMV ΔProCANC tube structure used for comparison was EMD-2089 (31). Visualization of tomograms or electron microscopy density maps was performed using either IMOD (48), UCSF chimera (53), or Amira4 (FEI Visualization Sciences Group) with the electron microscopy toolbox (54).

RESULTS

To study the role of the basic RKK region, we prepared mutants in which the RKK amino acids were replaced either by a triple alanine (RKK/AAA mutant), or by a GPG (RKK/GPG mutant) sequence. The reason for selecting the latter mutation was that in HIV-1 CA the GPG sequence is located at a position corresponding to that of RKK in M-PMV and thus could have the same functional role. The RKK/AAA and RKK/GPG mutations were introduced into both bacterial expression and M-PMV proviral vectors.

Mutation of the RKK region influences assembly in vitro.

We first used a bacterial system to study the role of the RKK basic region in the assembly of immature particles. The RKK/AAA and RKK/GPG mutations were introduced into truncated M-PMV Gag (ΔProCANC), and its ability to assemble in bacterial cells was assessed using TEM. In contrast to wt ΔProCANC protein that forms tubular and spherical VLPs in E. coli cells, none of the RKK mutant proteins formed any particles, indicating that the RKK sequence is important for the assembly of VLPs in bacterial cells.
We next purified the expressed proteins and studied their ability to assemble into VLPs in vitro using TEM. Our previous results showed that the wt ΔProCANC of M-PMV could form in vitro either spherical (5) or tubular (31) particles, depending on the assembly conditions. The RKK/GPG ΔProCANC mutant protein did not assemble into any particles in vitro under any assembly conditions tried (see Materials and Methods). In the presence of λ phage DNA at reducing conditions, the RKK/AAA mutant of ΔProCANC protein formed tubular VLPs that were similar to those formed by the wt protein (Fig. 1) but were typically longer (up to several microns) than those of the wt protein. This mutant assembled also in the presence of MS2 phage RNA, although at both reducing and nonreducing conditions it formed only a few regular spherical particles (as seen in Fig. 2C), alongside fragments of particles and aggregated protein. Particle assembly was dependent on the presence of nucleic acid, an observation consistent with our previous finding that the efficiency of wt ΔProCANC VLP assembly is significantly facilitated by the presence of nucleic acids (5).
FIG 1
FIG 1 TEM analysis of negatively stained in vitro assembled M-PMV particles. wt ΔProCANC (A and B) and RKK/AAA mutant ΔProCANC (C and D) particles assembled in vitro under reducing conditions in the presence of λ phage DNA. Scale bars: A and C, 2 μm; B and D, 100 nm.
FIG 2
FIG 2 SDS-PAGE and TEM analysis of OptiPrep gradient fractions. (A) A dialyzed assembly mixture was ultracentrifuged through a 15 to 55% OptiPrep equilibrium gradient, and collected fractions were analyzed by SDS-PAGE. The amount of proteins in the lanes was assessed densitometrically. The percentage (means with standard deviations, n = 3) represents the relative amounts of wt and RKK/AAA mutant proteins assembled into particles (fractions 6 to 9) in the presence of either MS2 phage RNA or λ phage DNA. (B, C, D, and E) TEM analysis of OptiPrep gradient fractions 7 containing wt and RKK/AAA mutant protein particles assembled in the presence of 12 μg of MS2 RNA (B and C, respectively) and wt and RKK/AAA mutant protein particles assembled in the presence of 6 μg of λ DNA (D and E, respectively). Scale bars, 100 nm.
To assess the efficiency of in vitro VLP assembly, we performed OptiPrep gradient ultracentrifugation of particles assembled under reducing conditions from both wt and mutant ΔProCANC proteins in the presence of either MS2 RNA or λ phage DNA, followed by SDS-PAGE analysis of individual fractions and by densitometric analysis of the bands (Fig. 2). All VLPs assembly reactions, together with ultracentrifugations and protein quantitation analyses, were performed in triplicate from independent protein isolations. Independent of the type of added nucleic acid, the in vitro assembly of wt ΔProCANC protein proceeded efficiently. The proportion of the assembled protein ranged between ca. 60% and ca. 50% in the presence MS2 RNA and λ DNA, respectively (Fig. 2A). For the RKK/GPG mutant, for which no particles were observed by TEM, the assembly efficiency was negligible, and no visible bands corresponding to assembled particles were observed in the SDS-PAGE gel. The yield of the RKK/AAA mutant particles was significantly lower than that of wild type under both conditions (i.e., with MS2 RNA or λ DNA) and, unlike the wild-type particles, it was more dependent on the amount of nucleic acid added. Increasing the amount of MS2 RNA in the assembly mixture from 6 to 12 μg enhanced the VLP assembly efficiency of RKK/AAA mutant from 6.4% to 21% while the wt protein assembled most efficiently when 6 μg of MS2 RNA was added (Fig. 2A). On the other hand, increased concentration of the λ DNA slightly reduced the assembly efficiency of the RKK/AAA mutant from ca. 21% ± 1% to ca. 16% ± 2% (Fig. 2A), which presumably reflects the redistribution of particles in the gradient as a result of aggregation. We inspected the gradient fractions using TEM to confirm the presence of assembled particles in the relevant fractions (Fig. 2B to E). As expected, spherical or tubular assembled particles were observed in fractions 6 to 9.

Structure of in vitro-assembled RKK/AAA VLPs.

