Hsp90 Is Required for Snakehead Vesiculovirus Replication via Stabilization of the Viral L Protein
ABSTRACT
Snakehead vesiculovirus (SHVV), a kind of fish rhabdovirus isolated from diseased hybrid snakehead fish, has caused great economic losses in snakehead fish culture in China. The large (L) protein, together with its cofactor phosphoprotein (P), forms a P/L polymerase complex and catalyzes the transcription and replication of viral genomic RNA. In this study, the cellular heat shock protein 90 (Hsp90) was identified as an interacting partner of SHVV L protein. Hsp90 activity was required for the stability of SHVV L because Hsp90 dysfunction caused by using its inhibitor destabilized SHVV L and thereby suppressed SHVV replication via reducing viral RNA synthesis. SHVV L expressed alone was detected mainly in the insoluble fraction, and the insoluble L was degraded by Hsp90 dysfunction through the proteasomal pathway, while the presence of SHVV P promoted the solubility of SHVV L and the soluble L was degraded by Hsp90 dysfunction through the autophagy pathway. Collectively, our data suggest that Hsp90 contributes to the maturation of SHVV L and ensures the effective replication of SHVV, which exhibits an important anti-SHVV target. This study will help us to understand the role of Hsp90 in stabilizing the L protein and regulating the replication of negative-stranded RNA viruses.
IMPORTANCE It has long been proposed that cellular proteins are involved in viral RNA synthesis via interacting with the viral polymerase protein. This study focused on identifying cellular proteins interacting with the SHVV L protein, studying the effects of their interactions on SHVV replication, and revealing the underlying mechanisms. We identified Hsp90 as an interacting partner of SHVV L and found that Hsp90 activity was required for SHVV replication. Hsp90 functioned in maintaining the stability of SHVV L. Inhibition of Hsp90 activity with its inhibitor degraded SHVV L through different pathways based on the solubility of SHVV L due to the presence or absence of SHVV P. Our data provide important insights into the role of Hsp90 in SHVV polymerase maturation, which will help us to understand the polymerase function of negative-stranded RNA viruses.
INTRODUCTION
The large (L) protein of the nonsegmented negative-stranded RNA viruses, members of the order Mononegavirales, is an ∼240-kDa RNA-dependent RNA polymerase that catalyzes viral RNA (vRNA) synthesis. The L protein, together with the phosphoprotein (P), forms a P/L polymerase complex that functions for the transcription and replication of viral genomic RNA. In addition to the viral P protein, it has long been suggested that host proteins are involved in the function of viral L protein. β-tubulin, elongation factor 1, and guanylyltransferase interact with vesicular stomatitis virus (VSV) L protein and function as necessary factors for the synthesis of VSV RNAs (1–3). DNA topoisomerase 1 colocalizes and interacts with Ebola virus L protein and is required for efficient polymerase activity (4). Dynein light chain 1 acts as a transcription factor that stimulates rabies virus (RV) primary transcription by binding to the viral L protein (5). Heat shock protein 90 (Hsp90) functions as a molecular chaperone of the L proteins of human respiratory syncytial virus (HRSV), VSV, Nipah virus (NiV), measles virus (MeV), and mumps virus (MuV) (6–8). R2TP (Rvb1-Rvb2-Tah1-Pih1) complex is a cochaperone of Hsp90 and is involved in regulating the transcription of MeV and MuV by interacting with their L proteins (9).
Hsp90, an evolutionarily conserved molecular chaperone from bacteria to mammals, has been extensively confirmed to be required for virus replication (6–22). By promoting the proper folding and maturation, Hsp90 contributes to the stability of viral proteins and thus regulates virus replication (23). Hsp90 activity is important for bluetongue virus (BTV) replication by stabilizing and preventing degradation of the BTV proteins (20). In the case of rubella virus (RUBV), Hsp90 is an important host factor for RUBV replication by contributing to the functional integrity of the p150 protein and promoting p200 processing (21). Foot-and-mouth disease virus (FMDV) assembles capsid via the multimerization of several copies of a single capsid precursor protein into a pentamer, and Hsp90 promotes FMDV capsid precursor processing and subsequent pentamer formation (17). In addition, increasing evidence suggests that Hsp90 binds with the viral polymerase protein L and maintains its stability, such as in HRSV (6), VSV (7), NiV (7), MeV (7), and MuV (8). However, the underlying mechanism was still not fully clear.
