Poxvirus Protein MC132 from Molluscum Contagiosum Virus Inhibits NF-κB Activation by Targeting p65 for Degradation

Human embryonic kidney 293T (HEK293T) cells, HeLa cells, and COS-1 cells were maintained in Dulbecco's modified Eagle's medium (DMEM) containing 10% (vol/vol) fetal calf serum (FCS) and penicillin-streptomycin. Stable cells were selected with 300 μg Hygrogold (Invivogen), and expression of MC132 was induced with dilutions of sterile 10 mM cadmium chloride (Sigma). Sendai virus (ECACC), vesicular stomatitis virus (VSV; a gift from John C. Bell, Ottawa Hospital Research Institute), and modified vaccinia virus Ankara (MVA; a gift from Ingo Drexler, Düsseldorf University) were all used at a multiplicity of infection (MOI) of 10.

MC132 and MC014 were synthesized by Invitrogen and Genscript, respectively, and subcloned into the KpnI and NotI sites of pCEP and cadmium chloride-inducible pMEP4 plasmids (Invitrogen) with a C-terminal Flag tag (DYKDDDDK). The following forward (FP) and reverse (RP) primers were used for cloning of full-length and truncated MC132 into pCEP4: for pCEP4-MC132-Flag, GGGGTACCATGATGAACTTTTCCGACC (FP) and CCCAAGCTTACAACGCTGCAGAAGCAGG (RP); for pCEP4-T0, GGGGTACCATGGACCCGTGCTTGCTAGGT (FP); for pCEP4-T1, GGGGTACCATGTTGCGGCGGCTCGGTTGGC (FP); for pCEP4-T3, GGGAAGCTTGTGTGCCTGCTCGCGAAAG (RP); for pCEP4-T1.2, GGGGTACCATGACCCCCGAAGCAAAAGCG (FP); pCEP4-T3.2, GGGAAGCTTAGGCCAGGGTCCCGAGAGA (RP); and for pCEP4-T3.3, GGGAAGCTTCAAGTGCCGCGCGCAAAT (RP). pCEP4-MC132-HA was made by replacing the Flag sequence with a hemagglutinin (HA) tag. p65 truncations were made using the following primers: for full-length p65(1–551), p65F (GGGGTACCATGGACGAACTGTTCCCC) and p65R (CCCAAGCTTCTCTTCTATAGGAACTTG); for p65(1–147), p65F and 147R (CCCAAGCTTCTCTTCTATAGGAACTTG); for p65(148–300), 148F (GGGGTACCATGCAGCGTGGGGACTACGACC) and 300R (CCCAAGCTTCTCCTCAATCCGGTGACG); for p65(1–300), p65F and 300R; for p65(1–458), p65F and 458R (CCCAAGCTTTGTGCTGTTGCCAAGCAAGG); and for p65(148–458), 148F and 458R. Plasmids expressing Flag-IKKα, Flag-IKKβ, Flag-IKKε, Flag-TRAF2, and Flag-TRAF6 were from Tularik Inc. The sources of other expression plasmids were as follows: Flag-TRIF, S. Akira, Osaka University, Osaka, Japan; Myc-MyD88 and ISRE-luciferase, L. O'Neill, Trinity College Dublin, Dublin, Ireland; CD4-TLR9, A. Ozinsky, University of Washington, WA; CD4-TLR3, R. Medzhitov, Yale University, CT; Flag-MAVS and cGAMP synthase (cGAS), J. Chen, UT Southwestern Medical Centre; RasVHa, D. Cantrell, University of Dundee, Dundee, United Kingdom; Flag–p38 mitogen-activated protein kinase (MAPK), J. Saklatvala, Kennedy Institute of Rheumatology, London, United Kingdom; Elongin B and Elongin C, N. Stevenson, Trinity College Dublin, Dublin, Ireland; and HA-ubiquitin, A. Mansell, Monash University, Melbourne, Australia. The human STING coding region was amplified by PCR from full-length I.M.A.G.E. cDNA clones (IRATp970D0274D and IRAVp968F0688D; imaGenes) and cloned into the vector pCMV-myc (Clontech). The NF-κB–luciferase reporter gene was obtained from R. Hofmeister (Universitat Regensburg, Germany), and the pFR-luciferase reporter and pFA2-Elk1 were from Agilent. Cullin-5 small interfering RNA (siRNA) (5′-AGATTCCTGGCGTAAAAGCTT-3′) was from Invitrogen. Poly(dA:dT) was from Sigma-Aldrich. The sequences of the Elongin B PCR primers were as follows: ElonginB-FP, ATGGACGTGTTCCTCATGATC; and ElonginB-RP, TGCTGTTTGACTGGTGAAGC.