We next assessed whether the RKK/AAA mutation affects the structure of the assembled tubular particles. ΔProCANC M-PMV RKK/AAA tubes assembled in vitro under reducing conditions in the presence of λ DNA were subjected to cryoelectron tomography. Consistent with the negative-stain electron microscopy results, long tubular arrays were observed (Fig. 3A). Along the surface of the tubes hexagonal patches were visible, similar to those observed in cryoelectron tomograms of wt ΔProCANC tubes (32). We performed subtomogram averaging and obtained an ∼11-Å resolution structure (Fig. 3B). We compared the mutant structure with the available wt ΔProCANC tube structure (31). No differences were seen in the capsid region (Fig. 3B), indicating that the RKK/AAA mutation does not influence the tertiary or quaternary structure of the capsid domains. Differences were observed in the region underlying the C-terminal part of capsid (Fig. 3B and C), where the nucleocapsid and nucleic acids are located. Here, the RKK/AAA mutant lacks a filamentous density that was present in the wt tube (Fig. 3B, yellow). The dimensions of this density are approximately that of a nucleic acid double helix. We previously suggested that this density was nucleic acid recruited by the RKK motif in M-PMV that is not present in the HIV CA sequence nor in the cryoelectron microscopy structure (30, 31). The absence of this structure in the RKK/AAA mutant strongly supports this hypothesis.
FIG 3
FIG 3 Cryoelectron tomography and subtomogram averaging analysis of M-PMV ΔProCANC RKK/AAA tubes. (A, left) Slice through a cryoelectron tomogram containing a ΔProCANC RKK/AAA tube. The protein density is black. Scale bar, 50 nm. (A, right) Corresponding subtomogram averaging output lattice map to the tube represented in panel A. Hexagons are placed on the positions determined during alignment, resolving the orientations of the hexameric unit cells of the proteins along the tube. Hexagon colors denote cross-correlation of the respective subtomogram with the reference (green, high; red, low). (B) Comparison of the structures in wt ΔProCANC (left) (EMD-2089) and ΔProCANC RKK/AAA tubes (right). Isosurface representations of the two structures, both filtered to 11 Å, are shown from the outside (top), from a horizontal view (middle), and from the inside of the tube (bottom). The filamentous densities present only in wt tubes are colored yellow. Yellow asterisks mark the approximate positions of the RKK sequences in the central hexamer. Scale bar, 50 Å. (C) Slices through the electron density, indicating the positions of the protein domains in an orientation corresponding to the middle panel in panel B. The protein density is white.

The RKK region plays role in nucleic acid binding.

The observations presented so far suggest a role for the RKK basic region in binding of nucleic acids. To investigate whether the RKK/GPG and RKK/AAA mutations alter nucleic acid binding, we mixed the studied proteins with a 1-kb DNA ladder in two different ratios (protein/DNA ratios of 30:1 [wt/wt] and 10:1 [wt/wt]) and performed an EMSA. The ratios of protein to nucleic acid were based on the optimization of reaction conditions, where the DNA was bound efficiently to wt and mutant protein. None of the tested proteins (wt, RKK/AAA, or RKK/GPG) showed any traces of contaminating nucleic acids (Fig. 4, lanes PC), and no shifts were observed when the equivalent reaction mixtures were also treated with proteinase K (Fig. 4, lane Pr), indicating that any observed shifts are caused exclusively by the interaction of the protein with added nucleic acid. At a protein/DNA ratio of 30:1 the wt protein quantitatively bound DNA content from the reaction mixture (Fig. 4, left panel, wt lane P), whereas at a protein/DNA ratio of 10:1 some DNA was not bound by the protein and remained free in the solution (Fig. 4, right panel, wt, lane P). The RKK/AAA and RKK/GPG mutants showed a much lower ability to bind DNA at both ratios (Fig. 4, AAA and GPG, lanes P), the reduction was particularly severe for the RKK/GPG mutant. The higher-molecular-weight fragments from the 1-kb ladder showed greater retention than those of the lower-molecular-weight fragments (compare Fig. 4, lanes P). The EMSA indicates that mutations in the RKK region indeed lead to reduced DNA binding that correlates with a reduced efficiency of particle assembly.
FIG 4
FIG 4 EMSA results for wt ΔProCANC and RKK/AAA and RKK/GPG mutant proteins. The EMSAs were performed at 30:1 (wt/wt) and 10:1 (wt/wt) protein/DNA ratios under reducing conditions. PC, protein control (no nucleic acid added); 1kb, 1-kbp DNA ladder; P, protein-DNA interaction mixture; Pr, Proteinase K-treated protein-DNA interaction mixture.

The RKK region regulates the efficiency of intracytoplasmic particle assembly.