Snakehead vesiculovirus (SHVV), a fish rhabdovirus isolated from diseased hybrid snakehead fish (24), contains a single-stranded, nonsegmented, negative-sense RNA molecule with a size of ∼11 kb. The SHVV genome encodes five structural proteins including nucleoprotein (N), P protein, matrix protein (M), glycoprotein (G), and L protein (25, 26). In this study, we identified Hsp90 as an interacting partner of SHVV L and a host factor required for SHVV replication because SHVV replicated poorly when Hsp90 was knocked down by specific small interfering RNA (siRNA) or inhibited by inhibitors. Further study showed that Hsp90 activity was required for stabilizing SHVV L, and the SHVV P also played an important role in the stability of SHVV L via preventing the L protein from misfolding and aggregating into the insoluble form. Moreover, the soluble and insoluble SHVV L underwent degradation by Hsp90 dysfunction through the autophagy pathway and proteasomal pathway, respectively. In summary, our data reveal that Hsp90 regulates SHVV replication by stabilizing the L protein.
RESULTS
Identification of Hsp90 as an interacting partner of SHVV L protein.
To identify cellular binding partners of SHVV L protein, coimmunoprecipitation (Co-IP) was performed on SHVV-infected channel catfish ovary (CCO) cells using rabbit anti-SHVV-L antibody and rabbit IgG. CCO cells without SHVV infection were used as control. The eluted samples were separated by SDS-PAGE followed by silver staining (Fig. 1A). Mass spectrometry analysis identified 32 potential interacting partners of SHVV L (Fig. 1B), among which Hsp90 and Hsp70 are two heat shock proteins that have been reported to regulate the replication of many mammalian viruses. Moreover, the unique peptide number of Hsp90 is the highest among the captured proteins. Therefore, this study focuses on the role of Hsp90 and Hsp70 in SHVV replication and the related mechanisms. The results indicated that Hsp90, but not Hsp70, coimmunoprecipitated with SHVV L (Fig. 1C). Furthermore, subcellular localization of Hsp90 and SHVV L was conducted. We found that both the enhanced green fluorescent protein L (EGFP-L) (green) and DsRed-Hsp90 (red) localized in the cytoplasm and colocalized at several sites (yellow) (Fig. 1D). These results strongly suggest that Hsp90 is an interacting partner of SHVV L.
FIG 1
Effects of knockdown or activity inhibition of Hsp90 on SHVV replication.
To evaluate the effects of Hsp90 on SHVV replication, we synthesized three Hsp90-specific siRNAs (siHsp90-1, siHsp90-2, and siHsp90-3). Transfection of siHsp90-1 caused the most effective decrease to Hsp90 protein level compared to that of siHsp90-2 or siHsp90-3 (Fig. 2A). Therefore, CCO cells were transfected with siHsp90-1 or the control siRNA (siNC), followed by SHVV infection at 24 h posttransfection. Virus titer in the supernatants and G protein in cells were detected at 24 h postinfection (hpi). We found that siHsp90-1 significantly reduced virus titer and G protein level (Fig. 2B), indicating that Hsp90 was required for SHVV replication.
FIG 2
To examine whether Hsp90 activity was required for SHVV replication, we used two Hsp90 inhibitors, including geldanamycin and its derivative 17-DMAG. The toxicity of 17-DMAG and geldanamycin to CCO cells was analyzed. Cell viability was not significantly affected by 17-DMAG or geldanamycin at concentrations of up to 5 μM (Fig. 2C and E). CCO cells were infected with SHVV and cultured with 5 μM 17-DMAG or geldanamycin. At 24 hpi, virus titer in the supernatants and G protein in cells were detected. The results showed that both 17-DMAG and geldanamycin significantly reduced virus titers and G protein levels (Fig. 2D and F), indicating that Hsp90 activity was required for SHVV replication. In addition, geldanamycin and 17-DMAG significantly inhibited the Hsp90 activity of CCO cells (Fig. 2G). Due to stronger inhibitory effect on SHVV replication, 17-DMAG, but not geldanamycin, was selected for the following research.
Hsp90 activity is required for SHVV RNA synthesis.
To further evaluate the importance of Hsp90 activity in viral RNA synthesis, CCO cells were infected with SHVV and cultured with or without 17-DMAG. At 3, 6, 9, 12, 18, and 24 hpi, the cells were collected. Total RNA was extracted, and the G mRNA and vRNA were measured by quantitative reverse transcription-PCR (qRT-PCR). When CCO cells were cultured without 17-DMAG, the viral G mRNA and vRNA levels increased along with the time (Fig. 3A and B). When the cells were treated with 17-DMAG, the G mRNA (Fig. 3A) and vRNA (Fig. 3B) levels were significantly reduced. Overall, these results indicate that the Hsp90 activity is required for SHVV RNA synthesis.
