Prolonged Outbreak of Infection Due to TEM-21-Producing Strains of Pseudomonas aeruginosa and Enterobacteria in a Nursing Home
ABSTRACT
Over a 6-year period, 24 extended-spectrum β-lactamase (ESBL)-producing isolates of Pseudomonas aeruginosa were collected from 18 patients living in a nursing home. These isolates had a delayed development of a red pigment and exhibited a similar antibiotype (resistance to all β-lactams except for imipenem and to gentamicin, tobramycin, netilmicin, ciprofloxacin, and rifampin) associated with the production of the TEM-21 β-lactamase and a type II 3′-N-aminoglycoside acetyltransferase [AAC(3)-II] enzyme. Surprisingly, serotyping showed that these isolates belonged to four successive serotypes (P2, P16, P1, and PME), although molecular typing by PCR methods and pulsed-field gel electrophoresis yielded identical or similar profiles. Moreover, in all isolates the blaTEM-21 gene was part of a chromosomally located Tn801 transposon truncated by an IS6100 element inserted within the resolvase gene, and the aac(3)-II gene was adjacent to this structure. During the same period, 17 ESBL-producing isolates of enterobacteria were also collected from 10 of these patients. These isolates harbored a similar large plasmid that contained the blaTEM-21 and the aac(3)-II genes and that conferred additional resistance to sulfonamides and chloramphenicol, as well as to kanamycin, tobramycin, netilmicin, and amikacin, conveyed by an AAC(6′)-I enzyme. The blaTEM-21 gene was part of the Tn801 transposon disrupted by IS4321. Thus, a single clone of P. aeruginosa that had undergone a progressive genetic drift associated with a change in serotype appeared to be responsible for an outbreak of nosocomial infections in a nursing home. This strain has probably acquired the blaTEM-21-encoding plasmid that was epidemic among the enterobacteria at the institution, followed by chromosomal integration and genomic reorganization.
Pseudomonas aeruginosa is a saprophytic organism widespread in nature, particularly in moist environments (water, soil, plants, and sewage). This bacterial species is endowed with only a weak pathogenic potential in immunocompetent persons (2, 17, 21, 23) but can cause severe and even fatal infections in patients with impaired specific or nonspecific defense systems (40). Thus, P. aeruginosa is rarely involved in community-acquired infections, while it is responsible for a wide range of hospital-acquired infections, such as pneumonia, urinary tract infections (UTIs), and bacteremia. Moreover, a series of outbreaks due to this important and frequent nosocomial pathogen has been reported in hospital intensive care, burn wound, and cancer units (6, 13, 42). In contrast, little has been reported on P. aeruginosa-induced infections in long-term-care facilities, including nursing homes; and most of the studies that have reported such infections have described sporadic cases rather than outbreaks (16, 22, 44).
Linked to its nosocomial status, P. aeruginosa is intrinsically resistant to most antimicrobials. In addition, resistance to the main active agents, i.e., β-lactams and aminoglycosides, by gene acquisition is common. However, in this bacterial species, extended-spectrum β-lactamases (ESBLs) are rare and are generally of the OXA type, which are poorly inhibited by clavulanic acid, and belong to class D of the Ambler classification scheme (1). Clavulanic acid-susceptible ESBLs of the TEM and SHV families of class A, which are widespread among enterobacteria (35), are highly infrequent in P. aeruginosa. Nevertheless, some of these enzymes, i.e., TEM-4, TEM-21, TEM-24, TEM-42, SHV-2a, SHV-5, and SHV-12, as well as unaffiliated class A β-lactamases such as PER-1, VEB-1, VEB-2, GES-1, GES-2, and IBC-2, have occasionally been found (48). These observations suggest that ESBL-producing enterobacteria, which are often responsible for intra- and interhospital outbreaks due to the spread of strains, plasmids, or genes, might be the sources of these ESBLs for P. aeruginosa (33), which could become a reservoir for these types of enzymes. Aminoglycoside resistance is mainly mediated by antibiotic-modifying enzyme production, principally, the type II 6′-N-aminoglycoside acetyltransferase [AAC(6′)-II] (kanamycin, gentamicin, tobramycin, and netilmicin resistance phenotype) in P. aeruginosa, while the type II 3′-N-aminoglycoside acetyltransferase [AAC(3)-II] enzyme (gentamicin, tobramycin, and netilmicin resistance phenotype), the type I 2"-O-nucleotidyltransferase [ANT(2")-I] enzyme (kanamycin, gentamicin, and tobramycin resistance phenotype), and the type I AAC(6′) enzyme (kanamycin, tobramycin, netilmicin, and amikacin resistance phenotype) are prevalent among members of the family Enterobacteriaceae (32).
Over a 6-year period, 24 isolates of P. aeruginosa and 17 enterobacteria producing the TEM-21 β-lactamase and the AAC(3)-II enzyme were isolated from 18 patients living in a nursing home. The aim of this study was to investigate this prolonged outbreak and to analyze the genetic backgrounds of the resistance genes in order to understand their route of dissemination between these taxonomically distant bacteria.
(This work was presented in part at the 40th Interscience Conference on Antimicrobial Agents and Chemotherapy, Toronto, Ontario, Canada, 18 September 2000.)
MATERIALS AND METHODS
Bacterial strains and culture conditions.
Between November 1996 and December 2002, 24 ESBL-producing isolates of P. aeruginosa were collected from 18 patients by a private laboratory (Table 1). All isolates were identified by conventional methods (18) and serotyped by three independent assays by using the antisera provided by Bio-Rad (Marnes la Coquette, France). Seventeen ESBL-producing enterobacteria were also recovered from 10 of these 18 patients (Table 1). Identification to the species level was performed with the API 20E system (bioMérieux, Marcy l'Etoile, France). The wild-type strain P. aeruginosa ATCC 27853 was used as the control for MIC determination and pulsed-field gel electrophoresis (PFGE). An azide-resistant (Azr) mutant of Escherichia coli HB101, a spontaneous rifampin- and nalidixic acid-resistant (Rifr Nalr) mutant of E. coli K-12, and a rifampin-resistant (Rifr) mutant of P. aeruginosa ATCC 27853 were the recipient strains in conjugation experiments; and E. coli JM109, E. coli DH5α, and P. aeruginosa ATCC 27853 were used in transformation assays. All bacterial strains were routinely cultured at 37°C on Mueller-Hinton (MH) agar medium (Diagnostics Pasteur, Marnes la Coquette, France) or were grown in brain heart broth (Bio-Rad) or Trypticase soy broth (Diagnostics Pasteur).
Antibiotic susceptibility testing.
The susceptibilities of the 41 isolates to 32 antimicrobial agents were determined by the disk diffusion method in MH agar medium, according to French guidelines (http://www.sfm.asso.fr ). The presence of an ESBL was detected by the double-disk synergy test. For the 24 P. aeruginosa isolates, the MICs of 10 β-lactams alone or in combination with β-lactamase inhibitors (clavulanic acid, 2 μg/ml; tazobactam, 4 μg/ml) and of four aminoglycosides were determined by a standard agar dilution method in MH medium with an inoculum of 104 CFU per spot (http://www.sfm.asso.fr ).