To investigate whether the effect of mutations in the RKK region on nucleic acid binding and particle assembly observed in vitro are reflected in changes in the viral life cycle, HEK 293T cells were transfected with proviral wt pSARM4 plasmid and the corresponding RKK/AAA and RKK/GPG mutants. Transfection with all of the constructs led to the expression of similar amounts of Gag, Gag-Pro, and Gag-Pro-Pol polyproteins, indicating that the level of expression was not affected by the mutations (Fig. 5A). At 48 h posttransfection, the expression and processing of the wt and mutant M-PMVs were assessed by pulse-chase assay and Western blot analysis of transfected cells.
FIG 5
FIG 5 Synthesis, release, and processing of M-PMV wild-type and RKK mutants. The HEK 293T cells were transfected with wt, RKK/AAA, and RKK/GPG mutant proviral DNAs. Viral proteins were metabolically labeled with [35S]cysteine-methionine mix for 30 min and then chased for 16 h. (A) M-PMV CA (p27)-related polyproteins Gag (Pr78), Gag-Pro (Pr95), and Gag-Pro-Pol (Pr180) were then immunoprecipitated from the cells by rabbit anti-M-PMV CA antibody, separated by SDS-PAGE, and analyzed by using a Typhoon phosphorimager. (B) Released M-PMV CA (p27) was immunoprecipitated from the culture medium by rabbit anti-M-PMV CA antibody at 16 h after the chase, separated by SDS-PAGE, and analyzed by using a Typhoon phosphorimager. (C) Quantification of M-PMV wt and RKK mutants release. The band intensities of 35S-pulse-labeled Gag (Pr78) and released CA (p27) were calculated. The relative percentage of CA released into the culture media was corrected for intracellular expression of individual samples. The released viral proteins are shown as the average relative concentration of CA correlated to the level of intracellular Gag in individual samples. Error bars represent standard errors of the mean calculated from two independent experiments.
We measured the amount of protein in the supernatant (after a 16-h chase) relative to the amount of cell-associated proteins (before chase) in order to estimate the amount of virus released (Fig. 5C). The efficiency of release for the RKK/AAA mutant was only ca. 45% that of the wt. Both the wt and the RKK/AAA virions contained processed CA protein, indicating that proteolytic processing of capsid was not affected by the RKK/AAA mutation (Fig. 5B). In the RKK/GPG mutant the ratio of CA protein detected in the medium was <20% that of the wt.
To analyze the assembly pathway of the virions, we performed TEM analysis of thin sections of transfected HEK 293T cells (Fig. 6). We inspected about 30 infected cells of each wt or mutant viruses and semiquantitatively assessed the virus particle morphogenetic types. Transfection with wt M-PMV gives rise to large numbers of intracellularly assembled D-type particles in the pericentriolar region. We counted approximately 100 intracellular particles which were exclusively D-type. In the case of the RKK/AAA mutant, we observed not only D-type pericentriolar assembly but also a considerable amount of particles assembling at the plasma membrane (C-type assembly) (Fig. 6B and C, respectively). In 30 cells we counted 58 intracellular D-type particles and 29 partially assembled C-type particles budding from the plasma membrane. The intracellular RKK/AAA M-PMV particles had a spherical shape similar to that of the wt M-PMV (compare Fig. 6A and B). Released virions were also observed. The GPG mutant failed to form immature particles inside the cells; however, a large amount of electron-dense material (presumably Gag) accumulated underneath the cell plasma membrane (Fig. 6D) (55). This compact layer on the membrane did not form any released virus particles or budding structures. Based on this analysis (see further discussion below), we concluded that the CA protein detected in the medium of the RKK/GPG mutant most likely represents free protein and not virus particles.
FIG 6
FIG 6 TEM analysis of thin sections of M-PMV-infected HEK 293T cells. (A) wt virus. The virus assembled inside the cytoplasm (D-type particles). (B and C) RKK/AAA mutant. The particles were assembled in the cytoplasm (D-type) and also on the cell membrane (C-type); the particles are marked with arrows. (D) RKK/GPG mutant. Large amounts of protein, presumably Gag, accumulated at the cell membrane (indicated by arrows). Scale bars, 200 nm.
The infectivity of the released particles was tested by single-round infectivity assay (Fig. 7A). The infectivity of the RKK mutants was below the detection limit (<1%) compared to that of the wt M-PMV, indicating that the mutation affected some key step of the infectivity process.
FIG 7
FIG 7 Relative infectivity and genomic RNA incorporation into M-PMV wt and RKK mutant viruses. (A) The relative infectivity of RKK mutants was determined by a single-round assay. HEK 293T cells were cotransfected with wild-type or RKK mutant pSARM-EGFP and pTMO vectors. At 48 h posttransfection, the virus particles from the culture medium were filtered and normalized for CA (p27) by quantitative Western blotting. Equivalent amounts of virions were used to infect fresh HEK 293T cells. At 48 h postinfection, the cells were harvested, and the numbers of GFP-positive cells were determined by flow cytometry (BD FACSAria). The mean percentage of three independent infectivity measurements (with calculated standard deviations) for each mutant relative to the wild-type is shown. (B) Mean relative RNA contents with standard deviations (n = 3) of the wt and RKK/AAA mutant viruses are shown. Viral RNA was isolated from purified viral particles released into the culture media at 48 h posttransfection. After reverse transcription of normalized samples (see Materials and Methods), real-time PCR was used to quantify the amount of incorporated RNA.
The above-mentioned results of particle release and TEM analysis (Fig. 5C and 6, respectively) indicate that mutation of the RKK motif leads to a reduction in particle release efficiency and to a partial relocalization of the assembly site from the pericentriolar region to the plasma membrane. The mutant particles are released from the cells but show severely abolished infectivity.

The RKK region is important for genomic RNA incorporation.

To assess whether mutation of the RKK motif influences nucleic acid incorporation in infected cells, we determined the total RNA and the genomic RNA content of the released particles. We found that the total amounts of RNA (measured spectrophotometrically at A260) incorporated into the mutant and wt virions were comparable (wt [100% ± 5%] and RKK/AAA mutant [118% ± 18%]). To quantify genomic RNA incorporated into released M-PMV particles, the isolated total RNA from the wt and RKK/AAA mutant was reverse transcribed and analyzed by real-time qPCR using three various CA-specific primer pairs. No positive signals (i.e., threshold cycle [CT] > 38) were determined in the control samples in which cDNA isolated from mock-infected HEK 293T cells, isolated total RNA, or water were used as a template for real-time quantitative PCR. Surprisingly, significant differences between the RKK/AAA mutant and the wt particles were observed by specific quantification (quantitative RT-PCR) of the genomic RNA (Fig. 7B). The RKK/AAA mutant particles contained only about 9% (±1.5%) of genomic RNA in comparison to the wt. The data represent three independent transfections, where the wt values were arbitrarily assigned as 100%.