FIG 3
SHVV L protein is a client of Hsp90.
The Hsp90 client proteins are destabilized when Hsp90 activity is inhibited (27). To examine the effects of Hsp90 activity on the expression level of the L protein during SHVV infection, CCO cells were infected with SHVV and cultured with or without 17-DMAG. The cell extracts were collected at 0, 6, 12, and 24 hpi, and the expression levels of the L and Hsp90 proteins were detected. The results showed that, in the absence of 17-DMAG, the level of SHVV L gradually increased along with the time, while the presence of 17-DMAG significantly reduced the level of SHVV L (Fig. 4A). However, the level of Hsp90 was not significantly changed by 17-DMAG during the infection period (Fig. 4A).
FIG 4
To further verify whether SHVV L was a client of Hsp90, we checked the effects of 17-DMAG on the expression levels of N, P, M, G, and L proteins of SHVV using expression plasmids. The 293T cells were transfected with plasmid pCDNA-N, pCDNA-P, pCDNA-M, pCDNA-G, or pCDNA-L and cultured with or without 17-DMAG. The cell extracts were collected to examine the expression levels of the N, P, M, G, and L proteins. The results showed that the levels of the N, P, M, and G proteins were not significantly changed by 17-DMAG, while the level of the L protein was reduced (Fig. 4B). These data indicate that SHVV L is a client protein of Hsp90.
The role of SHVV P in Hsp90 dysfunction-mediated degradation of SHVV L.
Since P protein also functions as a chaperone of the viral L protein (7, 8), we examined the role of P protein in Hsp90 dysfunction-mediated degradation of SHVV L. The 293T cells were transfected with pCDNA-L alone or together with pCDNA-P. The cells were cultured with or without 17-DMAG for 24 h, and the L protein was then detected. The results showed that SHVV L expressed alone was degraded when the cells were treated with 17-DMAG, and the degradation was significantly promoted by the coexpression of SHVV P (Fig. 5A). We next evaluated whether SHVV L was degraded through the proteasomal pathway. The results showed that Hsp90 dysfunction-mediated degradation of SHVV L was eliminated by the proteasome inhibitor MG132 in the absence, but not in the presence, of SHVV P (Fig. 5B). We then checked whether SHVV L was degraded through the autophagy or lysosomal pathway in the presence of SHVV P by using the inhibitors 3-MA and NH4Cl (28). We found that, in the presence of SHVV P, Hsp90 dysfunction-mediated degradation of SHVV L was eliminated by the autophagy pathway inhibitor 3-MA but not by the lysosomal pathway inhibitor NH4Cl (Fig. 5C). All of these results suggest that SHVV P affects Hsp90 dysfunction-mediated degradation of SHVV L.
FIG 5
SHVV P affects Hsp90 dysfunction-mediated degradation of SHVV L via promoting the solubility of the L protein.
To determine how the SHVV P affects Hsp90 dysfunction-mediated degradation of SHVV L, 293T cells were transfected with pCDNA-L alone or together with pCDNA-P and cultured with or without 17-DMAG. The cells were lysed using a urea-free lysis solution, and the soluble fraction was collected after centrifugation. Then, the pellet was lysed with a lysis solution containing 8 M urea and then centrifuged. The supernatant was used as the insoluble fraction. The results showed that in the absence of SHVV P, most of the SHVV L was detected in the insoluble fraction, while the SHVV L was detected in both the soluble and insoluble fractions with similar levels in the presence of SHVV P (Fig. 6A). These results suggest that SHVV P promotes the solubility of SHVV L. We then evaluated the Hsp90 dysfunction-mediated degradation of the soluble and insoluble L proteins. In the absence of SHVV P, the Hsp90 dysfunction-mediated degradation of the insoluble L protein was eliminated by MG132 (Fig. 6B). However, in the presence of SHVV P, the Hsp90 dysfunction-mediated degradation of the soluble L protein can be eliminated by 3-MA, while the degradation of the insoluble L protein can be eliminated by MG132 (Fig. 6B), indicating that the soluble L protein was degraded through the autophagy pathway, while the insoluble L protein was degraded through the proteasomal pathway. All of the data indicate that SHVV P affects Hsp90 dysfunction-mediated degradation of SHVV L via promoting the solubility of the L protein.