RNAs from HEK293 cells grown in 12-well plates were extracted using an RNeasy kit (Qiagen) and converted to cDNAs by using a Quantitect RT kit (Qiagen). Elongin B mRNA was quantified by real-time PCR with the TaqMan gene expression assay Hs00277188_s1 and a β-actin endogenous control VIC-MGB probe (6-carboxyrhodamine–minor groove binder; Applied Biosystems). Experiments were performed in triplicate.

Primary antibodies (Abs) used for immunoblotting were anti-β-actin (AC-74), anti-Myc (9E10), and anti-Flag (M2) from Sigma-Aldrich; anti-IκBα from R. Hay, University of Dundee, Dundee, United Kingdom; anti-phospho-p65 (Ser536; 93H1), anti-p65 (C-20), and anti-Cullin-5 from Santa Cruz; and anti-HA from Covance. The secondary Abs for immunoblotting were IRDye 680LT-conjugated anti-mouse, IRDye 800CW-conjugated anti-rabbit, and IRDye 680LT-conjugated anti-goat Abs (Li-Cor Biosciences). Secondary Abs for confocal microscopy were Alexa Fluor 647-conjugated anti-mouse or Alexa Fluor 488-conjugated anti-rabbit Abs (Invitrogen). An anti-rabbit isotype control antibody was obtained from Sigma.

Cell culture supernatants were assayed for expression of the IL-8 protein by use of an enzyme-linked immunosorbent assay (ELISA) kit (R&D Systems) according to the manufacturer's instructions.

Cells were seeded at 5 × 10⁵ cells/well in 6-well dishes and transfected the next day with 3 μg total DNA by use of GeneJuice (Novagen). Twenty-four hours later, cells were lysed in 200 μl sample buffer (187.5 mM Tris [pH 6.8], 6% [wt/vol] SDS, 30% [vol/vol] glycerol, 0.3% [wt/vol] bromophenol blue, 150 mM dithiothreitol [DTT], and Benzonase), incubated on ice for 5 min, and then boiled for 5 min at 99°C. Twenty-microliter lysates were resolved by 10 to 20% SDS-PAGE, transferred to polyvinylidene difluoride membranes (Millipore), blocked for 1 h in 3% (wt/vol) bovine serum albumin (BSA) in phosphate-buffered saline (PBS), and probed overnight with a primary Ab (1:1,000 dilution in blocking solution). The next day, membranes were incubated with secondary Abs (1:10,000 dilution in blocking solution), and blots were visualized using an Odyssey imaging system (Li-Cor Biosciences).

Cells were seeded at 4 × 10⁶ cells/10-cm dish and transfected with 8 μg total plasmid the next day. Twenty-four hours later, cells were washed with ice-cold PBS and then scraped into lysis buffer (50 mM Tris [pH 7.4], 150 mM NaCl, 0.5% [vol/vol] NP-40, 30 mM NaF, 5 mM EDTA, 10% [vol/vol] glycerol, and 40 mM β-glycerophosphate containing inhibitors, i.e., 1 mM Na₃VO₄, 1 mM phenylmethylsulfonyl fluoride [PMSF], and 1% [vol/vol] aprotinin) and left on ice for 45 min. Anti-Flag beads (Sigma) were equilibrated with lysis buffer, and cleared lysates were mixed with beads and incubated for 2 h with rolling at 4°C. Beads were then washed three times with 1 ml lysis buffer, and immunoprecipitated material was eluted with 3× Flag peptide (Sigma) for 30 min with rolling at 4°C, after which it was separated and immunoblotted, with probing for the indicated proteins.

Cells were seeded at 3 × 10⁵ cells/ml on glass coverslips in 24-well plates and stimulated the next day as indicated. Cells were fixed for 12 min in 4% (wt/vol) paraformaldehyde and permeabilized for 15 min with 0.5% (vol/vol) Triton X-100 in PBS. Coverslips were blocked for 1 h in 5% (wt/vol) BSA-0.05% (vol/vol) Tween 20 in PBS and stained overnight with primary Abs (1:200 dilution in blocking solution). The following day, coverslips were incubated for 3 h with secondary Abs (1:500 dilution in blocking solution) and mounted in Mowiol 4-88 (Calbiochem) containing 1 mg/ml DAPI (4′,6-diamidino-2-phenylindole). Images were obtained with an Olympus FV1000 confocal microscope using a 360× oil-immersion objective.

