A CRISPR Activation Screen Identifies Genes That Protect against Zika Virus Infection

CRISPR activation was employed to identify genes rescuing cells from multiple cycles of ZIKV infection. Lentiviruses prepared from vectors carrying a pooled genome-scale sgRNA library were used to infect Huh7 hepatoma cells stably expressing the dCas9 and activation domains (12, 21). Huh7 cells were chosen due their high susceptibility and pronounced cytopathic effect following ZIKV infection (22). While the liver is not a major organ in ZIKV pathogenesis, high levels of ZIKV RNA were detected in the liver of mouse models (23, 24). Moreover, a limited number of studies reported jaundice and/or hepatic dysfunction in patients with ZIKV infection as well (25, 26). The Huh7 cells were infected with ZIKV MR776 at a low multiplicity of infection (MOI) (0.2). The surviving cells were collected 10 days postinfection. Genomic DNA prepared from these cells was used to amplify the sgRNA for next-generation sequencing (NGS) (Fig. 1A). We found that at 10 days postinfection, the sgRNA distributions were different between the infected cells and controls, with a subset of guides showing enrichment in infected cells (Fig. 1B). The pooled library used contained 3 sgRNAs for each gene in the RefSeq database (23,430 isoforms) (12). For most enriched genes, more than one sgRNA targeting the same gene was enriched in the infected cells (Fig. 1C). Two ranking algorithms were used to analyze the obtained results, “RNAi gene enrichment ranking” (RIGER) (27) and “model-based analysis of genome-wide CRISPR-Cas9 knockout” (MAGeCK) (28). The tools use different statistical models for the ranking of genes. While RIGER relies on a Kolmogorov-Smirnov-based statistic for ranking, MAGeCK uses a negative binomial model in combination with a robust ranking aggregation algorithm. We applied both methods to test our data for robustness against the statistical model used. The obtained top-ranking genes are shown in Table 1 . The order of the genes in the table is relative to the gene ranking results of MAGeCK applied to the first screen. Our six highest ranking genes are robust across the two screens performed and against the statistical method used for ranking. Moreover, as mentioned above, most of these genes are ISGs with known antiviral activity, further confirming these results (16–20).