FIG 6
DISCUSSION
L protein, an RNA-dependent RNA polymerase of the nonsegmented negative-stranded RNA viruses, functions in the transcription and replication of the viral genomic RNA. Although several host proteins have been identified as being involved in the function of the viral L protein (1–9), it is still of interest to investigate the interacting partners of the L protein and unveil the effects of the interactions on virus replication. In this study, the cellular interactome of SHVV L was investigated in SHVV-infected cells using Co-IP and liquid chromatography-tandem mass spectrometry (LC-MS/MS). Of the 32 potential interacting proteins, two heat shock proteins, including Hsp90 and Hsp70, were selected for further verification because both Hsp90 and Hsp70 have been identified in the interactomes of HRSV and MuV L proteins (6, 9). However, Hsp90, but not Hsp70, has been proven to interact with the L proteins of HRSV, MeV, and MuV (6–8). Herein, Hsp90 was also proven to be an interacting partner of SHVV L by using Co-IP and subcellular localization. However, although coprecipitated with the L protein in SHVV-infected cells, Hsp70 was not coprecipitated with SHVV L expressed alone in cells. It is thereby hypothesized that Hsp70 might indirectly interact with the L proteins of SHVV, HRSV, and MuV via binding to other viral proteins that associate with the L proteins, such as the P protein.
Hsp90, a molecular chaperone that facilitates the folding and stabilization of its client proteins (29), has been extensively confirmed to be required for virus replication via maintaining the stability of viral proteins (9, 12–15, 17, 18, 20–22, 30). The data in the present study showed that Hsp90 dysfunction suppressed SHVV RNA synthesis, protein expression, and viral production. Since we used Hsp90-targeted siRNA and two kinds of Hsp90-specific inhibitors, it is unlikely that our results were related to off-target activities. Moreover, our data suggested that Hsp90 activity was required for SHVV replication via stabilizing SHVV L as the Hsp90 dysfunction by its inhibitor-degraded SHVV L. Similarly, the Hsp90 activity was also required for maintaining the stability of the L proteins of HRSV, VSV, NiV, and MuV because Hsp90 dysfunction also caused degradation of these L proteins (6–8). The exception is the MeV L, which was poorly affected by Hsp90 inhibitor when expressed alone (7). Our data, together with previous reports (6–8), demonstrate that Hsp90 chaperone activity is required for the stability of the L proteins of many mononegaviruses.
The presence or absence of P protein may affect Hsp90 dysfunction-mediated degradation of the L protein. Hsp90 dysfunction caused degradation of HRSV L, irrespective of the P coexpression (6). However, the MeV L expressed alone was poorly affected by the Hsp90 dysfunction, while the presence of MeV P significantly promoted Hsp90 dysfunction-mediated degradation of MeV L (7). In this study, we found that Hsp90 dysfunction degraded SHVV L no matter the absence or presence of SHVV P, but the presence of SHVV P also significantly promoted Hsp90 dysfunction-mediated degradation of SHVV L. More importantly, the Hsp90 dysfunction-mediated degradation of SHVV L was alleviated by MG132 (proteasomal pathway inhibitor) in the absence of SHVV P, while it was alleviated by 3-MA (autophagy pathway inhibitor) in the presence of SHVV P. This phenomenon was quite different from MeV L. In the presence of P, the Hsp90 dysfunction-mediated degradation of MeV L was alleviated by MG132 but not 3-MA (7). Our data, together with a previous report (7), suggest that P protein affects the degradation of the L proteins of mononegaviruses when Hsp90 activity is inhibited.
The viral P protein functions differently in the maturation of the L protein. The MeV and VSV L proteins undergo aggregation into the insoluble form in the absence of the P proteins, while the presence of the P proteins prevents the aggregation of the L proteins via promoting their solubility (7). However, the presence of MuV P functions to prevent degradation, but not aggregation, of the MuV L (8). Consistent with the MeV and VSV L proteins, the SHVV L expressed alone was detected mainly in the insoluble form, while the presence of SHVV P significantly increased the soluble L protein. Therefore, the P protein can promote the solubility of the L proteins of many mononegaviruses, such as MeV, VSV, and SHVV. Moreover, we found that the Hsp90 dysfunction-mediated degradation of the soluble SHVV L was alleviated by 3-MA, while the insoluble SHVV L was alleviated by MG132, suggesting that the soluble and insoluble SHVV L proteins were degraded through autophagy and proteasomal pathway, respectively. Previous research has reported that Hsp90 dysfunction-mediated degradation of the insoluble MeV and VSV L proteins could be alleviated by MG132 (7). However, how the Hsp90 dysfunction caused degradation of the soluble MeV and VSV L proteins was not investigated (7).