For reporter gene assays, cells were seeded at 1 × 10⁵ cells/ml in 96-well plates and transfected 16 h later, using GeneJuice transfection reagent (Novagen), with 80 ng reporter luciferase, 20 ng pGL3-renilla luciferase, and the indicated amounts of expression vectors and MCV ORFs, with the total amount of DNA adjusted to 230 ng with the empty vector pCMV-HA. Twenty-four hours after transfection, cells were either stimulated with cytokines, infected with virus for 24 h, or directly lysed in passive lysis buffer (Promega) and analyzed for luciferase activity. Firefly luciferase activity was normalized to renilla luciferase activity to control for transfection efficiency. For the Ras-driven Elk1 reporter assay, 1 ng of the pFA-Elk1 expression vector together with the pFR-luciferase reporter plasmid (80 ng) was employed, using a Ras-Ha expression vector for pathway activation.

Expression of Flag-tagged ORFs was induced by use of 1 μM CdCl₂ in stably transfected HEK293T cells. After 24 h, cells were washed in 1× PBS, pelleted at 3,000 × g for 5 min at 4°C, and snap-frozen in liquid nitrogen. Cell pellets were thawed on ice and resuspended in 1 ml ice-cold TAP lysis buffer (50 mM Tris-HCl, pH 7.5, 4.3% glycerol, 0.2% NP-40, 1.5 mM MgCl₂, 100 mM NaCl) supplemented with EDTA-free Complete protease inhibitor cocktail (Roche) and 250 U Benzonase (Sigma-Aldrich). After incubation on ice for 30 min, lysates were centrifuged at 12,000 × g for 5 min at 4°C. Cleared lysates were incubated with 40 μl anti-Flag M2 affinity gel (Sigma-Aldrich) for 1 h on a rotating wheel at 4°C. After incubation, the resin was washed in TAP lysis buffer (with the final 2 washes performed without NP-40) and resuspended in 40 μl 6 M guanidinium-HCl in 100 mM Tris, pH 8.5, supplemented with 10 mM tris(2-carboxyethyl)phosphine (TCEP) and 40 mM chloroacetamide. After 30 min of incubation at room temperature in the dark, lysates were diluted 1:10 with digestion buffer (10% acetonitrile, 25 mM Tris, pH 8.5) and incubated with 0.5 μg EndoLysC (Wako Chemicals) and 0.5 μg sequencing-grade modified trypsin (Promega) overnight on a rotating wheel at room temperature. After digestion, peptides were acidified with trifluoroacetic acid, desalted on reversed-phase C₁₈ StageTips, and eluted before liquid chromatography-tandem mass spectrometry (LC-MS/MS) using buffer B (80% acetonitrile, 0.5% acetic acid). Eluted peptides were analyzed on a nanoflow EASY-nLC system coupled to an LTQ-Orbitrap XL mass spectrometer (Thermo Fisher Scientific). Peptide separation was achieved on a C₁₈ reversed-phase column (ReproSil-Pur C₁₈-AQ; 1.9 μm by 200 mm by 0.075 mm; Dr.Maisch), using a 120-min linear gradient from 2 to 60% acetonitrile in 0.1% formic acid. The LTQ-Orbitrap XL MS was operated with a Top10 MS/MS spectrum acquisition method in the linear ion trap mode for each MS full scan. Raw files were processed with MaxQuant (version 1.4.1.4) and searched with the built-in Andromeda search engine against a human protein database (UniprotKB, release 2012_01) concatenated with a decoy of reversed sequences, using a label-free quantification (LFQ) algorithm as described previously (7). Carbamidomethylation was set as a fixed modification, while methionine oxidation and protein N-acetylation were included as variable modifications. The search was performed with an initial mass tolerance of 6 ppm for the precursor ion and 0.5 Da for the fragment ions. Search results were filtered in Perseus (version 1.4.1.8), with a false discovery rate (FDR) of 0.01. Prior to statistical analysis, known contaminants and reverse hits were removed. Proteins identified with at least 2 unique peptides and a minimum of 2 quantitation events in at least one experimental group were considered for analysis. LFQ protein intensity values were log transformed, and missing values were filled in by imputation, with random numbers drawn from a normal distribution. Significant interactors were determined using the two-sample t test with the Welch correction after 250 permutations, with the FDR threshold set to 0.01 and S₀ empirically set to 1. Results were plotted using R (release version 2.15.3).