To validate the screen results, we recloned the top-ranking individual sgRNAs into the library backbone. Lentiviruses carrying these sgRNAs were prepared and used to create stable Huh7 cell lines. Cells expressing nontargeting sgRNAs served as controls. The obtained cell lines were infected with ZIKV, and viability was determined 7 days postinfection (Fig. 2A and C). Initially, we cloned the top-ranking sgRNA for each gene. Additional sgRNAs were cloned for genes showing a protective effect. Crystal violet staining of the infected wells shows significantly less cell death in the cells expressing interferon alpha-inducible protein 6 (IFI6) and interferon lambda 2 (IFN-λ2) (Fig. 2A and C). A smaller protective effect was observed for interferon-stimulated exonuclease gene 20 (ISG20) and helicase with zinc finger 2 (HELZ2). Quantification of the crystal violet staining indicated that for IFI6 and IFN-λ2, most sgRNAs targeting the same gene showed significant though varied levels of protection (Fig. 2A). The activation of the targeted genes by the sgRNAs was confirmed using real-time PCR (Fig. 2B). Overall, most of the targeted genes were significantly activated at levels ranging from 3- to >400-fold. Significant activation was observed for all genes showing a protective effect, except HELZ2. For IFI6, there was a clear correlation between the activation and protection levels. Such a correlation was not observed for the rest of the genes. Taken together, these results confirm a protective role from ZIKV infection by the activation of IFI6, IFN-λ2, and, to a lesser extent, ISG20. To further confirm the roles of IFI6 and IFN-λ2 in protection from ZIKV infection, we tested ZIKV RNA levels in infected CRISPR-activated cell lines expressing nontargeting (NT), IFI6, or IFN-λ2 sgRNAs. Activation of both genes significantly inhibited the accumulation of ZIKV RNA (Fig. 2D). The ZIKV RNA levels were >20-fold lower in cells expressing IFI6 sgRNAs than in cells expressing NT sgRNAs after 48 h and 47-fold lower at 72 h postinfection. In cells expressing IFN-λ2 sgRNAs, ZIKV RNA levels were 195-fold lower than in cells expressing NT sgRNAs after 48 h, and 34-fold lower at 72 h postinfection. Viral production from these cells was significantly inhibited in the IFI6- and IFN-λ2-activated cells as well (Fig. 2E). Virus production was reduced more than 5-fold in IFI6-activated cells and 11-fold in IFN-λ2-activated cells after 48 h. Although the effect was still significant, the reduction in virus production at 72 h postinfection diminished to 2.5-fold and 7-fold in IFI6- and IFN-λ2-activated cells, respectively. The use of flow cytometry analysis of ZIKV-infected Huh7 cells stably expressing NT, IFI6, and IFN-λ2 sgRNAs indicated that the activation of IFI6 inhibited infection by 48%, while IFN-λ2 inhibited infection by 35% (Fig. 2F). IFI6 activation itself conferred high levels of protection from ZIKV infection, comparable to that of IFN-λ2, which activates other ISGs. This fact led us to test if IFI6 is capable of activating the transcription of other ISGs using an ISG56 promoter reporter cell line (29). Mitochondrial antiviral-signaling (MAVS) protein was used as a positive control. IFI6 did not activate ISG56 promoter-dependent transcription (Fig. 2G), indicating that its antiviral activity is a direct effect. To determine the role of IFI6 in controlling ZIKV infection, we performed a knockdown experiment using small interfering RNAs (siRNAs) (Fig. 2H and I). In the presence of interferon alpha (IFN-α), IFI6 levels were induced by approximately 94-fold compared to nontreated control cells. IFI6 siRNA reduced this elevation by 4.3-fold (Fig. 2H; **, P < 0.01). A smaller but significant 0.7-fold reduction was observed in controls in the absence of IFN (**, P < 0.01). These results confirm the efficiency of these siRNAs.

IFN-α suppressed ZIKV RNA levels by 50%. ZIKV RNA levels were slightly but significantly (*, P < 0.05) elevated as a result of IFI6 downregulation compared to cells transfected with nontargeting siRNA cells (Fig. 2I). In the absence of IFN-α, ZIKV RNA levels were not significantly affected. These results indicate that IFI6 has a role in controlling ZIKV replication.

IFI6 is a member of the ISG12 family containing four related ISG12 genes, IFI6 and ISG12a (IFI27), ISG12b(IFI27L2), and ISG12c(IFI27L1) (30). The IFI6 gene encodes a small 130-amino-acid (aa)-long protein containing a predicted N-terminal signal peptide and two predicted transmembrane domains (Fig. 3A). IFI6 was previously reported to localize to the mitochondria and to inhibit apoptosis in DENV-infected cells (31, 32). To confirm the localization of IFI6, we constructed a C-terminal FLAG fusion protein. First, we transfected our IFI6-FLAG construct into Huh7 cells and stained the cells both with FLAG (red) and commercial IFI6-specific (green) antibodies (Fig. 3B). While a significant amount of the two signals seems to colocalize, IFI6 background staining could be observed in nonexpressing cells. Thus, we continued our analysis with the IFI6-FLAG (green) construct, which was further stained with both GRP94 (blue), a known ER marker (33), and MitoTracker (red, Fig. 3C and D). In our hands, IFI6 showed significant colocalization with GRP94 (Pearson correlation coefficient, 0.55 ± 0.03 versus 0.14 ± 0.03 for the mitochondria; n = 16), indicating that the majority of IFI6 localizes to the ER (Fig. 3D). This localization suggests that IFI6 might inhibit a stage in the viral life cycle that occurs at the ER.