Taken together, Hsp90 activity is commonly required for the replication of many mononegaviruses via maintaining the L protein stability. Our data will provide new insights into understanding the role of Hsp90 in the maturation of the L proteins of mononegaviruses. Moreover, our study is the first report to reveal the chaperone role of Hsp90 in the replication of aquatic viruses, which will help design antiviral drugs targeting fish Hsp90 and breed new antiviral fish species based on Hsp90.
MATERIALS AND METHODS
Cells and viruses.
Channel catfish ovary (CCO) cells were cultured at 25°C in minimum essential medium (MEM) (HyClone) supplemented with 10% fetal bovine serum (FBS) (Gibco), penicillin (100 g/ml), and streptomycin (100 g/ml). The 293T cells were cultured at 37°C and 5% CO2 atmosphere in Dulbecco’s modified Eagle medium (DMEM) (HyClone) containing 10% FBS, penicillin (100 g/ml), and streptomycin (100 g/ml). SHVV (GenBank accession number KP876483.1) was isolated from diseased hybrid snakehead fish and stored at −80°C (24).
Plasmids.
The plasmids pCDNA-N, pCDNA-P, pCDNA-M, pCDNA-G, and pCDNA-L have been constructed previously (31, 32). The plasmid pEGFP-L was constructed by amplifying the SHVV L gene from pCDNA-L and cloning into pEGFP-N1 using the primers listed in Table 1. The plasmids pDsRED-Hsp90 and pFlag-Hsp90 were constructed by amplifying the Hsp90 gene from CCO cells and cloning into pDsRED-N1 or p3XFlag-CMV-14 using primers listed in Table 1. The plasmid pFlag-Hsp70 was constructed by amplifying the Hsp70 gene from CCO cells and cloning into p3XFlag-CMV-14 using primers listed in Table 1.
TABLE 1
| Application and primer name | Sequence (5′–3′) |
|---|---|
| Expression | |
| Flag-Hsp90-FW | CCCAAGCTTATGCCTGAAGAAATGCGCCAA |
| Flag-Hsp90-BW | GCTCTAGAATCAACTTCCTCCATGCGAGA |
| Flag-Hsp70-FW | CCCAAGCTTATGTCAGTAGTGGGATTCGATGTG |
| Flag-Hsp70-BW | GCTCTAGAATCGATGTCCATTTCCGGCAGCTTG |
| EGFP-L-FW | GGACTCAGATCTCGAGCTCAAGCTTATGGATTATTCTCAGGAATATGTC |
| EGFP-L-BW | CCGTCGACTGCAGAATTCGAAGCTTTTCCGTCCACGCAGCTTCTCT |
| DsRED-90-FW | CCCAAGCTTATGCCTGAAGAAATGCGCCAA |
| DsRED-90-BW | CGGGGTACCGTATCAACTTCCTCCATGCGAGA |
| qRT-PCR | |
| q-hsp90-FW | CAGTGGGAAGGACCTCAAG |
| q-hsp90-BW | ACACCAAACTGCCCAATCA |
| q-G-FW | ACACCATACATGCCAGAGGC |
| q-G-BW | GCCTCGCTGGGTATCCAAAT |
| q-vRNA-FW | AGAGTCAATAAGGTGATGGGATA |
| q-vRNA-BW | AGTTCCTCAAAGTTGGTAGCC |
| q-β-actin-FW | CACTGTGCCCATCTACGAG |
| q-β-actin-BW | CCATCTCCTGCTCGAAGTC |
Reagents and antibodies.
17-DMAG, geldanamycin, MG132, 3-MA, and cycloheximide (CHX) were purchased from Selleck Biotechnology Co., LTD. (Shanghai, China). Small interfering RNAs (siRNAs) of Hsp90 (siHsp90) and the control siRNA (siNC) were synthesized from GenePharma Co., Ltd (Shanghai, China). The rabbit anti-SHVV-N, -P, -M, -G, and -L polyclonal antibodies were made by Abiotech (Jinan, China). The mouse anti-β-actin, anti-GFP, anti-Flag, and anti-Hsp90 antibodies were purchased from ABclone Biotechnology Co., Ltd (Wuhan, China). The secondary anti-rabbit IgG and anti-mouse IgG antibodies were purchased from ABclone Biotechnology Co., Ltd.
Virus infection and titration.