Cells were seeded at 4 × 10⁶ cells/10-cm dish and transfected with 2.5 nM Elongin B siRNA (AATGAACAAGCCGTGCAGTGA), 20 nM Cullin-5 siRNA (AGATTCCTGGCGTAAAAGCTT), or control siRNA, using Lipofectamine (Invitrogen). The next day, cells were transfected with a second dose of siRNA and simultaneously transfected with the indicated plasmids, and they were harvested the following day.

In order to identify novel MCV inhibitors of human innate immunity, we analyzed the MCV genome for ORFs predicted to encode small, soluble proteins of unknown function and tested the effects of expression of 31 ORFs on inflammatory signaling. To do this, we stimulated HEK293T cells with TNF-α and measured the activation of an NF-κB-dependent reporter gene in the presence of transfected MCV ORF expression plasmids. This screen revealed MC132 as an inhibitor of TNF-activated NF-κB, in contrast to an unrelated MCV protein, MC014, which had no effect on this pathway (Fig. 1A). The effect of MC132 on NF-κB was not due to toxicity or nonspecific effects on reporter genes, since a constitutively active form of Ras (8), RasVHa, which activates Elk1 (using an Elk-1/GAL4 DNA-binding-domain fusion which monitors upstream activation of Elk-1 through a GAL4 promoter luciferase system), was unaffected by MC132 expression (Fig. 1D). Both MC132 and MC014 were expressed at similar levels (Fig. 1B), and MC132 exhibited cytoplasmic localization, whereas MC014 was localized to the nucleus (Fig. 1C).

We next examined the effect of MC132 on the activation of NF-κB by expression of TRAF2, a key regulatory component of the TNF receptor signaling pathway, and we also observed potent inhibition of this signal by MC132 (Fig. 1E). Inhibition of TRAF2-stimulated NF-κB by MC132 was independent of the cell type tested, since apart from HEK293T cells, inhibition was also observed in Cos-1 cells (Fig. 1F) and HeLa cells (Fig. 1G). We next established HEK293T cell lines with MC132 expression under the control of a metallothionein promoter, allowing expression to be induced by CdCl₂. Using these cells, we demonstrated that NF-κB inhibition by MC132 translated into suppression of secretion of an important NF-κB-dependent cytokine, namely, IL-8 (Fig. 1H). Together, these results establish MC132 as a novel MCV NF-κB inhibitor.

Since NF-κB inhibitors in other poxviruses often act downstream, at points of signaling convergence, in order to disable multiple detection pathways (3), we determined the effect of MC132 on NF-κB activation pathways other than the TNF pathway. Thus, we next examined the effect of MC132 on IL-1-activated NF-κB. MC132, but not MC014, potently inhibited activation of NF-κB by IL-1, as well as NF-κB activation by the IL-1 signaling components TRAF6 and MyD88 (Fig. 2A, C, and D), with similar levels of MCV protein expression (Fig. 2B). Since TLR9, like IL-1, also signals in a MyD88-dependent manner, we tested the effect of the MCV ORFs on TLR9 signaling and found that MC132 also inhibited TLR9-dependent NF-κB activation (Fig. 2E), while not affecting a TLR9-stimulated ISRE-dependent reporter gene which monitors IRF activation (Fig. 2F). Similarly, activation of NF-κB by TLR3, but not that of the ISRE reporter, was also inhibited (Fig. 2G and H), as was NF-κB stimulated by the TLR3 adapter protein TRIF (Fig. 2I). Both TLR9 and TLR3 have key roles in responding to poxviruses in vivo (9, 10), and both are characteristically upregulated in MCV-infected lesions, despite a lack of inflammation or viral clearance in such lesions under most circumstances (11). This is consistent with the notion that MC132 may prevent TLR3- and TLR9-driven responses in vivo.

We next examined the effect of MC132 on the activation of innate signaling pathways during live poxvirus infection. As there are currently no experimental in vitro or in vivo models for MCV infection, we utilized a model comprising infection of HEK293T cells with modified vaccinia virus Ankara (MVA), an attenuated VACV strain that activates type I IFN gene induction in cell culture (Fig. 3C). Interestingly, while MC132 potently inhibited MVA-driven NF-κB activation (Fig. 3A), it had no effect on MVA-driven ISRE-luciferase activation (Fig. 3B). The human IFN-β gene promoter requires both NF-κB and IRF transcription factor transactivation during virus infection (12), and consistent with this, MC132 did inhibit induction of the MVA-stimulated IFN-β promoter (Fig. 3C).