β-Lactamase extraction and IEF.
β-Lactamases of the 24 isolates of P. aeruginosa, the 17 isolates of enterobacteria, and their transconjugants were released by ultrasonic treatment; and their pIs were determined by isoelectric focusing (IEF) on a pH 3.5 to 10 ampholine polyacrylamide gel, as described by Matthew et al. (31). Enzyme activities were detected by the iodine procedure in a gel with benzylpenicillin (75 μl/ml) as the substrate. β-Lactamases of known pIs, TEM-1 (pI 5.4), TEM-21 (pI 6.4), SHV-3 (pI 7.0), and SHV-1 (pI 7.6), were used as pI markers.
Conjugation, transformation experiments, and plasmid content analysis.
The transfer of resistance genes to E. coli K-12 Rifr Nalr, E. coli HB101 Azr, and P. aeruginosa ATCC 27853 Rifr was attempted by a filter mating technique. Transconjugants were selected on MH agar plates containing ceftazidime (2 μg/ml) and rifampin (200 μg/ml) or ceftazidime (2 μg/ml) and sodium azide (300 μg/ml). Plasmid DNA was extracted from the clinical isolates, the transconjugants, and the E. coli JM109 strain harboring the recombinant plasmid by using an alkaline lysis method (5) and a plasmid DNA midi kit (QIAGEN, Courtaboeuf, France). Putative plasmid DNA extracts obtained from the P. aeruginosa isolates was electroporated into E. coli DH5α and P. aeruginosa ATCC 27853 with selection on MH agar plates containing ticarcillin (100 μg/ml). Plasmid DNA extracted from the transconjugants of Enterobacteriaceae was restricted by the EcoRI enzyme and was analyzed on a 0.8% agarose gel in the presence of ethidium bromide.
PCR, sequencing, and cloning experiments.
Total DNA of the P. aeruginosa and enterobacterial isolates was extracted as described previously (39). The detection of the resistance genes was carried out under standard PCR conditions (41) with primers specific for the blaTEM and aac(6′)-Ib genes or primers designed in the laboratory (Table 2) and 0.5 μg of whole-cell DNA of the ESBL-expressing isolates. A combination of primers designed in the laboratory was also used for the determination of the blaTEM-21 genetic environment (Table 2). Amplification of large fragments (>3 kb) was performed with the GeneAmp XL-PCR kit (Applied Biosystems, Courtaboeuf, France), according to the manufacturer's instructions. The amplicons were revealed by electrophoresis on a 1.5% agarose gel and subsequent exposure to UV light in the presence of ethidium bromide. For sequencing purposes, the PCR products, purified through spin columns (Sephacryl S400; Amersham Biosciences, Orsay, France), and recombinant plasmid pEc223H were used as templates in a single-cycle reaction by using the primers designed in the laboratory and the DYEnamic ET dye terminator kit (Amersham Biosciences). The sequences were analyzed with an automatic sequencer (ABI 310; Perkin-Elmer, Courtaboeuf, France) by using the Sequencing Analysis software and were compared to each other and to homologous sequences with the Sequence Navigator software. The nucleotide and the deduced protein sequences were analyzed by using the software available over the Internet at the National Center for Biotechnology Information website (http://www.ncbi.nlm.nih.gov ).
The whole-cell DNA of the Ec223 isolate was totally restricted by the HindIII enzyme and was ligated into the HindIII site of the pBK-CMV cloning vector. The E. coli JM109 strain, which harbored recombinant plasmid pEc223H, was selected on MH agar plates containing 100 μg/ml of ampicillin and 50 μg/ml of kanamycin. The resistance patterns of the transconjugants were assessed by the disk diffusion method.
Hybridization.
DNA-DNA hybridization was carried out as described by Sambrook et al. (41) by Southern transfer on an agarose gel containing total DNA from the 24 P. aeruginosa isolates and the 17 enterobacterial isolates digested with the NruI restriction enzyme as the templates. The probe consisted of a 956-bp PCR fragment that was generated from the total DNA of the Pa141 isolate and that corresponds to the blaTEM-21 gene. Nonradioactive labeling of the probe and signal detection were achieved according to the manufacturer's instructions (Roche, Applied Science, Meylan, France).
Molecular typing.
For the 24 isolates of P. aeruginosa, a random amplified polymorphic DNA (RAPD) assay with primers AP12h (50) and primers 208 and 272 (28) and enterobacterial repetitive intergenic consensus PCR (ERIC-PCR) with primers ERIC2 and ERIC1R (47) were performed. After a first cycle of denaturation for 10 min at 94°C, the 45 subsequent cycles of amplification consisted of denaturation for 1 min at 94°C, annealing for 1 min at 42°C, and extension for 1 min at 72°C, with a final extension step for 10 min at 72°C. The amplification products were analyzed by electrophoresis of 10-μl samples on 1.5% agarose gels in the presence of ethidium bromide.
PFGE analysis was performed with the 24 isolates of P. aeruginosa by using the whole-cell DNA digested with the SpeI restriction enzyme, the Gene Path kits, and the CHEF-DR III variable angle system, according to the manufacturer's recommendations (Bio-Rad, Marnes la Coquette, France).
Nucleotide sequence accession number.
The nucleotide sequence of strain Pa141 has been submitted to GenBank and can be found under accession number AF46656 .
RESULTS
Patients and strains.
From November 1996 to December 2002, 18 patients (patients A to R) living in a nursing home near the city of Bordeaux, France, were infected by ESBL-expressing P. aeruginosa isolates that produced a green pigment that turned to red after 24 h. The nursing home was a 70-bed long-term-care facility that accommodates elderly and mostly invalid individuals. The 18 patients, 12 females and 6 males, ranged in age from 54 to 97 years (mean age, 80.5 years) and carried urinary catheters or condom drainage systems. A total of 24 P. aeruginosa isolates were collected from 19 urine specimens, 4 bedsores, and 1 sputum sample (Table 1). Seventeen ESBL-producing enterobacteria (five Proteus mirabilis, four Klebsiella pneumoniae, three Providencia stuartii, three E. coli, and two Morganella morganii isolates) were also isolated from 10 of these patients during the same period. These strains were collected from 15 urine specimens and 2 bedsores (Table 1). Unfortunately, the histories of these patients were unavailable, and no epidemiological investigation could be conducted.
Antibiotic susceptibility testing.
By the disk diffusion method, the 24 P. aeruginosa isolates were insensitive to all potentially active β-lactams except imipenem and produced an ESBL. In addition, all isolates were resistant to gentamicin, tobramycin, netilmicin, ciprofloxacin, and rifampin. These data were confirmed by MIC determination (Table 3). Five isolates were also resistant to fosfomycin.