The overexpression of IFI6 at the protein level in our activated stable cell line, compared to a nontargeting control, was confirmed using the specific antibody mentioned above (Fig. 4A). In spite of the apparent high background, a significant overexpression could be observed. Fluorescence intensity was over 20-fold higher in the cells expressing IFI6 sgRNAs than in the NT controls. While we could not confirm the overexpression of IFN-λ2 at the protein level due to a lack of appropriate specific antibodies, we performed a functional assay. In this assay, medium from NT or IFN-λ2-activated cells was used to treat Huh7 cells for 18 h. Following treatment, the cells were harvested and tested for the expression of Myxovirus resistance 1 (Mx1), a known ISG that is strongly elevated in the presence of IFN-λ, using quantitative PCR (qPCR) (34). Mx1 levels were elevated by 100-fold compared to controls treated with medium from NT cells, indicating that IFN-λ2 is activated at the protein level and secreted (Fig. 4B).

The phenotypic readout used in our screen and functional validation was cell viability following ZIKV infection. This readout cannot distinguish between genes preventing ZIKV infection and genes protecting cells from ZIKV-induced cell death. To distinguish between these two possibilities, we infected Huh7 stable cell lines expressing NT, IFI6, and IFN-λ2 sgRNAs with ZIKV (Fig. 4C) or DENV (Fig. 4D). The cells were fixed and stained with an antibody against flavivirus E protein and antibodies recognizing dsRNA. Nearly all the cells expressing the control nontargeting sgRNAs were stained with both protein E and dsRNA antibodies, indicating high levels of infection, while cells expressing the sgRNAs for IFI6 and IFN-λ2 showed considerably lower levels of infection. The fact that most of the sgRNAs expressing cells do not contain dsRNA indicates that their activation most likely inhibits a stage in viral infection prior to its formation. To further identify the mechanistic details of IFI6 antiviral activity, the effects of its activation on various steps in the flavivirus life cycle occurring in the ER were determined using an IFI6-activated cell line. To determine if IFI6 affects viral RNA translation, we used a DENV translation reporter containing a firefly luciferase gene flanked by the viral untranslated regions (35). In vitro-transcribed viral RNA was transfected into control and IFI6-activated cells. Luciferase levels were determined 1 and 4 h posttransfection. The luciferase levels were similar in control cells and in the IFI6-activated cell line, indicating that IFI6 does not affect viral RNA translation or stability. Processing of the viral polyprotein by host protease was tested using FLAG-tagged NS4B-2K. IFI6 activation did not affect host protease processing of this junction. In addition, the possible interaction between IFI6 and several viral replicase proteins that was tested using immunoprecipitation and did not yield any significant results. ISG12a, an IFI6-related protein, inhibits hepatitis C virus by degrading nonstructural protein NS5A (36). IFI6 activation, however, did not seem to affect the stability of several tested ZIKV proteins. Last, as flaviviruses modify host membranes and thus depend on host lipid stores for membrane proliferation, we tested the possible effect of IFI6 activation on lipid droplet (LD) formation. IFI6 activation did not affect LD number, size, or distribution.

IFI6 was previously reported to inhibit apoptosis in DENV-infected cells (31, 32), in the context of parvovirus infection (37), and in cancer cells (38–40). Our results (Fig. 4) thus far agree with an effect of IFI6 and IFN-λ2 on an early stage in viral infection due to the fact that most of the infected cells expressing IFI6 or IFN-λ2 sgRNAs do not contain dsRNA at 24 h postinfection. This, however, does not rule out an additional later effect on cell death as well. To test this possibility, we infected Huh7 stable cell lines expressing NT, IFI6, and IFN-λ2 sgRNAs with ZIKV and analyzed the cells using live/dead staining flow cytometry at 72 h posttransfection. Both IFI6 and IFN-λ2 significantly inhibited infection-induced cell death (Fig. 5). While the number of infected cells varied in the 4 experiments we performed, in the cells expressing nontargeting sgRNAs, approximately 25% ± 8% of the infected cells were consistently dead in most experiments after 72 h. However, in the cells with activated IFI6 or IFN-λ2, rates of cell death were approximately 10-fold lower (Fig. 5). These results suggest that overexpression of both of these genes could inhibit infection-associated cell death.