The RKK region influences nuclear trafficking of Gag.

It was previously observed that mutation of basic amino acid patches in the pp24 domain of M-PMV Gag affects its localization to nuclear pores (56). We therefore next assessed whether the genome packaging defect observed in the RKK/AAA mutant might also relate to altered nuclear trafficking of Gag. To delay fast export of proteins from the nucleus, we treated the cells at 24 h posttransfection with LMB. This inhibitor of CRM1-dependent nuclear export was selected because it was suggested to affect M-PMV Gag exit from the nucleus (22). Analysis of LMB-treated cells thus should reveal even transient presence of Gag inside the nuclei. Nuclear and cytosolic fractions of cells transfected with wt or RKK/AAA mutant M-PMV vector were analyzed for the presence of Gag (Fig. 8).
FIG 8
FIG 8 Western blot analysis of LMB-treated transfected HEK 293T cells. At 24 h posttransfection of the HEK 293T cells with the wild-type or RKK/AAA mutant M-PMV proviral constructs, LMB at a final concentration of 20 nM was added to the cells. Incubation proceeded for 30, 60, and 120 min, and then nuclear and cytosolic fractions were isolated. Individual samples of total cell lysate and nuclear and cytosolic fractions were then analyzed by Western blotting with the following antibodies: rabbit anti-M-PMV CA, rabbit anti-lamin-A, rabbit anti-cyclophilin A (CypA), and mouse monoclonal anti-β-actin.
The level of wt M-PMV Gag in the nuclear fractions gradually increased with increasing length of LMB treatment over a 120-min time frame. For the RKK/AAA mutant, the initial amount of Gag in the nucleus was notably higher than for the wt but did not increase during longer incubations. These results are consistent with a reduced rate of nuclear export for the RKK/AAA mutant of Gag. A reduced export rate would lead to increased accumulation of RKK/AAA Gag during the 24-h period of posttransfection before LMB treatment. Upon reaching saturation, no increase in nuclear RKK/AAA was observed when export was inhibited by LMB.
Another remarkable observation is the difference in the presence of the wt and RKK/AAA mutant CA proteins inside the cell nucleus (Fig. 8). Although nuclear localization is not surprising for the wt CA protein since it was also reported for the HIV-1 CA protein in primary human macrophages and HeLa cells at the early stages of infection (57, 58), the AAA mutation of the RKK motif in the M-PMV CA protein almost completely abolished the import of the CA protein into the nucleus (Fig. 8). The detectable amounts of M-PMV CA in the nucleus may originate from CA present in a preintegration complex in cells newly infected by the released particles. The absence of CA in the nuclei of cells transfected with the RKK mutant is consistent with the fact that the RKK/AAA mutant virus lacking the vRNA is noninfectious and thus unable to introduce mature CA into the cells.

DISCUSSION

Role of RKK in nucleic acid binding and virus assembly.

The mutation of the RKK region to either AAA or GPG had wide-ranging effects on Gag assembly, nucleic acid incorporation, and virus production. In the case of mutation to GPG, assembly, nucleic acid incorporation and virus production were essentially abolished. We speculate that the insertion of a proline residue in this region may cause structural defects in CA which interfere with its proper function.
Mutation of RKK to AAA was still permissive for in vitro assembly. This allowed us to test our previous hypothesis—that the extended filament of density underlying CA in in vitro-assembled ΔProCANC tubes represents an ordered nucleic acid structure bound to the basic RKK region (30). Indeed, structural analysis showed that this filament is lost in the RKK/AAA mutant, indicating that the nucleic acid is either absent in the particles or is no longer bound to the RKK motif. Consistent with this observation, the efficiency of nucleic acid binding by the mutant protein is reduced. We observed that the mutation also leads to significantly reduced efficiency of Gag assembly, suggesting that the interactions between RKK and nucleic acid may facilitate the assembly. This could be achieved either by promoting CA dimerization or further oligomerization into a hexameric lattice. Since the wt ΔProCANC assembles into particles of similar morphology both in E. coli and in vitro, the failure of the ΔProCANC RKK/AAA mutant to assemble in E. coli suggests that RKK-mediated CA oligomerization may be particularly important in crowded cellular environments. Together, these observations are consistent with a model in which nucleic acid binding by the RKK motif creates a scaffold promoting Gag assembly.
When placed in the context of the infectious virus, the RKK/AAA mutation leads to a ca. 50% drop in virus particle release, which is consistent with the assembly defect observed in vitro. Strikingly, the mutation also influences the site of assembly: whereas wild-type M-PMV assembles D-type particles in the pericentriolar region (1, 59), in the AAA mutant, approximately one-third of the observed particles appeared as C-type particles assembling at the plasma membrane. In the GPG mutant, dense layers of accumulated protein are seen underlying the plasma membrane, which are not seen in noninfected cells. Based on the thickness of these layers, and because similar structures have previously been shown to be formed by assembly-incompetent Gag polyproteins (55, 60, 61), we presume that these extra layers observed under the plasma membrane are formed by accumulated mutant Gag protein.
Trafficking of M-PMV Gag to the pericentriolar assembly site is dependent on the interaction between a CTRS signal in MA with the Tctex-1 component of dynein (4). We consider it unlikely that mutation of RKK influences this interaction because the MA site is distal to CA. We prefer the following alternative explanation for the relocation of assembly. The assembly of C-type retroviruses at the plasma membrane is promoted by CA-CA interactions, NC-RNA-NC interactions, and MA-membrane-MA interactions. In the case of M-PMV, a D-type retrovirus, assembly in the cytoplasm is promoted by CA-CA, NC-RNA-NC, and CA(RKK)-nucleic acid-CA(RKK) interactions. In the case where the CA(RKK)-nucleic acid-CA(RKK) interaction is abolished by mutation of the RKK, the cytosolic assembly efficiency is reduced, and part of Gag is transported to the PM, where MA-membrane-MA interactions promote C-type assembly.