The 17 enterobacterial isolates were also ESBL producers and were additionally resistant to kanamycin, gentamicin, tobramycin, netilmicin, amikacin, sulfonamides, and chloramphenicol. Among them, 12 were also resistant to tetracycline, 11 to fluoroquinolones, 8 to fosfomycin, and 7 to trimethoprim.
Transfer of resistance and plasmid content.
Conjugation experiments between the ESBL-producing P. aeruginosa isolates and E. coli HB101 Azr or P. aeruginosa ATCC 27853 Rifr as the recipients did not yield any ESBL-producing transconjugants (<10−8). Despite repeated attempts, plasmid DNA could be detected in only two pseudomonal isolates, and transformation of all plasmid DNA extracts into E. coli DH5α or P. aeruginosa ATCC 27853 by electroporation remained unsuccessful.
In contrast, mating assays between the ESBL-producing enterobacterial isolates and E. coli K-12 Nalr Rifr as the recipient always led to ESBL-producing transconjugants, as indicated by the antibiogram. Moreover, the transconjugants displayed the same pattern of coresistance as the donor strains, i.e., kanamycin, gentamicin, tobramycin, netilmicin, amikacin, sulfonamide, and chloramphenicol resistance. Plasmid DNA analysis revealed the presence of a single large plasmid, which gave an identical EcoRI restriction profile in all transconjugants (data not shown).
β-Lactamase characterization.
The β-lactamase contents of the clinical isolates and transconjugants was first analyzed by IEF. All the ESBL-producing P. aeruginosa isolates presented a band of pI 6.4 that cofocused with that of Pa141, which was previously shown by sequencing to contain the blaTEM-21 gene (14). Moreover, PCR products of the expected size were obtained with primers specific for the TEM family of β-lactamases for all P. aeruginosa isolates. All the ESBL-producing transconjugants obtained from the enterobacteria also displayed a single band of pI 6.4 and gave positive TEM-specific PCR amplifications. The clinical donor isolates occasionally presented additional bands consistent with species-specific β-lactamases (chromosomal penicillinase of pI 7.6 in K. pneumoniae or cephalosporinase with a pI of ≈7 in M. morganii) or acquired TEM-1 or TEM-2 enzymes (pI 5.4 and 5.6, respectively, in five P. mirabilis isolates, two K. pneumoniae isolates, and one P. stuartii isolate.
Serotyping and molecular typing.
The isolates of P. aeruginosa were serotyped by using polyvalent antisera and then monovalent antisera. They were found to belong to three serotypes (Fig. 1), O:2 (seven isolates), O:16 (seven isolates), and O:1 (four isolates); or they agglutinated with the serotype PME-specific polyvalent antiserum (six isolates) but with none of the corresponding monovalent antisera (O:2, O:5, O:15, and O:16). In two patients (patients G and L), P. aeruginosa isolates belonging to different serotypes (O:16 and O:1) were isolated at intervals of 6 and 2 weeks, respectively.
Molecular typing of P. aeruginosa isolates was undertaken at first by RAPD and ERIC-PCR methods. The results obtained with primers Ap12h and ERIC1R were insufficiently discriminant (the profiles were composed of two or three bands). The profiles given by primers ERIC2, 208, and 272 allowed better differentiation (8 to 11 bands) and appeared to be very similar (data not shown). The PFGE profiles of SpeI-restricted DNA of all TEM-21-producing P. aeruginosa isolates were identical or similar and were clearly different from that of the P. aeruginosa ATCC 27853 strain, used as a control (Fig. 2). Compared to the predominant pattern (e.g., Pa773), additional fragments were observed: ca. 500 kb (Pa1513), 400 kb (Pa133, Pa190, Pa1920, and Pa2044), 220 kb in four isolates of serotype PME (Pa1885, Pa1920, Pa2017, and Pa2030), and 140 kb (Pa133, Pa141, Pa190, and Pa192). On the other hand, some fragments were missing: ca. 360 kb (Pa2044), 320 kb (Pa133 and Pa190), and 80 kb (Pa815, Pa942, Pa1152, Pa1276, Pa1486, Pa1885, Pa1920, and Pa2017). Thus, the maximum number of fragment differences was three, which corresponds to the “closely related” category of isolates, according to Tenover et al. (45), and indicates that the isolates were probably part of an outbreak. Moreover, there was no evident relationship between the PFGE profiles and the serotypes.
Characterization of the genetic environment of the blaTEM-21 gene.
Based on the genetic environment of blaTEM-21 previously determined for isolate Pa141 (Fig. 3) (14), PCR amplifications with primers C6T7 and aac(3)-IIb were performed for all P. aeruginosa isolates and generated a fragment of the expected size, 2,847 bp. The specificity of the amplicon was checked by restriction with the SspI enzyme and led to the predicted profile of two bands of 919 and 1,928 bp. Then, primer C6T3P, located ca. 2,000 bp downstream from the aac(3)-II gene, was combined with primer C6T7, generating a large fragment of about 5 kb for all P. aeruginosa isolates. These data strongly suggested an identical genetic environment of blaTEM-21 in all pseudomonal isolates. In order to confirm these observations and the presence of a single blaTEM-21 gene, Southern blot experiments were carried out with the DNA of P. aeruginosa isolates restricted with the NruI enzyme and a blaTEM-specific probe. A single band of the expected size of 2,260 bp was observed in all cases (Fig. 4A). In contrast, Southern blotting carried out under the same experimental conditions and with DNA from the isolates of enterobacteria revealed the presence of at least one band, generally of about 6.5 kb (Fig. 4B), suggesting a common genetic environment different from that observed in the P. aeruginosa isolates. Moreover, PCR amplifications with primers C6T7 and aac(3)-IIb did not give any band with the enterobacteria, suggesting the absence of the IS6100 element upstream from the blaTEM-21 gene. Then, primer C6T7bis was combined with primer aac(3)-IIb, which yielded a fragment of 2,378 bp for all enterobacteria, indicating an identical genetic background of blaTEM-21. Further digestion with the SspI restriction enzyme confirmed the specificity of the amplicon. Thus, blaTEM-21 was present within transposon Tn801 and was colocated with the aac(3)-II gene. Then, the whole-cell DNA of the Ec223 strain was totally restricted by HindIII and ligated into the HindIII site of the pBK-CMV cloning vector. Sequencing experiments with the recombinant plasmid showed the presence of IS4321 (37) upstream from the Tn801 resolvase gene (Fig. 3). Primer IRL4321, within the left inverted repeat sequence of IS4321, in association with primer TnpA4R, upstream from the Tn801 resolvase gene, generated an expected fragment of 1,443 bp for all enterobacteria. These primers also allowed an amplicon of the same size to be obtained for all isolates of P. aeruginosa except Pa133 and Pa190, the two isolates from patient B, suggesting the presence of IS4321 upstream from IS6100. Thus, a sequence encompassing IS6100 has probably inserted within the resolvase gene of Tn801 in P. aeruginosa. However, this inserted fragment seemed to be very large, since GenAmp XL-PCR did not allow a specific amplification to be obtained.