IFI6 has three different splice variants, as follows: isoform A (UniProt P09912-1, small) is considered the canonical isoform, is shorter than the other isoforms, and lacks 8 aa at the N terminus of the protein immediately following the signal peptide (Fig. 6A); isoform C (UniProt P09912-3, full length) is the longest variant, containing all 8 aa; and isoform B (UniProt P09912-2, medium) has only the first 4 aa of the 8 aa at this location. Alternatively, spliced variants of the related ISG12a were previously reported to have distinct tissue expression and function (41, 42); thus, we tested if the IFI6 alternative splicing has functional consequences in terms of its antiviral activity. IFI6 was amplified from IFN-treated cells, the PCR products were cloned, and the percentages of the different isoforms were analyzed using specific primers. We found that the small isoform of IFI6 is the most abundant form, appearing in approximately 70% of our amplified clones, while the full-length isoform was detected in only 25% of the clones and the medium isoform in the remaining 5%. To test the possible differences in the antiviral activities of the different isoforms, we cloned them into an expression vector with a C-terminal FLAG tag. The plasmids were transfected into Huh7 cells, followed by ZIKV infection. The cells were analyzed by flow cytometry at 48 h postinfection (Fig. 6B). Although the differences between the variants were statistically significant, the difference in antiviral activities between the isoforms was approximately 20%. Thus, we do not believe that such a difference could have a significant measurable functional relevance in this system.

To test the relevance of the identified genes in disease relevant primary tissue, we tested the expression of these genes in ex vivo placenta explants following ZIKV infection. First trimester pregnancy samples were obtained from healthy women undergoing elective termination of pregnancy. Tissue explants from three independent donors were prepared from placenta and infected with ZIKV. Infected tissue was analyzed by real-time PCR for ZIKV RNA and ISG expression levels. All three identified genes were induced in all three donors; however, these inductions were highly varied in their magnitude and kinetics (Fig. 7). ISG20 showed the lowest levels of induction at ∼2-fold in all donors (Fig. 7C), while IFI6 was significantly induced in all three donors and at high levels, at >5-fold in 2/3 donors (Fig. 7B). IFN-λ2 showed a generally similar pattern (Fig. 7C). ZIKV RNA levels, however, did not significantly differ between the different donors (Fig. 7D). While a direct link between the induction of the expression of these proteins and ZIKV RNA levels could not be established, their induction suggests a potential role for these proteins in controlling viral infection.

Vero, HEK293T, and Huh7 cells were propagated in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% (vol/vol) fetal calf serum and 1% (vol/vol) penicillin-streptomycin (Biological Industries, Bet-Haemek, Israel). The Huh7 cells stably expressing the MS2-P65-HSF1 activator plasmid (Addgene plasmid 89308) were grown in the presence of hygromycin (0.8 mg/ml). Lipofectamine 2000 (Invitrogen, Carlsbad, CA) or polyethyleneimine (PEI; Polysciences, Warrington, PA) were used for plasmid DNA transfections of subconfluent cells.

ZIKV MR766 was a kind gift from Leslie Lobel (Ben-Gurion University, Israel), and dengue virus 2 New Guinea C strain stocks were purchased from Culture Collections (Public Health England). Virus stocks were propagated in Vero cells, and the supernatant was harvested at 3 to 7 days postinfection. Viral titers were determined by plaque assays on Vero cells. Interferon alpha B2 was purchased from PBL (NJ; catalog no. 11115-1), and recombinant human interleukin 28B (IL-28B)/IFN-λ 3 protein was from R&D Systems (catalog no. 5259-IL).

A pooled library of lentiviral vectors (lentiSAMv2) containing genome-scale sgRNA was purchased from Addgene (plasmid 1000000078, a gift from Feng Zhang). The library was amplified according to the depositor’s protocol (21). sgRNA distribution was verified following amplification by NGS. HEK293T cells were used for lentivirus production. The cells were seeded at 40% confluence in 4 T225 flasks. The next day, cells were transfected using PEI with 3.4 μg pMD2.G, 6.8 μg psPAX2, and 13.6 μg of the amplified library (21). The supernatant was harvested at 2 days posttransfection, filtered, and stored at −80°C. The library titer was determined through transduction in Huh7 cells stably expressing the MS2-P65-HSF1 activator plasmid, as described previously (21).