Role of RKK in genome packaging and nuclear transport.

Surprisingly, while the RKK/AAA mutation does not affect the total amount of RNA being incorporated into virus particles, it dramatically reduces the packaging of genomic RNA. This is most likely the cause of the observed reduced infectivity. Specific packaging of genomic RNA in retroviruses is typically mediated by NC (6264). While some studies have indicated that interactions between MA and nucleic acid may modulate this effect (18, 19), a role for CA in genome packaging has not been described. We cannot rule out that the RKK motif influences packaging by direct interaction with sequences in the genomic RNA, but this seems unlikely. A number of other hypotheses seem more likely. The RKK motif may help to stabilize the Gag-vRNA complex, or it may contribute to a structural arrangement of the NC region which is required for packaging. The reduction in genome packaging may be a secondary effect resulting from the relocalization of viral assembly from the pericentriolar region to the plasma membrane. Alternatively, packaging may be hindered by a change in the nuclear transport of Gag.
Nuclear trafficking of Gag has previously been shown to be important for genomic RNA incorporation for RSV (24, 25). In the case of M-PMV, Gag associates with nuclear pores (56) and may enter the nucleus (22). We found both RKK/AAA and wild-type Gag in the nucleus. The phenotype we observed for the RKK/AAA Gag is consistent with reduced efficiency of nuclear export. Because the RSV nuclear export signal consists mainly of nonpolar amino acids in the p10 domain (65), we expect that the export of Gag from the nucleus is not directly inhibited by the mutation of the polar RKK region, but it is rather mediated by the Gag-vRNA interactions and their simultaneous export from the nucleus. This could lead to a reduction in genomic RNA export and packaging into virus particles. Alternatively, if nuclear export is promoted by a Gag-vRNA complex, then reduced export might result indirectly from the RKK/AAA mutation interfering with genomic RNA binding. In either case, the reduction in genomic RNA incorporation and the altered nuclear trafficking would be related phenotypes.
In summary, our data suggest that the RKK region of CA modulates interactions between Gag and the viral genomic RNA in a manner that is also accompanied with changes in nuclear trafficking. The nucleic acid recruited by RKK serves a scaffolding function that promotes Gag assembly. We speculate that D-type retroviruses such as M-PMV may require an additional assembly scaffold to replace the function of the plasma membrane in the assembly of C-type retroviruses.

ACKNOWLEDGMENTS

This study was supported by the Grant Agency of the Czech Republic (14-15326S), by the LH12011 project and NPU I sustainability projects LO1302 and LO1304 from the Czech Ministry of Education, and by Deutsche Forschungsgemeinschaft grant BR 3635/2-1 to J.A.G.B.
We thank Tanmay Bharat for preparation of the cryoelectron microscopy grids and Wim Hagen for assistance with cryoelectron tomography.
This study was technically supported by Frank Thommen and EMBL IT-services.