Since the TEM-21-producing enterobacteria and their transconjugants were resistant to amikacin, the presence of the aac(6′)-I gene in these isolates was confirmed by PCR amplification, but it was absent from P. aeruginosa.
DISCUSSION
Between November 1996 and December 2002, infections associated with ESBL-producing isolates of P. aeruginosa were observed in a nursing home. Most of them were collected from urine specimens. Although E. coli is the most common organism responsible for UTIs, other enterobacteria, such as P. mirabilis, P. stuartii, or K. pneumoniae, and P. aeruginosa, occur frequently in older patients, especially those in long-term-care facilities, as in this study (16, 34, 43, 44). UTIs are the most common bacterial infections in the older population (34). Moreover, among individuals who use urinary devices, as was the case among all patients in this study, colonization of these devices and subsequent infection by transmission between patients on the hands of caregivers or through contaminated equipment tend to occur (7, 34). The urinary tract is thus the most prevalent site of nosocomial infections in long-term-care facilities (16, 43). Although the term “nosocomial infections” has traditionally meant infections acquired in a general hospital, it should be broadened to include infections acquired in nursing homes (43). UTIs are also one of the most frequent indications for the prescription of systemic antimicrobials in the older population. This contributes to the excessive use of antibiotics and promotes the emergence of antimicrobial resistance (7). Consistently, older residents of long-term-care facilities have a higher prevalence of resistant organisms than older patients who are not institutionalized (44, 51).
The P. aeruginosa isolates involved exhibited an unusual red pigment whose development was delayed and a similar antibiotype. Moreover, the presence of a TEM-21 enzyme was demonstrated by IEF, PCR experiments, and sequencing of representative isolate Pa141 (14). These data were suggestive of an outbreak of resistant strains due to a clone that persisted over at least a 6-year period in the environment or in the patients of this nursing home. Surprisingly, serotyping revealed that these isolates belonged to four chronologically successive serotypes, O:2, O:16, O:1, and PME. The blaTEM-21 gene was found to be chromosomally located, as demonstrated by the absence of transfer by conjugation, transformation of a putative plasmid extract, and Southern blot experiments with unrestricted DNA (data not shown). Thus, the plasmid profile could not be used as an epidemiological marker. Consequently, whole-DNA typing was undertaken by RAPD and ERIC-PCR experiments. RAPD analysis is considered a robust, simple, and highly reproducible method and has successfully been used to study the epidemiology of P. aeruginosa in patients with cystic fibrosis (8) and during a nosocomial outbreak (24). Primers ERIC2, 208, and 272 gave the most informative results and indicated a high similarity among the isolates, despite their different serotypes. Thus, the “gold standard” typing method, PFGE, was performed and confirmed that all isolates were closely related, suggesting a progressive genetic drift from the parental isolate. Indeed, members of the species P. aeruginosa are known to have variable bacterial characteristics and to undergo changes in serotype and O-antigen structure during bacteriophage infection (27) or antipseudomonal drug use (25).
Moreover, because the genetic environment of antibiotic resistance genes may represent an epidemiological marker for closely related strains (4), the sequences surrounding the blaTEM-21 gene in P. aeruginosa isolates were analyzed by PCR amplification and Southern blot experiments. All pseudomonal isolates appeared to possess an identical genetic environment for the blaTEM-21 gene; i.e., the blaTEM-21 gene was part of a Tn801 transposon truncated by an IS6100 element inserted within the resolvase gene, and the aac(3)-II gene was adjacent to this structure (14). In order to elucidate the origin of the blaTEM-21 gene in the P. aeruginosa isolates, the ESBL-producing enterobacteria carried by 10 of the 18 patients were examined. These isolates, which belonged to five different species, were found by IEF and PCR experiments to produce the TEM-21 β-lactamase. This enzyme was encoded by the same large conjugative plasmid, according to analysis of the cotransferred drug resistance and restriction profiles. This plasmid carried the blaTEM-21 and the aac(3)-II genes and conferred additional resistance to amikacin, conveyed by an AAC(6′)-I enzyme. Indeed, an outbreak of nosocomial infections due to the spread of TEM-21-producing enterobacteria and a TEM-21-encoding plasmid among different species of the family Enterobacteriaceae has previously been demonstrated for other patients in this nursing home during a 6-month survey in 1999 (3). Outbreaks of ESBL-producing enterobacteria due to the spread of resistant plasmids have been described in hospitals (9, 10, 20, 26, 36) as well as in long-term-care facilities (49), but the persistence of the ESBL-producing enterobacteria in the nursing home described here during at least a 6-year period reflected an endemic situation that has, until now, been reported only in hospitals (19, 29). Among the ESBLs elaborated by enterobacteria, TEM-21 is less frequent than TEM-24 and TEM-3 in France (11, 12, 19), but it has been already detected in the Bordeaux area (3, 46) and was unknown in P. aeruginosa until our description (14). Thus, the hypothesis that the blaTEM-21 gene found in P. aeruginosa isolates originated from enterobacteria by gene transfer, as previously evidenced for blaTEM-24 (30) and blaSHV-2a (33) and suspected for blaSHV-12 and blaSHV-15 (9, 38), appeared to be likely. However, cloning and sequencing experiments for a representative isolate, Ec223, followed by PCR amplifications of all transconjugants of the 16 remaining strains, indicated an organization different from that in the P. aeruginosa isolates. Indeed, the blaTEM-21 gene was part of Tn801 and was adjacent to the aac(3)-II gene, but the transposon was disrupted by IS4321, inserted between the resolvase and the transposase genes.
Thus, the blaTEM-21 gene was carried on a conjugative plasmid in the enterobacterial isolates, while it was chromosomally located in the P. aeruginosa isolates. Differences in origins of replication may lead to the elimination of plasmids from Enterobacteriaceae in P. aeruginosa. Therefore, the persistence of the resistance genes requires their chromosomal integration. Since the blaTEM-21 gene was located within a truncated Tn801 and the aac(3)-II gene was situated outside of the transposon in both types of organisms, both genes could not have been transferred by a Tn801-mediated transposition. Thus, chromosomal integration of the plasmid itself might have happened after intergeneric transfer, as was suggested for P. aeruginosa isolates containing the blaSHV-12 gene (9) and the blaSHV-5 gene (38). However, if such chromosomal integration occurred in TEM-21-producing P. aeruginosa isolates, it was incomplete since the aac(6′)-I gene present on the plasmid from Enterobacteriaceae was lacking. Alternatively, a large mobile element encompassing the resistance genes might have ensured this genetic transfer. In this regard, one can notice that IS4321 is a member of the IS1111 family and is known to target the terminal inverted repeats of the Tn21 family of transposons (37). Moreover, the genetic environment of the blaTEM-21 gene was different and was characterized by the presence of IS6100 in P. aeruginosa isolates, replaced by an IS4321 at a slightly different position in the enterobacteria. The insertion of IS4321 in Tn801 of most P. aeruginosa isolates indicated that a very large fragment that includes IS6100 might have been secondarily integrated in the chromosome within Tn801. Only isolates Pa133 and Pa190, from patient B, lacked this fragment; and both isolates were indistinguishable by PFGE, but their PFGE patterns were slightly different from the outbreak isolate PFGE pattern, suggesting a specific genetic rearrangement.