To transduce the Huh7 cells stably expressing the MS2-P65-HSF1 activator plasmid, the cells were seeded into 6-well plates at a density of 2.45 × 10⁶ cells per well. The cells were transduced with lentiviral pseudoparticles at an MOI of 0.3. A total of 1.17 × 10⁸ Huh7 cells were infected with the library plasmids to yield 3.5 × 10⁷ transduced cells at an MOI of 0.3. Since the library contains 70,290 sgRNAs, this number is sufficient for infection of at least 500 cells with each sgRNA (12, 21). The cells were then spinoculated at 1,000 × g for containing 3% fetal bovine serum (FBS), 20 mM HEPES, and 4 μg ml⁻¹ Polybrene. The next day, the cells were replated at low confluence in T175 flasks and selected with 6 μg/ml blasticidin for 7 days. Following selection, the cells were replated at 40% confluence and infected with ZIKV (MOI, 0.2) for 2 h. The cells were washed extensively and incubated for 10 days. During the incubation period the cells were washed and the medium was replaced every 3 days. Genomic DNA was prepared from the cells and used to amplify the sgRNA for NGS, as described previously (21). Samples were sequenced on an Illumina HiSeq 2000 platform. The screen was repeated twice.

The resulting reads from the NGS experiments were analyzed with two different algorithms, RIGER (27) (utilizing the GENE-E framework) and MAGeCK v0.5.6 (28). In order to prepare the input for RIGER, we used the Python scripts available online (21). Key regions in our reads were detected with python –no-g counter_spacers.py, available in reference 12.

RIGER and MAGeCK were used with default parameters following the workflow given in reference 12. As the two methods yielded similar lists in terms of high-ranking genes, we continued using the list produced by MAGeCK. Raw sgRNA sequencing read numbers and the MAGeCK scored and ranked list of genes from the two screen repeats are added in the supplemental material (Data Sets S1 to S4).

To validate the screen hits, sgRNAs for the top-ranking genes were individually cloned into the library backbone plasmid (lentiSAMv2; Addgene). Lentiviruses produced from these plasmids were used to infect Huh7 cells stably expressing the MS2-P65-HSF1 activator plasmid. The cells were selected with 6 μg/ml blasticidin for 7 days to create stable cell lines. The obtained cell lines were infected with ZIKV (MOI, 0.2) for 2 h, followed by extensive washes. After 7 days, the cells were stained with crystal violet. To quantify the crystal violet staining, the dye was extracted using 10% acetic acid. The obtained solution was diluted and transferred to a 96-well plate. Absorbance at 570 nm was measured using a plate reader.

For qPCR experiments, total RNA was extracted from each cell line using Tri Reagent (Sigma, Rehovot, Israel). The obtained RNA was reverse transcribed using ExcelRT (SMOBIO). Real-time PCR was performed using Fast SYBR green mastermix (Roche) and the primers listed in Table 2. Hypoxanthine phosphoribosyltransferase 1 (HPRT) was used as a housekeeping control. The results are the fold change from nontargeting sgRNA-expressing cells calculated using the ΔΔCT method.

Virus-containing medium from Zika-infected cells was collected at 2, 24, 48, and 72 h postinfection. Confluent Vero cells grown in 6-well plates were infected with serial dilutions (up to 1 × 10^–6) of the virus-containing medium for 2 h, washed, and overlaid with 0.5% hydroxypropyl methylcellulose in DMEM. The cells were stained with crystal violet at 5 days postinfection, and the plaques were counted.