REFERENCES

1.
Choi G, Park S, Choi B, Hong S, Lee J, Hunter E, Rhee SS. 1999. Identification of a cytoplasmic targeting/retention signal in a retroviral Gag polyprotein. J Virol 73:5431–5437.
2.
Sfakianos JN, Hunter E. 2003. M-PMV capsid transport is mediated by Env/Gag interactions at the pericentriolar recycling endosome. Traffic 4:671–680.
3.
Sakalian M, Hunter E. 1999. Separate assembly and transport domains within the Gag precursor of Mason-Pfizer monkey virus. J Virol 73:8073–8082.
4.
Vlach J, Lipov J, Rumlová M, Veverka V, Lang J, Srb P, Knejzlík Z, Pichová I, Hunter E, Hrabal R, Ruml T. 2008. D-retrovirus morphogenetic switch driven by the targeting signal accessibility to Tctex-1 of dynein. Proc Natl Acad Sci U S A 105:10565–10570.
5.
Ulbrich P, Haubova S, Nermut MV, Hunter E, Rumlova M, Ruml T. 2006. Distinct roles for nucleic acid in in vitro assembly of purified Mason-Pfizer monkey virus CANC proteins. J Virol 80:7089–7099.
6.
Campbell S, Vogt VM. 1997. In vitro assembly of virus-like particles with Rous sarcoma virus Gag deletion mutants: identification of the p10 domain as a morphological determinant in the formation of spherical particles. J Virol 71:4425–4435.
7.
Gross I, Hohenberg H, Kräusslich HG. 1997. In vitro assembly properties of purified bacterially expressed capsid proteins of human immunodeficiency virus. Eur J Biochem 249:592–600.
8.
Hadravová R, de Marco A, Ulbrich P, Stokrová J, Dolezal M, Pichová I, Ruml T, Briggs JAG, Rumlová M. 2012. In vitro assembly of virus-like particles of a gammaretrovirus, the murine leukemia virus XMRV. J Virol 86:1297–1306.
9.
Ma YM, Vogt VM. 2004. Nucleic acid binding-induced Gag dimerization in the assembly of Rous sarcoma virus particles in vitro. J Virol 78:52–60.
10.
Pastré D, Hamon L, Landousy F, Sorel I, David M-O, Zozime A, Le Cam E, Piétrement O. 2006. Anionic polyelectrolyte adsorption on mica mediated by multivalent cations: a solution to DNA imaging by atomic force microscopy under high ionic strengths. Langmuir 22:6651–6660.
11.
Datta SAK, Zuo X, Clark PK, Campbell SJ, Wang Y-X, Rein A. 2011. Solution properties of murine leukemia virus gag protein: differences from HIV-1 gag. J Virol 85:12733–12741.
12.
Rulli SJ, Hibbert CS, Mirro J, Pederson T, Biswal S, Rein A. 2007. Selective and nonselective packaging of cellular RNAs in retrovirus particles. J Virol 81:6623–6631.
13.
Jouvenet N, Simon SM, Bieniasz PD. 2009. Imaging the interaction of HIV-1 genomes and Gag during assembly of individual viral particles. Proc Natl Acad Sci U S A 106:19114–19119.
14.
Dorfman T, Luban J, Goff SP, Haseltine WA, Göttlinger HG. 1993. Mapping of functionally important residues of a cysteine-histidine box in the human immunodeficiency virus type 1 nucleocapsid protein. J Virol 67:6159–6169.
15.
Dannull J, Surovoy A, Jung G, Moelling K. 1994. Specific binding of HIV-1 nucleocapsid protein to PSI RNA in vitro requires N-terminal zinc finger and flanking basic amino acid residues. EMBO J 13:1525–1533.
16.
Aldovini A, Young RA. 1990. Mutations of RNA and protein sequences involved in human immunodeficiency virus type 1 packaging result in production of noninfectious virus. J Virol 64:1920–1926.
17.
Gorelick RJ, Henderson LE, Hanser JP, Rein A. 1988. Point mutants of Moloney murine leukemia virus that fail to package viral RNA: evidence for specific RNA recognition by a “zinc finger-like” protein sequence. Proc Natl Acad Sci U S A 85:8420–8424.
18.
Alfadhli A, Still A, Barklis E. 2009. Analysis of human immunodeficiency virus type 1 matrix binding to membranes and nucleic acids. J Virol 83:12196–12203.
19.
Ott DE, Coren LV, Gagliardi TD. 2005. Redundant roles for nucleocapsid and matrix RNA-binding sequences in human immunodeficiency virus type 1 assembly. J Virol 79:13839–13847.
20.
Fritz CC, Green MR. 1996. HIV Rev uses a conserved cellular protein export pathway for the nucleocytoplasmic transport of viral RNAs. Curr Biol 6:848–854.
21.
Butterfield-Gerson KL, Scheifele LZ, Ryan EP, Hopper AK, Parent LJ. 2006. Importin-beta family members mediate alpharetrovirus gag nuclear entry via interactions with matrix and nucleocapsid. J Virol 80:1798–1806.
22.
Baluyot MF, Grosse SA, Lyddon TD, Janaka SK, Johnson MC. 2012. CRM1-dependent trafficking of retroviral Gag proteins revisited. J Virol 86:4696–4700.
23.
Lochmann TL, Bann DV, Ryan EP, Beyer AR, Mao A, Cochrane A, Parent LJ. 2013. NC-mediated nucleolar localization of retroviral gag proteins. Virus Res 171:304–318.
24.
Garbitt-Hirst R, Kenney SP, Parent LJ. 2009. Genetic evidence for a connection between Rous sarcoma virus gag nuclear trafficking and genomic RNA packaging. J Virol 83:6790–6797.
25.
Gudleski N, Flanagan JM, Ryan EP, Bewley MC, Parent LJ. 2010. Directionality of nucleocytoplasmic transport of the retroviral Gag protein depends on sequential binding of karyopherins and viral RNA. Proc Natl Acad Sci U S A 107:9358–9363.
26.
Kemler I, Saenz D, Poeschla E. 2012. Feline Immunodeficiency Virus Gag Is a Nuclear Shuttling Protein. J Virol 86:8402–8411.
27.
Tabernero C, Zolotukhin AS, Valentin A, Pavlakis GN, Felber BK. 1996. The posttranscriptional control element of the simian retrovirus type 1 forms an extensive RNA secondary structure necessary for its function. J Virol 70:5998–6011.
28.
Ernst RK, Bray M, Rekosh D, Hammarskjöld ML. 1997. A structured retroviral RNA element that mediates nucleocytoplasmic export of intron-containing RNA. Mol Cell Biol 17:135–144.
29.
Grüter P, Tabernero C, von Kobbe C, Schmitt C, Saavedra C, Bachi A, Wilm M, Felber BK, Izaurralde E. 1998. TAP, the human homolog of Mex67p, mediates CTE-dependent RNA export from the nucleus. Mol Cell 1:649–659.
30.
de Marco A, Davey NE, Ulbrich P, Phillips JM, Lux V, Riches JD, Fuzik T, Ruml T, Kräusslich H-G, Vogt VM, Briggs JAG. 2010. Conserved and variable features of Gag structure and arrangement in immature retrovirus particles. J Virol 84:11729–11736.
31.
Bharat TAM, Davey NE, Ulbrich P, Riches JD, de Marco A, Rumlova M, Sachse C, Ruml T, Briggs JAG. 2012. Structure of the immature retroviral capsid at 8 Å resolution by cryo-electron microscopy. Nature 487:385–389.
32.
Schur FKM, Hagen WJH, de Marco A, Briggs JAG. 2013. Determination of protein structure at 8.5Å resolution using cryo-electron tomography and sub-tomogram averaging. J Struct Biol 184:394–400.
33.
Schur FK, Hagen WJ, Rumlová M, Ruml T, Müller B, Kräusslich HG, Briggs JAG. 2014. Structure of the immature HIV-1 capsid in intact virus particles at 8.8 Å resolution. Nature 517:505–508.
34.