In conclusion, we report here on an endemic situation in a nursing home due to the dissemination of ESBL-producing strains and an ESBL-encoding plasmid, which shows that such a situation is not restricted to hospitals and clinics. A P. aeruginosa strain once probably acquired the ESBL-encoding plasmid that was epidemic among enterobacteria in this institution, and subsequent chromosomal integration followed by genetic reorganization allowed the persistence of the ESBL-encoding gene. Then, this strain spread among patients of the nursing home, undergoing genetic drift under antibiotic treatment or other pressures which became associated with modifications of the serotype. After a change in the directory staff of the nursing home, the number of prescriptions of microbiological analyses decreased considerably, and no ESBL-producing P. aeruginosa isolates have been isolated from the residents since 2003; but ESBL-producing enterobacteria are still being recovered.
FIG. 1.
FIG. 2.
FIG. 3.
FIG. 4.
TABLE 1.
| Patient/age (yr)/sex | Bacterial species | Strain no. | Specimen | Date of isolation (day/mo/yr) | P. aeruginosa serotype | β-Lactamase content | Antibiotypeb | ||
|---|---|---|---|---|---|---|---|---|---|
| pI(s) | Enzyme(s) | ||||||||
| A/78/M | P. aeruginosa | Pa192 | Urine | 27/11/1996 | P2 | 6.4 | TEM-21 | GTNt, FQ | |
| B/85/M | P. aeruginosa | Pa133 | Urine | 09/09/1997 | P2 | 6.4 | TEM-21 | GTNt, FQ | |
| P. aeruginosa | Pa190 | Urine | 31/10/1997 | P2 | 6.4 | TEM-21 | GTNt, FQ | ||
| P. stuartii | Ps202 | Urine | 31/10/1997 | 6.4 | TEM-21 | KGTNt(A), SSS, TMP, C, TE, FQ, FOS | |||
| K. pneumoniae | Kp447 | Urine | 06/08/1998 | 5.4, 6.4, 7.6 | TEM-1, TEM-21, SHV-1 | KGTNt(A), SSS, TMP, C, FQ | |||
| C/68/F | P. aeruginosa | Pa141 | Urine | 19/09/1997 | P2 | 6.4 | TEM-21 | GTNt, FQ | |
| P. stuartii | Ps1737 | Urine | 12/09/2001 | 6.4 | TEM-21 | KGTNt(A), SSS, TMP, C, TE, FQ, FOS | |||
| P. mirabilis | Pm1890 | Urine | 05/03/2002 | 5.4, 6.4 | TEM-1, TEM-21 | KGTNt(A), SSS, C, TE, FQ | |||
| D/74/M | E. coli | Ec223 | Urine | 23/01/1999 | 6.4 | TEM-21 | KGTNt(A), SSS, C | ||
| K. pneumoniae | Kp276 | Urine | 23/02/1999 | 6.4, 7.6 | TEM-21, SHV-1 | KGTNt(A), SSS, C | |||
| P. aeruginosa | Pa504 | Urine | 23/04/1999 | P2 | 6.4 | TEM-21 | GTNt, FQ | ||
| E/94/M | P. aeruginosa | Pa678 | Bedsore | 09/10/1999 | P2 | 6.4 | TEM-21 | GTNt, FQ | |
| F/91/F | P. mirabilis | Pm749 | Urine | 28/01/2000 | 5.4, 6.4 | TEM-1, TEM-21 | KGTNt(A), SSS, C, TE | ||
| K. pneumoniae | Kp750 | Urine | 28/01/2000 | 6.4, 7.6 | TEM-21, SHV-1 | KGTNt(A), SSS, C, TE | |||
| P. aeruginosa | Pa773 | Sputum | 02/02/2000 | P16 | 6.4 | TEM-21 | GTNt, FQ | ||
| P. stuartii | Ps763 | Bedsore | 10/02/2000 | 5.4, 6.4 | TEM-1, TEM-21 | KGTNt(A), SSS, TMP, C, TE, FQ, FOS | |||
| G/88/F | P. aeruginosa | Pa815 | Bedsore | 25/02/2000 | P16 | 6.4 | TEM-21 | GTNt, FQ | |
| P. aeruginosa | Pa943 | Urine | 08/04/2000 | P1 | 6.4 | TEM-21 | GTNt, FQ | ||
| H/72/M | M. morganii | Mm109 | Urine | 15/12/1998 | 6.4, 7 | TEM-21, AmpC | KGTNt(A), SSS, TMP, C, TE, FQ, FOS | ||
| P. aeruginosa | Pa813 | Urine | 29/02/2000 | P16 | 6.4 | TEM-21 | GTNt, FQ | ||
| I/80/F | P. aeruginosa | Pa942 | Urine | 13/04/2000 | P16 | 6.4 | TEM-21 | GTNt, FQ | |
| J/91/F | P. aeruginosa | Pa1152 | Urine | 18/10/2000 | P16 | 6.4 | TEM-21 | GTNt, FQ | |
| M. morganii | Mm1344 | Urine | 02/02/2001 | 6.4, 7 | TEM-21, AmpC | KGTNt(A), SSS, TMP, C, TE, FQ, FOS | |||
| P. mirabilis | Pm1615 | Bedsore | 16/05/2001 | 5.4, 6.4 | TEM-1, TEM-21 | KGTNt(A), SSS, C, TE, FQ, FOS | |||
| K/89/F | P. aeruginosa | Pa1276 | Bedsore | 02/01/2001 | P16 | 6.4 | TEM-21 | GTNt, FQ | |
| L/97/F | P. mirabilis | Pm1345 | Urine | 02/02/2001 | 5.6, 6.4 | TEM-2, TEM-21 | KGTNt(A), SSS, C, TE, FQ, FOS | ||
| P. aeruginosa | Pa1486 | Urine | 08/03/2001 | P16 | 6.4 | TEM-21 | GTNt, FQ, FOS | ||
| P. aeruginosa | Pa1513 | Urine | 21/03/2001 | P1 | 6.4 | TEM-21 | GTNt, FQ, FOS | ||
| P. mirabilis | Pm1587 | Urine | 11/04/2001 | 5.4, 6.4 | TEM-1, TEM-21 | KGTNt(A), SSS, C, TE, FQ, FOS | |||
| M/91/F | P. aeruginosa | Pa1727 | Urine | 30/08/2001 | P1 | 6.4 | TEM-21 | GTNt, FQ | |
| E. coli | Ec1728 | Urine | 30/08/2001 | 6.4 | TEM-21 | KGTNt(A), SSS, C, TE, FQ | |||