CCO cells were infected with SHVV at a multiplicity of infection (MOI) of 0.1. After 2 h adsorption at 25°C, the inoculum was removed, and the cells were washed twice with phosphate-buffered saline (PBS), followed by adding fresh MEM. At different time points postinfection, the supernatants were collected for virus titration by 50% tissue culture infectious dose (TCID50), while the cells were harvested for the detection of viral proteins by Western blotting or viral mRNA and genomic RNA (vRNA) by quantitative reverse transcription-PCR (qRT-PCR) with primers listed in Table 1.
qRT-PCR.
Total RNA was extracted from cells with TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. For the detection of SHVV G mRNA or vRNA, 1 μg RNA was mixed with 1 μl random primer, 4 μl 4× genomic DNA (gDNA) wiper mix (TaKaRa), and RNase-free H2O to a total volume of 16 μl. After incubation at 42°C for 2 min, 4 μl 5× select qRT supermix II was added and then incubated at 50°C for 15 min and 85°C for 2 min. The quantitative PCRs were conducted in 20 μl volume containing 10 μl AceQ qPCR SYBR green master mix (Vazyme), 1 μl cDNA template, 0.4 μl forward primer, 0.4 μl backward primer, and 8.2 μl double-distilled water (ddH2O) with the following cycling conditions: 95°C for 5 min, 45 cycles at 95°C for 10 s, 60°C for 10 s, and 72°C for 15 s, and ended with a 95°C at 5°C/s calefactive velocity to make the melt curve. Date were normalized to the level of β-actin in each sample using the 2−ΔΔCT method.
Immunostaining.
The 293T cells were transfected with plasmids pEGFP-L and pDsRED-Hsp90, pEGFP-L and pDsRED-N1, and pEGFP-N1 and pDsRED-Hsp90, respectively. At 24 h posttransfection, the cells were fixed with paraformaldehyde for 15 min and then permeabilized in 0.5% Triton X-100 for 10 min, followed by incubation with 4′,6-diamidino-2-phenylindole (DAPI). After washing three times with PBS, the samples were detected using confocal microscope.
Western blotting.
For the preparation of soluble cell extracts, cells were lysed in urea-free cell lysis buffer (10 mM Tris-Cl, pH 7.5, 150 mM NaCl, 0.5 mM ethylenediaminetetraacetic acid [EDTA], 0.5% NP-40, 0.09% sodium azide). For the preparation of insoluble cell extracts, cells were lysed in the above cell lysis buffer containing 8 M urea. The protein samples were separated by SDS-PAGE and transferred onto polyvinylidene difluoride membranes (Biosharp). The membranes were blocked with 5% skim milk in tris-buffered saline with 0.1% Tween 20 (TBST) at 4°C overnight, followed by incubation with the anti-N (1:1,000), anti-P (1:1,000), anti-M (1:1,000), anti-G (1:1,000), anti-L (1:1,000), anti-Flag (1:2,000), anti-Hsp90 (1:1,000), anti-GFP (1:2,000), or anti-β-actin (1:2,000) antibodies for 2 h at room temperature. The membranes were washed three times with TBST and incubated with horseradish peroxidase (HRP)-conjugated goat anti-rabbit antibody (1:5,000) or anti-mouse antibody (1:5,000) for 1 h at room temperate. The signal intensity was then determined using the Amersham Imager 600 system.
Coimmunoprecipitation.
SHVV-infected CCO cells or plasmid-transfected 293T cells were collected and subjected to Co-IP using anti-L or anti-Flag antibody according to the manufacturer’s instructions of Pierce Co-IP kit (Thermo Fisher). The eluted samples were then used for Western blotting.
Statistical analysis.
All statistical analyses were performed using GraphPad Prism 5.0 (GraphPad Software). The statistical significance of the data was determined by Student’s t test, and a P < value of <0.05 was considered statistically significant. Asterisks (* and **) indicate statistically significant differences (*, P < 0.05; **, P < 0.01).
ACKNOWLEDGMENT
This work was supported by the National Natural Science Foundation of China (31972832, 31725026).
REFERENCES
1.
Moyer SA, Baker SC, Lessard JL. 1986. Tubulin: a factor necessary for the synthesis of both Sendai virus and vesicular stomatitis virus RNAs. Proc Natl Acad Sci U S A 83:5405–5409.
2.
Das T, Mathur M, Gupta AK, Janssen GM, Banerjee AK. 1998. RNA polymerase of vesicular stomatitis virus specifically associates with translation elongation factor-1 αβγ for its activity. Proc Natl Acad Sci U S A 95:1449–1454.
3.
Gupta AK, Mathur M, Banerjee AK. 2002. Unique capping activity of the recombinant RNA polymerase (L) of vesicular stomatitis virus: association of cellular capping enzyme with the L protein. Biochem Biophys Res Commun 293:264–268.