We next examined the effect of MC132 on other pathways known to be involved in primary sensing of poxvirus infection, such as the cGAMP synthase (cGAS) cytosolic DNA sensor, which operates via STING (13, 14). Coexpression of cGAS and STING in HEK293T cells, which reconstitutes cGAS signaling (15), led to NF-κB and IRF activation. Consistent with the MVA data, MC132 potently inhibited cGAS-induced NF-κB activation but not cGAS-induced ISRE induction (Fig. 3D and E). In HEK293T cells, which lack TLR3, TLR9, and cGAS sensing pathways, it is likely that MVA activates NF-κB through the RNA polymerase III (Pol III) response (3). Pol III transcribes AT-rich DNA into an RNA ligand that activates the RIG-I–MAVS sensing system and has been implicated in sensing intracellular poxviral DNA (16). Thus, we stimulated cells expressing similar levels of MCV proteins (Fig. 3G) with poly(dA:dT) to activate Pol III-dependent signaling to NF-κB, and we found that MC132 potently inhibited both RIG-I- and MAVS-driven NF-κB activation (Fig. 3F and H).

To determine if MC132 could act as a general inhibitor of virus-induced NF-κB activation, we examined its effect on RNA virus-activated NF-κB by using vesicular stomatitis virus (VSV), and again, we observed a potent inhibition of this signal by MC132 (Fig. 3I). Since VSV infection is chiefly detected through RIG-I activation in these cells (17), these data are consistent with what was seen for the Pol III response, which operates via RIG-I (Fig. 3F). As an additional confirmation of the specificity of MC132 inhibition of the NF-κB pathway, we examined the effect of MC132 on phorbol myristate acetate (PMA)-stimulated activation of signaling pathways. While MC132 caused a potent, dose-dependent inhibition of PMA-activated NF-κB, it had no effect on PMA-activated Elk1 (Fig. 3J and K).

The data thus far suggested that the novel MCV inhibitor MC132 was targeting NF-κB activation at a common convergence point in the network of signal transduction pathways that would be activated during viral infection, namely, the IKK complex (Fig. 4A). The IKK complex consists of two kinases, IKKα and -β, which are required for NF-κB activation and directly regulate the transcription factor through phosphorylation of both IκΒ, driving its degradation, and the p65 subunit, with phosphorylation at key sites required for transactivation (3). We examined the effect of MC132 on NF-κB activation by IKKs by determining the expression of IKKα and IKKβ. In each case, we observed a potent inhibition of IKK-stimulated NF-κB activation (Fig. 4B and C) with similar levels of MCV protein expression (Fig. 4D), suggesting that MC132 was exerting its effect further downstream.

We next investigated the precise mechanism by which MC132 inhibits NF-κB downstream of IKK activation by examining direct NF-κB activation, as measured by detection of phosphorylated p65. To do this, we stimulated the MC132-expressing CdCl₂-induced stable cell line described earlier (Fig. 1H) with TNF. This showed a profound inhibition of p65 phosphorylation in MC132-expressing cells compared to pMEP4 empty vector control cells (Fig. 5A, top panel). Inhibition of p65 phosphorylation in the presence of MC132 expression was associated with a notable decrease in the protein expression levels of p65 (Fig. 5A, second panel). Thus, we next investigated whether MC132-stimulated decreased levels of p65 protein expression might be the primary mechanism through which MC132 exerts its effect on NF-κB. Using the MC132-expressing cells, different concentrations of CdCl₂ allowed titrated expression of the MC132 protein, and this demonstrated a direct correlation between increased expression of MC132 and reduced expression of p65 compared to that in control cells stably carrying the empty vector (Fig. 5B). Consistent with this, confocal microscopy showed that cells transiently transfected with the plasmid expressing MC132 displayed decreased staining of p65 compared to nontransfected bystander cells (Fig. 5C). In order to determine whether an MC132-mediated reduction of p65 expression explained the observed inhibition of NF-κB activity, the ability of ectopic p65 expression to overcome MC132 inhibition of NF-κB was examined. While MC132 was still able to inhibit p65-induced NF-κB activation when p65 was expressed at low levels, this inhibition was overcome when more of the plasmid encoding p65 was transfected into cells (Fig. 5D).