| P. aeruginosa | Pa1782 | Urine | 23/11/2001 | P1 | 6.4 | TEM-21 | GTNt, FQ, FOS | ||
| N/77/F | P. aeruginosa | Pa1891 | Urine | 05/03/2002 | P2 | 6.4 | TEM-21 | GTNt, FQ | |
| O/72/F | P. aeruginosa | Pa1885 | Urine | 11/03/2002 | PME | 6.4 | TEM-21 | GTNt, FQ | |
| P. aeruginosa | Pa2030 | Urine | 27/11/2002 | PME | 6.4 | TEM-21 | GTNt, FQ | ||
| P/79/F | P. aeruginosa | Pa1884 | Urine | 15/03/2002 | PME | 6.4 | TEM-21 | GTNt, FQ | |
| Q/54/M | P. aeruginosa | Pa1920 | Bedsore | 15/05/2002 | PME | 6.4 | TEM-21 | GTNt, FQ | |
| E. coli | Ec1927 | Urine | 12/06/2002 | 6.4 | TEM-21 | KGTNt(A), SSS, C | |||
| R/80/F | K. pneumoniae | Kp1966 | Urine | 28/09/2002 | 5.6, 6.4, 7.6 | TEM-2, TEM-21, SHV-1 | KGTNt(A), SSS, TMP, C | ||
| P. aeruginosa | Pa2017 | Urine | 13/11/2002 | PME | 6.4 | TEM-21 | GTNt, FQ, FOS | ||
| P. aeruginosa | Pa2044 | Urine | 10/12/2002 | PME | 6.4 | TEM-21 | GTNt, FQ, FOS | ||
a
M, male; F, female; FQ, fluoroquinolones; FOS, fosfomycin; SSS, sulfonamides; C, chloramphenicol; TE, tetracycline; TMP, trimethoprim; K, kanamycin; G, gentamicin; T, tobramycin; Nt, netilmicin; (A), amikacin at low levels.
b
The drug to which resistance is cotransferred by the ESBL is indicated in boldface.
TABLE 2.
| Primer | Sequence (5′ to 3′) | Position (nt)a | Reference |
|---|---|---|---|
| TEM-A2 | GTATCCGCTCATGAGACAAT | 1285-1304 | 14 |
| TEM-ext | GTATATATGAGTAAACTTGGTCTG | 2234-2211 | 14 |
| aac(3)-IIa | ATATCGCGATGCATACGCGG | 2380-2399 | 14 |
| aac(3)-IIb | GACGGCCTCTAACCGGAAGG | 3256-3237 | 14 |
| 5′AAC6′ | CATCATAGGAGGTGATCCAATGACCAACAGCAACGATTCCG | 15 | |
| 3′AAC6′ | CCTCGATGGAAGGGTTAGGC | 15 | |
| C6T7 | GCCTGAAGCACTGGGAAAAG | 410-429 | 14 |
| C6T7bis | TTTATTGACGACGGGATCAG | 879-898 | 14 |
| C6T3P | TTTGAACGTCCGCTGGCTGTG | This study | |
| Resinv | ATCCTCCGGCGTTCAGCTTG | 970-951 | 14 |
| TnpA4R | GGACACTCAAACGAAGCCG | This study | |
| IRL4321 | ATGGTCACTCCCTCCTTCC | This study |
a
nt, number of the nucleotide, according to the sequence from the strain Pa141 submitted to GenBank under accession number AF46656 .
TABLE 3.
| Antimicrobial agent(s) | Resistant strains of P. aeruginosa | MIC (μg/ml) for P. aeruginosa ATCC 27853 | MIC breakpoint (μg/ml)c | ||
|---|---|---|---|---|---|
| Range of MICs (μg/ml) | Mode MIC (μg/ml) | ||||
| Ticarcillin | >512 | >512 | 8 | ≤16->64 | |
| Ticarcillin + CLAa | 16-64 | 32 | 8 | ≤16->64 | |
| Piperacillin | 32-128 | 64 | 4 | ≤16->64 | |
| Piperacillin + TZBb | 4-16 | 8 | 4 | ≤16->64 | |
| Imipenem | 1-4 | 2 | 2 | ≤4->8 | |
| Aztreonam | 8-32 | 16 | 4 | ≤4->32 | |
| Aztreonam + CLA | 2-8 | 4 | 4 | ||
| Ceftazidime | 8-32 | 16 | 1 | ≤4->32 | |
| Ceftazidime + CLA | 1-4 | 4 | 1 | ||
| Cefotaxime | 128-512 | 256 | 16 | ≤4->32 | |
| Cefotaxime + CLA | 16-128 | 128 | 16 | ||
| Cefsulodin | 256->512 | 512 | 2 | ≤8->32 | |
| Cefoperazone | 32-128 | 32 | 4 | ≤4->32 | |
| Cefepime | 16-64 | 32 | 2 | ≤4->32 | |
| Cefpirome | 32-128 | 128 | 4 | ≤4->32 | |
| Gentamicin | 512-512 | >512 | 2 | ≤4->8 | |
| Tobramycin | 64-256 | 128 | 1 | ≤4->8 | |
| Netilmicin | >512 | >512 | 4 | ≤4->8 | |
| Amikacin | 8-32 | 16 | 4 | ≤8->16 | |
a
CLA, clavulanic acid, 2 μg/ml.
b
TZB, tazobactam, 4 μg/ml.
c
According to the French guidelines (http://www.sfm.asso.fr ).
Acknowledgments
We thank Hugues Bretheau for photographic work and Hélène Boulestreau for precious assistance with the PFGE experiments.
This work was supported by grants from the Ministère de l'Education Nationale et de la Recherche (EA-525), Université de Bordeaux 2, Bordeaux, France.
REFERENCES
1.
Ambler, R. P., A. F. Coulson, J. M. Frere, J. M. Ghuysen, B. Joris, M. Forsman, R. C. Levesque, G. Tiraby, and S. G. Waley. 1991. A standard numbering scheme for the class A β-lactamases. Biochem. J.276:269-270.
2.
Arancibia, F., T. T. Bauer, S. Ewig, J. Mensa, J. Gonzalez, M. S. Niederman, and A. Torres. 2002. Community-acquired pneumonia due to gram-negative bacteria and Pseudomonas aeruginosa: incidence, risk, and prognosis. Arch. Intern. Med.162:1849-1858.
3.
Arpin, C., V. Dubois, L. Coulange, C. Andre, I. Fischer, P. Noury, F. Grobost, J. P. Brochet, J. Jullin, B. Dutilh, G. Larribet, I. Lagrange, and C. Quentin. 2003. Extended-spectrum β-lactamase-producing Enterobacteriaceae in community and private health care centers. Antimicrob. Agents Chemother.47:3506-3514.