Reporter HEK293 cells stably expressing Toll-like receptor 3 (TLR3) and ISG56-luciferase (pGL3Basic [48]) were a gift to J. U. Jung. Subconfluent ISG56-Luc cells in 24 wells were transfected with the indicated plasmids using PEI. Luciferase activity was measured at 24 h posttransfection.

Nontargeting control siRNA and siIFI6 (Dharmacon, SMARTpool catalog number L-003672-00-0005 for the IFI6 and D-001810-10-05 for the nontargeting pool) were repeatedly transfected (at 24 h and 48 h postplating) to Huh7 cells using Lipofectamine 2000 (Invitrogen). The cells were treated with IFN-α (human IFN alpha B2 [Alpha 8], 1,000 IU/ml) for 2 h and then infected with ZIKV at an MOI of 1. qPCR was used to quantify IFI6 and ZIKV levels at 24 h postinfection, and HPRT was used as a housekeeping control. The primer sequences are listed in Table 2. The graph shows representative results from three independent experiments.

Cells were cultured on coverslips, washed with PBS, fixed for 20 min with methanol at −20°C, and blocked with 1% bovine serum albumin (BSA) in PBS for 1 h. Immunolabeling was performed overnight with the IFI6 antibody (catalog no. ab192314, 1:100 dilution; Abcam), flavivirus group antigen antibody (4G2, 1:200 dilution; Novus, Littleton, CO), or J2 dsRNA antibody (1:200 dilution; Scion, Budapest, Hungary). For colocalization studies, MitoTracker Red (1:1,000 dilution; Thermo), anti-FLAG (mouse monoclonal, 1:500 dilution; Sigma-Aldrich), or anti-GRP94 (catalog no. ADI-SPA-850, 1:1,000 dilution; Enzo) was used. The secondary antibody was Alexa Fluor 488 goat anti-mouse or Alexa Fluor 555 goat anti-rabbit (1:2,000 dilution). 4′,6-diamidino-2-phenylindole (DAPI; Molecular Probes, Eugene, OR) was used for nucleus staining. Images were acquired using a Zeiss LSM800 confocal laser scanning microscope (Carl Zeiss MicroImaging, Jena, Germany) hooked to an inverted microscope. Relative fluorescent intensity was quantified using ImageJ or Fiji (49, 50). For colocalization analysis between GRP94 or MitoTracker and IFI6, immunofluorescent signals were analyzed for Pearson’s colocalization using the ZEN software (Zeiss). Analysis was performed on 16 images.

IFI6 was amplified from the cDNA of IFN-α-treated Huh7 cells using the following primers: forward (FW), CAAGCTTATGCGGCAGAAGGCGGTATC, and reverse (RV), AGGTACCCTCCTCATCCTCCTCACTATC. The PCR product was ligated into the pJET1.2/Blunt donor plasmid (Thermo, Waltham, MA), verified by sequencing, and further cloned using Gibson Assembly into a modified pEF-IRES-puro vector encoding a C-terminal 3×FLAG tag (51). The percentages of full-length, medium, and small splice variants were calculated by performing colony PCR with distinguishing primers on pJet-IFI6-containing bacterial colonies. The FW primer used for detection of the full-length form of IFI6 is CAGGTGAGAATGCGGGTAAGG, and the FW primer for medium-length IFI6 is CAGGTGAGAATGCGGGTAAGA. Dengue virus translation reporter (52) was prepared from dengue virus strain 16681 luciferase replicon clone (53). The DENV open reading frame (ORF) was removed by PCR, leaving only luciferase reporter flanked by 5′ untranslated region (5′ UTR) and 3′ UTR, and the plasmid was religated. The primers used were FW, AAAGCAAAACTAACATGAAACAAGGCT, and RV, TTAGATAGATCTTTGTTCATTTTTGAGAACTCG. A capped in vitro-translated transcript was prepared as described previously (54). ZIKV PRVABC59 (ATCC VR-1843) NS4B-2K amplified from infected cells by reverse transcription-PCR (RT-PCR) and cloned into modified pEF-IRES-puro with a C-terminal 3×FLAG tag using Gibson Assembly. FLAG-tagged MAVS was expressed from a modified pEF-IRES-puro with a C-terminal 3×FLAG tag (51).