Rumlova-Klikova M, Hunter E, Nermut MV, Pichova I, Ruml T. 2000. Analysis of Mason-Pfizer monkey virus Gag domains required for capsid assembly in bacteria: role of the N-terminal proline residue of CA in directing particle shape. J Virol 74:8452–8459.
35.
Chiu J, March PE, Lee R, Tillett D. 2004. Site-directed, ligase-independent mutagenesis (SLIM): a single-tube methodology approaching 100% efficiency in 4 h. Nucleic Acids Res 32:e174.
36.
Song C, Hunter E. 2003. Variable sensitivity to substitutions in the N-terminal heptad repeat of Mason-Pfizer monkey virus transmembrane protein. J Virol 77:7779–7785.
37.
Křízová I, Hadravová R, Štokrová J, Günterová J, Doležal M, Ruml T, Rumlová M, Pichová I. 2012. The G-patch domain of Mason-Pfizer monkey virus is a part of reverse transcriptase. J Virol 86:1988–1998.
38.
Bohmová K, Hadravová R, Stokrová J, Tuma R, Ruml T, Pichová I, Rumlová M. 2010. Effect of dimerizing domains and basic residues on in vitro and in vivo assembly of Mason-Pfizer monkey virus and human immunodeficiency virus. J Virol 84:1977–1988.
39.
Brody BA, Kimball MG, Hunter E. 1994. Mutations within the transmembrane glycoprotein of Mason-Pfizer monkey virus: loss of SU-TM association and effects on infectivity. Virology 202:673–683.
40.
Newman RM, Hall L, Connole M, Chen G-L, Sato S, Yuste E, Diehl W, Hunter E, Kaur A, Miller GM, Johnson WE. 2006. Balancing selection and the evolution of functional polymorphism in Old World monkey TRIM5α. Proc Natl Acad Sci U S A 103:19134–19139.
41.
Rumlová M, Benedíková J, Cubínková R, Pichová I, Ruml T. 2001. Comparison of classical and affinity purification techniques of Mason-Pfizer monkey virus capsid protein: the alteration of the product by an affinity tag. Protein Expr Purif 23:75–83.
42.
Voráčková I, Suchanová S, Ulbrich P, Diehl WE, Ruml T. 2011. Purification of proteins containing zinc finger domains using immobilized metal ion affinity chromatography. Protein Expr Purif 79:88–95.
43.
Candiano G, Bruschi M, Musante L, Santucci L, Ghiggeri GM, Carnemolla B, Orecchia P, Zardi L, Righetti PG. 2004. Blue silver: a very sensitive colloidal Coomassie G-250 staining for proteome analysis. Electrophoresis 25:1327–1333.
44.
Schindelin J, Arganda-Carreras I, Frise E, Kaynig V, Longair M, Pietzsch T, Preibisch S, Rueden C, Saalfeld S, Schmid B, Tinevez J-Y, White DJ, Hartenstein V, Eliceiri K, Tomancak P, Cardona A. 2012. Fiji: an open-source platform for biological-image analysis. Nat Methods 9:676–682.
45.
Klikova M, Rhee SS, Hunter E, Ruml T. 1995. Efficient in vivo and in vitro assembly of retroviral capsids from Gag precursor proteins expressed in bacteria. J Virol 69:1093–1098.
46.
Stansell E, Apkarian R, Haubova S, Diehl WE, Tytler EM, Hunter E. 2007. Basic residues in the Mason-Pfizer monkey virus gag matrix domain regulate intracellular trafficking and capsid-membrane interactions. J Virol 81:8977–8988.
47.
Mastronarde DN. 2005. Automated electron microscope tomography using robust prediction of specimen movements. J Struct Biol 152:36–51.
48.
Kremer JR, Mastronarde DN, McIntosh JR. 1996. Computer visualization of three-dimensional image data using IMOD. J Struct Biol 116:71–76.
49.
Nickell S, Förster F, Linaroudis A, Del Net W, Beck F, Hegerl R, Baumeister W, Plitzko JM. 2005. TOM software toolbox: acquisition and analysis for electron tomography. J Struct Biol 149:227–234.
50.
Förster F, Medalia O, Zauberman N, Baumeister W, Fass D. 2005. Retrovirus envelope protein complex structure in situ studied by cryo-electron tomography. Proc Natl Acad Sci U S A 102:4729–4734.
51.
Castaño-Díez D, Kudryashev M, Arheit M, Stahlberg H. 2012. Dynamo: a flexible, user-friendly development tool for subtomogram averaging of cryo-EM data in high-performance computing environments. J Struct Biol 178:139–151.
52.
Xiong Q, Morphew MK, Schwartz CL, Hoenger AH, Mastronarde DN. 2009. CTF determination and correction for low dose tomographic tilt series. J Struct Biol 168:378–387.
53.
Pettersen EF, Goddard TD, Huang CC, Couch GS, Greenblatt DM, Meng EC, Ferrin TE. 2004. UCSF Chimera: a visualization system for exploratory research and analysis. J Comput Chem 25:1605–1612.
54.
Pruggnaller S, Mayr M, Frangakis AS. 2008. A visualization and segmentation toolbox for electron microscopy. J Struct Biol 164:161–165.
55.
Strohalmová-Bohmová K, Spiwok V, Lepšík M, Hadravová R, Křížová I, Ulbrich P, Pichová I, Bednárová L, Ruml T, Rumlová M. 2014. Role of Mason-Pfizer monkey virus CA-NC spacer peptide-like domain in assembly of immature particles. J Virol 88:14148–14160.
56.
Bohl CR, Brown SM, Weldon RA. 2005. The pp24 phosphoprotein of Mason-Pfizer monkey virus contributes to viral genome packaging. Retrovirology 2:68.
57.
Peng K, Muranyi W, Glass B, Laketa V, Yant SR, Tsai L, Cihlar T, Müller B, Kräusslich H-G. 2014. Quantitative microscopy of functional HIV post-entry complexes reveals association of replication with the viral capsid. eLife 4:1–21.
58.
Zhou L, Sokolskaja E, Jolly C, James W, Cowley SA, Fassati A. 2011. Transportin 3 promotes a nuclear maturation step required for efficient HIV-1 integration. PLoS Pathog 7:e1002194.
59.
Sfakianos JN, LaCasse RA, Hunter E. 2003. The M-PMV cytoplasmic targeting-retention signal directs nascent Gag polypeptides to a pericentriolar region of the cell. Traffic 4:660–670.
60.
Kräusslich HG, Fäcke M, Heuser AM, Konvalinka J, Zentgraf H. 1995. The spacer peptide between human immunodeficiency virus capsid and nucleocapsid proteins is essential for ordered assembly and viral infectivity. J Virol 69:3407–3419.
61.
Liang C, Hu J, Whitney JB, Kleiman L, Wainberg MA. 2003. A structurally disordered region at the C terminus of capsid plays essential roles in multimerization and membrane binding of the gag protein of human immunodeficiency virus type 1. J Virol 77:1772–1783.
62.
Fisher RJ, Rein A, Fivash M, Urbaneja MA, Casas-Finet JR, Medaglia M, Henderson LE. 1998. Sequence-specific binding of human immunodeficiency virus type 1 nucleocapsid protein to short oligonucleotides. J Virol 72:1902–1909.
63.
Avilov SV, Godet J, Piemont E, Mély Y. 2009. Site-specific characterization of HIV-1 nucleocapsid protein binding to oligonucleotides with two binding sites. Biochemistry 48:2422–2430.
64.
Houzet L, Morichaud Z, Didierlaurent L, Muriaux D, Darlix J-L, Mougel M. 2008. Nucleocapsid mutations turn HIV-1 into a DNA-containing virus. Nucleic Acids Res 36:2311–2319.
65.
Kenney SP, Lochmann TL, Schmid CL, Parent LJ. 2008. Intermolecular interactions between retroviral Gag proteins in the nucleus. J Virol 82:683–691.