4.
Takahashi K, Halfmann P, Oyama M, Kozuka-Hata H, Noda T, Kawaoka Y. 2013. DNA topoisomerase 1 facilitates the transcription and replication of the Ebola virus genome. J Virol 87:8862–8869.
5.
Bauer A, Nolden T, Nemitz S, Perlson E, Finke S. 2015. A dynein light chain 1 binding motif in rabies virus polymerase L protein plays a role in microtubule reorganization and viral primary transcription. J Virol 89:9591–9600.
6.
Munday DC, Wu W, Smith N, Fix J, Noton SL, Galloux M, Touzelet O, Armstrong SD, Dawson JM, Aljabr W, Easton AJ, Rameix-Welti MA, de Oliveira AP, Simabuco FM, Ventura AM, Hughes DJ, Barr JN, Fearns R, Digard P, Eleouet JF, Hiscox JA. 2015. Interactome analysis of the human respiratory syncytial virus RNA polymerase complex identifies protein chaperones as important cofactors that promote L-protein stability and RNA synthesis. J Virol 89:917–930.
7.
Bloyet LM, Welsch J, Enchery F, Mathieu C, de Breyne S, Horvat B, Grigorov B, Gerlier D. 2016. HSP90 chaperoning in addition to phosphoprotein required for folding but not for supporting enzymatic activities of measles and Nipah virus L polymerases. J Virol 90:6642–6656.
8.
Katoh H, Kubota T, Nakatsu Y, Tahara M, Kidokoro M, Takeda M. 2017. Heat shock protein 90 ensures efficient mumps virus replication by assisting with viral polymerase complex formation. J Virol 91:e02220-16.
9.
Katoh H, Sekizuka T, Nakatsu Y, Nakagawa R, Nao N, Sakata M, Kato F, Kuroda M, Kidokoro M, Takeda M. 2019. The R2TP complex regulates paramyxovirus RNA synthesis. PLoS Pathog 15:e1007749.
10.
Smith DR, McCarthy S, Chrovian A, Olinger G, Stossel A, Geisbert TW, Hensley LE, Connor JH. 2010. Inhibition of heat-shock protein 90 reduces Ebola virus replication. Antiviral Res 87:187–194.
11.
Shim HY, Quan X, Yi YS, Jung G. 2011. Heat shock protein 90 facilitates formation of the HBV capsid via interacting with the HBV core protein dimers. Virology 410:161–169.
12.
Chen W, Sin SH, Wen KW, Damania B, Dittmer DP. 2012. Hsp90 inhibitors are efficacious against Kaposi sarcoma by enhancing the degradation of the essential viral gene LANA, of the viral co-receptor EphA2 as well as other client proteins. PLoS Pathog 8:e1003048.
13.
Gao L, Harhaj EW. 2013. HSP90 protects the human T-cell leukemia virus type 1 (HTLV-1) tax oncoprotein from proteasomal degradation to support NF-κB activation and HTLV-1 replication. J Virol 87:13640–13654.
14.
Sun X, Bristol JA, Iwahori S, Hagemeier SR, Meng Q, Barlow EA, Fingeroth JD, Tarakanova VL, Kalejta RF, Kenney SC. 2013. Hsp90 inhibitor 17-DMAG decreases expression of conserved herpesvirus protein kinases and reduces virus production in Epstein-Barr virus-infected cells. J Virol 87:10126–10138.
15.
Rathore AP, Haystead T, Das PK, Merits A, Ng ML, Vasudevan SG. 2014. Chikungunya virus nsP3 & nsP4 interacts with HSP-90 to promote virus replication: HSP-90 inhibitors reduce CHIKV infection and inflammation in vivo. Antiviral Res 103:7–16.
16.
Vashist S, Urena L, Gonzalez-Hernandez MB, Choi J, de Rougemont A, Rocha-Pereira J, Neyts J, Hwang S, Wobus CE, Goodfellow I. 2015. Molecular chaperone Hsp90 is a therapeutic target for noroviruses. J Virol 89:6352–6363.
17.
Newman J, Asfor AS, Berryman S, Jackson T, Curry S, Tuthill TJ. 2018. The cellular chaperone heat shock protein 90 is required for foot-and-mouth disease virus capsid precursor processing and assembly of capsid pentamers. J Virol 92:e01415-17.
18.