For live/dead cells and infection experiments, Huh7 cells expressing nontargeting or IFI6 sgRNAs were infected ZIKV at MOI of 1. The cells were stained for 30 min with Zombie Yellow (1:500 dilution; BioLegend) in PBS at 72 h postinfection. The cells were then fixed with 4% paraformaldehyde, permeabilized with 0.2% Triton, blocked (1% FBS), and stained with anti-protein E (flavivirus group antigen antibody, 4G2, 1:200 dilution; Novus, Littleton, CO). The secondary antibody was anti-rabbit Alexa Fluor 488 (1:1,000 dilution; Thermo). For the experiment with the IFI6 splicing variants, Huh7 cells were transfected with IFI6-FLAG variants or a FLAG control (FLAG-TBC1D20 R105A [55] or FLAG-VP35 [56] a gift from L. Lobel). Since an empty FLAG plasmid cannot be detected using fluorescence-activated cell sorting (FACS), we used two different FLAG-tagged controls presumed to be inert in these experiments: an inactive mutant form of an ER-localized Rab-GAP FLAG-TBC1D20 R105A (55) or Ebola virus VP35. Similar results were obtained with the two proteins. The cells were infected at 24 h posttransfection with ZIKV at an MOI of 1. The cells were fixed and stained as described above at 48 h postinfection. The primary antibodies were anti-protein E and FLAG M2 (Sigma). The secondary antibodies were anti-rabbit Alexa Fluor 488 or anti-mouse Alexa Fluor 555 (1:1,000 dilution; Thermo). Cells were analyzed using the CytoFLEX flow cytometer (Beckman Coulter Life Sciences).

First trimester pregnancy (7 to 12 weeks gestation) samples were obtained from healthy women undergoing elective termination of pregnancy at Paule de Viguier Toulouse University Hospital, France. Tissue explants (0.3 cm²) were prepared from placenta and infected with the Asian strain of Zika virus. Tissue explants were infected overnight with 5.6 × 10¹⁰ RNA copies/ml (MOI, 1) in DMEM-F12 containing 2% FBS. After five washes in an excess volume of PBS, explants were cultured in 10% FBS–DMEM-F12 medium for up to 3 days. For quantitative reverse transcription-PCR (qRT-PCR) analysis, placenta tissue was immersed in liquid nitrogen and ground. Samples were transferred to new tubes and lysed in RNA lysis buffer. Total RNA was isolated using an RNA minikit (Qiagen), following the manufacturer’s instructions. Purified RNA was reverse transcribed using the SuperScript III first-strand synthesis system kit (Invitrogen). Placental gene expression was quantified by qRT-PCR using LightCycler 480 SYBR green I master (Roche). HPRT was used as a housekeeping control. The results are the fold change from time-matched mock controls calculated using the ΔΔCT method. qRT-PCR was performed in 96-well plates and run on a LightCycler 480 instrument. Total RNA was isolated from the supernatants of infected human placental explants using the QIAamp viral RNA minikit (Qiagen), following the manufacturer’s instructions. Quantification of viral RNA was performed by a qRT-PCR assay using ZIKV-specific primers (ZIKV 835 forward AND 911c reverse). A standard curve was obtained by amplification of a fragment of ZIKV E-envelope region and cloned into pCR-XL-2 plasmid (Invitrogen). A standard curve was generated using 10-fold serial dilutions of constructed ZIKV envelope plasmid and was used to quantify ZIKV RNA in supernatants. Viral RNA copies were extrapolated from the standard curve using the sample threshold cycle (C_T) and represented as copies per milliliter of supernatant.

This study was approved by the South-West & Outmer II ethics committee and registered at the Ministry of Higher Education and Research (number DC-2016-2772). All participants provided prior written informed consent in agreement with the guidelines of the Declaration of Helsinki, with the experiments performed in accordance with approved guidelines.

Statistical analyses were performed using Prism (GraphPad, San Diego, CA).