Further analysis of the relationship between MC132 and p65 showed that the proteins strongly coimmunoprecipitated (Fig. 6A), and construction of a series of truncation mutants of p65 demonstrated that MC132 interacted only with any p65 truncation containing the N-terminal half of the DNA-binding Rel homology domain (RHD), indicating that MC132 interacts with p65 through this region (Fig. 6B). To determine the region of MC132 responsible for binding p65, we also constructed a series of truncation mutants of MC132, gradually removing distinct portions from the N and C termini of the protein and testing the expression of the mutants (Fig. 6C, upper panel). Even minimal truncations of MC132, where as few as 6 amino acids at the N terminus or 18 amino acids at the C terminus were absent, abrogated its ability to bind p65 (Fig. 6C, lower panels). Importantly, there was a direct correlation between the lack of binding of MC132 truncation mutants to p65 (Fig. 6C, lower panels) and a lack of inhibition of NF-κB (Fig. 6D). These data suggest that the entire MC132 protein is required to inhibit p65 function through direct binding to the p65 RHD, thereafter somehow stimulating p65 degradation.

In order to reveal the mechanism whereby MC132 can mediate p65 degradation, we explored which cellular proteins, apart from p65, MC132 might interact with by performing unbiased affinity purification combined with mass spectrometry (AP-MS), using the MC132-expressing inducible stable cell line (Fig. 5A and B). Analysis of MC132 interaction partners by AP-MS showed that four proteins were significantly enriched in the MC132 immunoprecipitates: TCEB2 (Elongin C), TCEB2 (Elongin B), CUL5 (Cullin-5), and PP1A (peptidyl-prolyl cis-trans isomerase A) (Fig. 7A). Peptides corresponding to p65 were detected in MC132 immunoprecipitates but not significantly enriched (data not shown), likely due to the stimulated degradation of p65 in the MC132-induced line. Note that Cullin-5 and Elongin B/C have previously been demonstrated to facilitate ubiquitin-mediated p65 degradation by gammaherpesvirus proteins with no sequence similarity to MC132, i.e., latent nuclear protein-1 (LANA-1) in Kaposi's sarcoma-associated herpesvirus (KSHV) (18) and the ORF73 protein in murid herpesvirus 4 (MuHV-4) (19). Thus, we examined the ability of MC132 to recruit p65 to the Elongin B/Elongin C/Cullin-5 E3 ligase complex to effect p65 degradation. Coimmunoprecipitation of ectopically expressed Elongin B showed that MC132 could associate with Elongin B in the presence or absence of ectopically expressed Elongin C (Fig. 7B, lanes 6 and 8). Note that p65 associated with Elongin B only when MC132 was present, not when it was absent (Fig. 7B, compare lane 9 to lane 10), suggesting that MC132 recruits p65 to the Elongin complex. Thus, we assayed the ability of MC132 to cause ubiquitination of endogenous p65 (in the presence of the proteasome inhibitor MG132 to prevent degradation of ubiquitin-tagged p65). Interestingly, p65 was ubiquitinated in the presence of full-length MC132 but not in the presence of the T3 MC132 truncation (Fig. 7C), which we previously observed to be defective in both p65 binding and NF-κB inhibition (Fig. 6C and D). This suggested that MC132 recruitment of p65 to the Elongin B/C complex might target p65 for ubiquitination and subsequent degradation via Cullin-5 E3 ligase activity. To test this, we employed RNA interference to target Elongin B. When Elongin B expression was reduced by the use of siRNA, as determined by real-time PCR (Fig. 7D), the ability of MC132 to cause p65 ubiquitination was significantly compromised (Fig. 7E, compare lane 6 to lane 3). Additionally, siRNA knockdown of Elongin B also marginally but reproducibly enhanced TRAF6-driven NF-κB activity (Fig. 7F, compare bar 3 and bar 1) and completely reversed the inhibition caused by MC132 (compare bar 4 and bar 6). We also depleted Cullin-5 by RNA interference (Fig. 7G) and observed that the ability of MC132 to cause p65 ubiquitination was partially compromised (Fig. 7H, compare lane 4 to lane 2), suggesting that Cullin-5 may play a less essential role in MC132-driven p65 degradation than that of Elongin B, possibly due to redundancy between Cullin family members. Overall, the data suggest that MCV utilizes MC132 to capture p65 for ubiquitin-mediated degradation, leading to effective suppression of NF-κB activity (Fig. 8).