Wang Y, Wang R, Li F, Wang Y, Zhang Z, Wang Q, Ren Z, Jin F, Kitazato K, Wang Y. 2018. Heat-shock protein 90α is involved in maintaining the stability of VP16 and VP16-mediated transactivation of α genes from herpes simplex virus-1. Mol Med 24:65.
19.
Li S, Wang Y, Hou D, Guan Z, Shen S, Peng K, Deng F, Chen X, Hu Z, Wang H, Wang M. 2019. Host factor heat-shock protein 90 contributes to baculovirus budded virus morphogenesis via facilitating nuclear actin polymerization. Virology 535:200–209.
20.
Mohl BP, Roy P. 2019. Hsp90 chaperones bluetongue virus proteins and prevents proteasomal degradation. J Virol 93:e00898-19.
21.
Sakata M, Katoh H, Otsuki N, Okamoto K, Nakatsu Y, Lim CK, Saijo M, Takeda M, Mori Y. 2019. Heat shock protein 90 ensures the integrity of rubella virus p150 protein and supports viral replication. J Virol 93:e01142-19.
22.
Zhang WJ, Wang RQ, Li LT, Fu W, Chen HC, Liu ZF. 2021. Hsp90 is involved in pseudorabies virus virion assembly via stabilizing major capsid protein VP5. Virology 553:70–80.
23.
Geller R, Taguwa S, Frydman J. 2012. Broad action of Hsp90 as a host chaperone required for viral replication. Biochim Biophys Acta 1823:698–706.
24.
Liu X, Wen Y, Hu X, Wang W, Liang X, Li J, Vakharia V, Lin L. 2015. Breaking the host range: mandarin fish is susceptible to a vesiculovirus derived from snakehead fish. J Gen Virol 96:775–781.
25.
Zhang C, Yi L, Feng S, Liu X, Su J, Lin L, Tu J. 2017. MicroRNA miR-214 inhibits snakehead vesiculovirus replication by targeting the coding regions of viral N and P. J Gen Virol 98:1611–1619.
26.
Zhang C, Feng S, Zhang W, Chen N, Hegazy AM, Chen W, Liu X, Zhao L, Li J, Lin L, Tu J. 2017. MicroRNA miR-214 inhibits snakehead vesiculovirus replication by promoting IFN-α expression via targeting host adenosine 5'-monophosphate-activated protein kinase. Front Immunol 8:1775.
27.
Taipale M, Krykbaeva I, Koeva M, Kayatekin C, Westover KD, Karras GI, Lindquist S. 2012. Quantitative analysis of HSP90-client interactions reveals principles of substrate recognition. Cell 150:987–1001.
28.
Ke W, Fang L, Tao R, Li Y, Jing H, Wang D, Xiao S. 2019. Porcine reproductive and respiratory syndrome virus E protein degrades porcine cholesterol 25-hydroxylase via the ubiquitin-proteasome pathway. J Virol 93:e00767-19.
29.
Latorre V, Mattenberger F, Geller R. 2018. Chaperoning the Mononegavirales: current knowledge and future directions. Viruses 10:699.
30.
Nayak TK, Mamidi P, Kumar A, Singh LP, Sahoo SS, Chattopadhyay S, Chattopadhyay S. 2017. Regulation of viral replication, apoptosis and pro-inflammatory responses by 17-AAG during chikungunya virus infection in macrophages. Viruses 9:3.
31.
Feng S, Su J, Lin L, Tu J. 2019. Development of a reverse genetics system for snakehead vesiculovirus (SHVV). Virology 526:32–37.
32.
Qin X, Feng S, Zhang Y, Su J, Lin L, Zhang YA, Tu J. 2021. Leader RNA regulates snakehead vesiculovirus replication via interacting with viral nucleoprotein. RNA Biol 18:537–546.
Information & Contributors
Information
Published In
Journal of Virology
Volume 95 • Number 16 • 26 July 2021
eLocator: 10.1128/jvi.00594-21
Editor: Susana López, Instituto de Biotecnologia/UNAM
Copyright
© 2021 American Society for Microbiology. All Rights Reserved.
History
Received: 7 April 2021
Accepted: 18 May 2021
Accepted manuscript posted online: 26 May 2021
Published online: 26 July 2021
Keywords
Contributors
Editor
Susana López
Editor
Instituto de Biotecnologia/UNAM
Metrics & Citations
Metrics
Note: There is a 3- to 4-day delay in article usage, so article usage will not appear immediately after publication.
Citation counts come from the Crossref Cited by service.
Citations
If you have the appropriate software installed, you can download article citation data to the citation manager of your choice. Simply select your manager software from the list below and click Download.