4.
Arpin, C., V. Dubois, A. M. Rogues, F. Menard, A. M. Gavinet, J. P. Maire, J. P. Gachie, M. C. Bezian, and C. Quentin. 2002. Cross-infection due to imipenem-resistant Bacteroides fragilis associated with a totally implantable venous port. J. Clin. Microbiol.40:3032-3034.
5.
Birnboim, H. C., and J. Doly. 1979. A rapid alkaline extraction procedure for screening recombinant plasmid DNA. Nucleic Acids Res.7:1513-1523.
6.
Bodey, G. P. 2001. Pseudomonas aeruginosa infections in cancer patients: have they gone away? Curr. Opin. Infect. Dis.14:403-407.
7.
Bonomo, R. A. 2000. Multiple antibiotic-resistant bacteria in long-term-care facilities: an emerging problem in the practice of infectious diseases. Clin. Infect. Dis.31:1414-1422.
8.
Campbell, J. I., O. Ciofu, and N. Hoiby. 1997. Pseudomonas aeruginosa isolates from patients with cystic fibrosis have different β-lactamase expression phenotypes but are homogeneous in the ampC-ampR genetic region. Antimicrob. Agents Chemother.41:1380-1384.
9.
Chanawong, A., F. H. M'Zali, J. Heritage, A. Lulitanond, and P. M. Hawkey. 2001. SHV-12, SHV-5, SHV-2a and VEB-1 extended-spectrum β-lactamases in gram-negative bacteria isolated in a university hospital in Thailand. J. Antimicrob. Chemother.48:839-852.
10.
D'Agata, E., L. Venkataraman, P. DeGirolami, L. Weigel, M. Samore, and F. Tenover. 1998. The molecular and clinical epidemiology of Enterobacteriaceae-producing extended-spectrum β-lactamase in a tertiary care hospital. J. Infect.36:279-285.
11.
De Champs, C., C. Chanal, D. Sirot, R. Baraduc, J. P. Romaszko, R. Bonnet, A. Plaidy, M. Boyer, E. Carroy, M. C. Gbadamassi, S. Laluque, O. Oules, M. C. Poupart, M. Villemain, and J. Sirot. 2004. Frequency and diversity of class A extended-spectrum β-lactamases in hospitals of the Auvergne, France: a 2 year prospective study. J. Antimicrob. Chemother.54:634-639.
12.
De Champs, C., D. Sirot, C. Chanal, R. Bonnet, J. Sirot, and The French Study Group. 2000. A 1998 survey of extended-spectrum β-lactamases in Enterobacteriaceae in France. Antimicrob. Agents Chemother.44:3177-3179.
13.
Dubois, V., C. Arpin, M. Melon, B. Melon, C. Andre, C. Frigo, and C. Quentin. 2001. Nosocomial outbreak due to a multiresistant strain of Pseudomonas aeruginosa P12: efficacy of cefepime-amikacin therapy and analysis of β-lactam resistance. J. Clin. Microbiol.39:2072-2078.
14.
Dubois, V., C. Arpin, P. Noury, and C. Quentin. 2002. Clinical strain of Pseudomonas aeruginosa carrying a blaTEM-21 gene located on a chromosomal interrupted TnA type transposon. Antimicrob. Agents Chemother.46:3624-3626.
15.
Dubois, V., L. Poirel, C. Marie, C. Arpin, P. Nordmann, and C. Quentin. 2002. Molecular characterization of a novel class 1 integron containing blaGES-1 and a fused product of aac3-Ib/aac6′-Ib′ gene cassettes in Pseudomonas aeruginosa.Antimicrob. Agents Chemother.46:638-645.
16.
Gambert, S. R., E. H. Duthie, Jr., B. Priefer, and R. A. Rabinovitch. 1982. Bacterial infections in a hospital-based skilled nursing facility. J. Chronic Dis.35:781-786.
17.
Garau, J., and L. Gomez. 2003. Pseudomonas aeruginosa pneumonia. Curr. Opin. Infect. Dis.16:135-143.
18.
Gilligan, P. H. 1995. Pseudomonas and Burkholderia, p. 509-519. In P. R. Murray, E. J. Baron, M. A. Pfaller, F. C. Tenover, and R. H. Yolken (ed.), Manual of clinical microbiology, 6th ed. ASM Press, Washington, D.C.
19.
Giraud-Morin, C., and T. Fosse. 2003. A seven-year survey of Klebsiella pneumoniae producing TEM-24 extended-spectrum β-lactamase in Nice University Hospital (1994-2000). J. Hosp. Infect.54:25-31.
20.
Gniadkowski, M., A. Palucha, P. Grzesiowski, and W. Hryniewicz. 1998. Outbreak of ceftazidime-resistant Klebsiella pneumoniae in a pediatric hospital in Warsaw, Poland: clonal spread of the TEM-47 extended-spectrum β-lactamase (ESBL)-producing strain and transfer of a plasmid carrying the SHV-5-like ESBL-encoding gene. Antimicrob. Agents Chemother.42:3079-3085.
21.
Hatchette, T. F., R. Gupta, and T. J. Marrie. 2000. Pseudomonas aeruginosa community-acquired pneumonia in previously healthy adults: case report and review of the literature. Clin. Infect. Dis.31:1349-1356.
22.
Hollyoak, V., D. Allison, and J. Summers. 1995. Pseudomonas aeruginosa wound infection associated with a nursing home's whirlpool bath. Commun. Dis. Rep. Rev.5:R100-R102.
23.
Huang, Y. C., T. Y. Lin, and C. H. Wang. 2002. Community-acquired Pseudomonas aeruginosa sepsis in previously healthy infants and children: analysis of forty-three episodes. Pediatr. Infect. Dis. J.21:1049-1052.
24.
Kerr, J. R., J. E. Moore, M. D. Curran, R. Graham, C. H. Webb, K. G. Lowry, P. G. Murphy, T. S. Wilson, and W. P. Ferguson. 1995. Investigation of a nosocomial outbreak of Pseudomonas aeruginosa pneumonia in an intensive care unit by random amplification of polymorphic DNA assay. J. Hosp. Infect.30:125-131.
25.
Kobayashi, I., M. Hasegawa, S. Miyazaki, M. Nishida, and S. Goto. 1994. In vitro and in vivo changes of serotype in Pseudomonas aeruginosa isolates by anti-pseudomonal drugs. J. Antibiot.47:72-79.
26.
Legakis, N. J., L. S. Tzouvelekis, G. Hatzoudis, E. Tzelepi, A. Gourkou, T. L. Pitt, and A. C. Vatopoulos. 1995. Klebsiella pneumoniae infections in Greek hospitals. Dissemination of plasmids encoding an SHV-5 type β-lactamase. J. Hosp. Infect.31:177-187.
27.