Information & Contributors

Information

Published In

cover image Journal of Virology
Journal of Virology
Volume 90Number 91 May 2016
Pages: 4593 - 4603
Editor: W. I. Sundquist
PubMed: 26912613

History

Received: 22 December 2015
Accepted: 15 February 2016
Published online: 14 April 2016

Permissions

Request permissions for this article.

Contributors

Authors

Tibor Füzik
Department of Biochemistry and Microbiology, University of Chemistry and Technology Prague, Prague, Czech Republic
Růžena Píchalová
Department of Biochemistry and Microbiology, University of Chemistry and Technology Prague, Prague, Czech Republic
Florian K. M. Schur
Structural and Computational Biology Unit and Molecular Medicine Partnership Unit, European Molecular Biology Laboratory, Heidelberg, Germany
Karolína Strohalmová
Institute of Organic Chemistry and Biochemistry IOCB Research Centre and Gilead Sciences, Academy of Sciences of the Czech Republic, Prague, Czech Republic
Ivana Křížová
Institute of Organic Chemistry and Biochemistry IOCB Research Centre and Gilead Sciences, Academy of Sciences of the Czech Republic, Prague, Czech Republic
Romana Hadravová
Institute of Organic Chemistry and Biochemistry IOCB Research Centre and Gilead Sciences, Academy of Sciences of the Czech Republic, Prague, Czech Republic
Michaela Rumlová
Institute of Organic Chemistry and Biochemistry IOCB Research Centre and Gilead Sciences, Academy of Sciences of the Czech Republic, Prague, Czech Republic
Department of Biotechnology, University of Chemistry and Technology Prague, Prague, Czech Republic
John A. G. Briggs
Structural and Computational Biology Unit and Molecular Medicine Partnership Unit, European Molecular Biology Laboratory, Heidelberg, Germany
Pavel Ulbrich
Department of Biochemistry and Microbiology, University of Chemistry and Technology Prague, Prague, Czech Republic
Tomáš Ruml
Department of Biochemistry and Microbiology, University of Chemistry and Technology Prague, Prague, Czech Republic

Editor

W. I. Sundquist
Editor

Notes

Address correspondence to Pavel Ulbrich, [email protected], or Tomáš Ruml, [email protected].

Metrics & Citations

Metrics

Note:

  • For recently published articles, the TOTAL download count will appear as zero until a new month starts.
  • There is a 3- to 4-day delay in article usage, so article usage will not appear immediately after publication.
  • Citation counts come from the Crossref Cited by service.

Citations

If you have the appropriate software installed, you can download article citation data to the citation manager of your choice. For an editable text file, please select Medlars format which will download as a .txt file. Simply select your manager software from the list below and click Download.

View Options

Figures and Media

Figures

Media

Tables

Share

Share

Share the article link

Share with email

Email a colleague

Share on social media

American Society for Microbiology ("ASM") is committed to maintaining your confidence and trust with respect to the information we collect from you on websites owned and operated by ASM ("ASM Web Sites") and other sources. This Privacy Policy sets forth the information we collect about you, how we use this information and the choices you have about how we use such information.
FIND OUT MORE about the privacy policy