Liu, P. V. 1969. Changes in somatic antigens of Pseudomonas aeruginosa induced by bacteriophages. J. Infect. Dis.119:237-246.
28.
Mahenthiralingam, E., M. E. Campbell, J. Foster, J. S. Lam, and D. P. Speert. 1996. Random amplified polymorphic DNA typing of Pseudomonas aeruginosa isolates recovered from patients with cystic fibrosis. J. Clin. Microbiol.34:1129-1135.
29.
Mammeri, H., G. Laurans, M. Eveillard, S. Castelain, and F. Eb. 2001. Coexistence of SHV-4- and TEM-24-producing Enterobacter aerogenes strains before a large outbreak of TEM-24-producing strains in a French hospital. J. Clin. Microbiol.39:2184-2190.
30.
Marchandin, H., H. Jean-Pierre, C. De Champs, D. Sirot, H. Darbas, P. F. Perigault, and C. Carriere. 2000. Production of a TEM-24 plasmid-mediated extended-spectrum β-lactamase by a clinical isolate of Pseudomonas aeruginosa.Antimicrob. Agents Chemother.44:213-216.
31.
Matthew, M., A. M. Harris, M. J. Marshall, and G. W. Ross. 1975. The use of analytical isoelectric focusing for detection and identification of β-lactamases. J. Gen. Microbiol.88:169-178.
32.
Miller, G. H., F. J. Sabatelli, L. Naples, R. S. Hare, and K. J. Shaw. 1995. The most frequently occurring aminoglycoside resistance mechanisms—combined results of surveys in eight regions of the world. J. Chemother.7:17-30.
33.
Naas, T., L. Philippon, L. Poirel, E. Ronco, and P. Nordmann. 1999. An SHV-derived extended-spectrum β-lactamase in Pseudomonas aeruginosa.Antimicrob. Agents Chemother.43:1281-1284.
34.
Nicolle, L. E. 2002. Resistant pathogens in urinary tract infections. J. Am. Geriatr. Soc.50:S230-S235.
35.
Nordmann, P. 1998. Trends in β-lactam resistance among Enterobacteriaceae.Clin. Infect. Dis.27:S100-S106.
36.
Palucha, A., B. Mikiewicz, W. Hryniewicz, and M. Gniadkowski. 1999. Concurrent outbreaks of extended-spectrum β-lactamase-producing organisms of the family Enterobacteriaceae in a Warsaw hospital. J. Antimicrob. Chemother.44:489-499.
37.
Partridge, S. R., and R. M. Hall. 2003. The IS1111 family members IS4321 and IS5075 have subterminal inverted repeats and target the terminal inverted repeats of Tn21 family transposons. J. Bacteriol.185:6371-6384.
38.
Poirel, L., E. Lebessi, M. Castro, C. Fevre, M. Foustoukou, and P. Nordmann. 2004. Nosocomial outbreak of extended-spectrum β-lactamase SHV-5-producing isolates of Pseudomonas aeruginosa in Athens, Greece. Antimicrob. Agents Chemother.48:2277-2279.
39.
Poirel, L., T. Naas, D. Nicolas, L. Collet, S. Bellais, J. D. Cavallo, and P. Nordmann. 2000. Characterization of VIM-2, a carbapenem-hydrolyzing metallo-β-lactamase and its plasmid- and integron-borne gene from a Pseudomonas aeruginosa clinical isolate in France. Antimicrob. Agents Chemother.44:891-897.
40.
Quinn, J. P. 1998. Clinical problems posed by multiresistant nonfermenting gram-negative pathogens. Clin. Infect. Dis.27:S117-S124.
41.
Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
42.
Santucci, S. G., S. Gobara, C. R. Santos, C. Fontana, and A. S. Levin. 2003. Infections in a burn intensive care unit: experience of seven years. J. Hosp. Infect.53:6-13.
43.
Sherman, F. T., V. Tucci, L. S. Libow, and H. D. Isenberg. 1980. Nosocomial urinary-tract infections in a skilled nursing facility. J. Am. Geriatr. Soc.28:456-461.
44.
Smith, P. W., C. W. Seip, S. C. Schaefer, and C. Bell-Dixon. 2000. Microbiologic survey of long-term care facilities. Am. J. Infect. Control28:8-13.
45.
Tenover, F. C., R. D. Arbeit, R. V. Goering, P. A. Mickelsen, B. E. Murray, D. H. Persing, and B. Swaminathan. 1995. Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing. J. Clin. Microbiol.33:2233-2239.
46.
Tessier, F., C. Arpin, A. Allery, and C. Quentin. 1998. Molecular characterization of a TEM-21 β-lactamase in a clinical isolate of Morganella morganii.Antimicrob. Agents Chemother.42:2125-2127.
47.
Versalovic, J., T. Koeuth, and J. R. Lupski. 1991. Distribution of repetitive DNA sequences in eubacteria and application to fingerprinting of bacterial genomes. Nucleic Acids Res.19:6823-6831.
48.
Weldhagen, G. F., L. Poirel, and P. Nordmann. 2003. Ambler class A extended-spectrum β-lactamases in Pseudomonas aeruginosa: novel developments and clinical impact. Antimicrob. Agents Chemother.47:2385-2392.
49.
Wiener, J., J. P. Quinn, P. A. Bradford, R. V. Goering, C. Nathan, K. Bush, and R. A. Weinstein. 1999. Multiple antibiotic-resistant Klebsiella and Escherichia coli in nursing homes. JAMA281:517-523.
50.
Williams, J. G., A. R. Kubelik, K. J. Livak, J. A. Rafalski, and S. V. Tingey. 1990. DNA polymorphisms amplified by arbitrary primers are useful as genetic markers. Nucleic Acids Res.18:6531-6535.
51.
Wright, S. W., K. D. Wrenn, M. Haynes, and D. W. Haas. 2000. Prevalence and risk factors for multidrug resistant uropathogens in ED patients. Am. J. Emerg. Med.18:143-146.
Information & Contributors
Information
Published In
Journal of Clinical Microbiology
Volume 43 • Number 8 • August 2005
Pages: 4129 - 4138
PubMed: 16081960
Copyright
© 2005 American Society for Microbiology.
History
Received: 3 March 2005
Revision received: 23 March 2005
Accepted: 12 April 2005
Published online: 1 August 2005
Contributors
Metrics & Citations
Metrics
Note:
- For recently published articles, the TOTAL download count will appear as zero until a new month starts.
- There is a 3- to 4-day delay in article usage, so article usage will not appear immediately after publication.
- Citation counts come from the Crossref Cited by service.
Citations
Citation
2005.
Prolonged Outbreak of Infection Due to TEM-21-Producing Strains of Pseudomonas aeruginosa and Enterobacteria in a Nursing Home. J Clin Microbiol
43:.
If you have the appropriate software installed, you can download article citation data to the citation manager of your choice. For an editable text file, please select Medlars format which will download as a .txt file. Simply select your manager software from the list below and click Download.