Research Article
1 July 1999

Detection and Identification ofEhrlichia, Borrelia burgdorferi Sensu Lato, andBartonella Species in Dutch Ixodes ricinusTicks

ABSTRACT

A sensitive and specific PCR hybridization assay was developed for the simultaneous detection and identification of Ehrlichiaand Borrelia burgdorferi sensu lato. In separate assays the 16S rRNA gene of Ehrlichia species and the 23S-5S rRNA spacer region of B. burgdorferi sensu lato were amplified and labeled by PCR. These PCR products were used in a reverse line blot hybridization assay in which oligonucleotide probes are covalently linked to a membrane in parallel lines. Hybridization of the samples with the oligonucleotide probes on this membrane enabled the simultaneous detection and identification of Ehrlichia,B. burgdorferi, and Bartonella species in 40 different samples. The application of the assay to DNA extracts from 121 Ixodes ricinus ticks collected from roe deer demonstrated that 45% of these ticks carried EhrlichiaDNA. More than half of these positive ticks carried species with 16S rRNA gene sequences closely related to those of E. phagocytophila and the human granulocytic ehrlichiosis agent. The majority of the other positive ticks were infected with a newly identified Ehrlichia-like species. In addition, 13% of the ticks were infected with one or more B. burgdorferigenospecies. In more than 70% of the ticks 16S rRNA gene sequences forBartonella species or other species closely related toBartonella were found. In five of the ticks bothEhrlichia and B. burgdorferi species were detected.
The zoonotic vector-borne diseases form a large proportion of the emerging bacterial infectious diseases. The most prominent of these diseases are Lyme disease, ehrlichiosis, and bartonellosis. In The Netherlands 10 to 35% of the Ixodes ricinus ticks are infected with Borrelia burgdorferi, the causative agent of Lyme disease (25, 26). In 1994, general practitioners in The Netherlands reported seeing 33,000 patients who had sustained tick bites and approximately 6,500 patients with erythema migrans (7). These findings not only underline the importance of borreliosis but also suggest that other vector-borne diseases may occur in The Netherlands.
Presently, two tick-transmitted Ehrlichia species have been shown to cause human disease. The first is Ehrlichia chaffeensis, which causes human monocytic ehrlichiosis and which is transmitted by Amblyomma americanum, a tick species found only in the United States. Until now, very few cases of E. chaffeensis infection in Europe have been described (5, 15, 21). The second Ehrlichia species pathogenic for humans is the human granulocytic ehrlichiosis agent (HGE). The exact nature of this organism is still unclear, but on the basis of its 16S rRNA sequence it is shown to be closely related to Ehrlichia phagocytophila and Ehrlichia equi. The HGE agent is transmitted by Ixodes scapularis, but possibly also by other vectors like I. ricinus. Again, the initial reports of disease of human patients with HGE came from the United States. Remarkably, there have been very few reports of cases of disease caused by HGE in Europe. The major indication that ehrlichiosis may play a role in Europe comes from serosurveys performed in several European countries including Sweden, Norway, Switzerland, and the United Kingdom (5, 7, 28). However, von Stedingk et al. (28) have recently detected Ehrlichia species in Swedish I. ricinus ticks, and Ehrlichia was also detected in a French I. ricinus tick (19). These findings indicate that Ehrlichia species that are pathogenic for humans may be present in Western Europe as well.
The clinical manifestations of HGE infection can vary from a flu-like disease to severe life-threatening acute febrile disease with thrombocytopenia, leukopenia, and elevated liver transaminase levels. Because of the diffuse nonspecific symptoms of this disease, diagnosis relies heavily on laboratory tests. Serology, particularly immunofluorescence, is commonly used, but serology often does not detect antibodies in the acute phase of disease. Culture of HGE is possible, but it is very labor intensive and has not been validated as far as sensitivity is concerned. Microscopic examination of stained blood smears can be used to detect characteristic enclosures in infected leukocytes. However, this method is insensitive and requires special expertise. The sensitivity and specificity of PCR for the detection of the Ehrlichia probably exceed those of the other methods. Several PCRs for detection of Ehrlichiaspecies have been described (1, 6, 9, 14); however, all of these assays enable the detection of just a single species. In this report we describe a PCR-hybridization assay that enables the simultaneous detection and species identification of a variety ofEhrlichia, B. burgdorferi, andBartonella species in a single sample. This method allowed us to screen a large number of Dutch tick samples for the presence of these tick-borne pathogens.

MATERIALS AND METHODS

Ticks and bacterial strains.

I. ricinus ticks were collected from infested roe deer (Capreolus capreolus) shot in the Flevopolder in The Netherlands, an area where roe deer are abundant (26). Immediately after collection, the ticks were immersed in 70% ethanol and stored. The four genomic groups ofB. burgdorferi sensu lato were represented by B. burgdorferi sensu stricto HB4, Borrelia garinii AR-1,Borrelia afzelii A39S, and Borrelia valaisianaM19. Crude DNA extracts from the following Ehrlichia species were used: E. phagocytophila (kindly provided by F. Jongejan) and HGE, Ehrlichia canis, and E. chaffeensis (kindly provided by S. Dumler). The twoBartonella species used in this study were Bartonella henselae ATCC 49882 and Bartonella quintana 90-268 (3).

Preparation of DNA extracts from ticks.

Ticks were processed as described before (10, 23). Briefly, the ticks were taken from the 70% ethanol solution, air dried, and boiled for 20 min in 100 μl of 0.7 M ammonium hydroxide to free the DNA. After cooling, the vial with the lysate was left open for 10 min at 90°C to evaporate the ammonia. The tick lysate either was used directly for PCR or was stored at −20°C until use.

PCR amplification.

PCR amplifications were performed in an Omnigene thermal cycler (Hybaid Ltd., Teddington, United Kingdom). DNA amplification was done in 50-μl reaction volumes. For the amplification of Ehrlichia DNA, each reaction mixture contained 10 pmol of primer 16S8FE and B-GA1B, 1.25 U of SuperTaq DNA polymerase (HT Biotechnology Ltd., Cambridge, United Kingdom), 0.275 μg of the TaqStart antibody (Clontech Laboratories, Palo Alto, Calif.), and standard amounts of amplification reagents (each deoxynucleoside triphosphate at a concentration of 200 μM, 10 mM Tris · HCl [pH 9.0], 50 mM KCl, 1.5 mM MgCl2, 0.01% gelatin, 0.1% Triton X-100). A 25-μl overlay of paraffin oil was added to the tubes, followed by the addition of 5 μl of the tick DNA extract. To minimize nonspecific amplification a touchdown PCR program was used: 3 min at 94°C, two cycles of 20 s at 94°C, 30 s at 67°C, and 30 s at 72°C, and then two cycles with conditions identical to the previous cycles but with an annealing temperature of 65°C. During subsequent two cycle sets the annealing temperature was lowered by 2°C until it reached 57°C. Then, an additional 40 cycles each consisting of 20 s at 94°C, 30 s at 57°C, and 20 s at 72°C, followed the touchdown program, were performed. The PCR was ended by an extra incubation for 7 min at 72°C. For the amplification of B. burgdorferi sensu lato DNA, conditions similar to those described above were used, except that 40 pmol of the primers 23SN2 and 5SCB and double the amounts of SuperTaq and TaqStart were used. In addition, the touchdown PCR temperature ranged from 60 to 50°C. For the amplification ofBartonella DNA, the previously described PCR protocol of Bergmans et al. (4) was used.
To monitor for the occurrence of false-positive PCR results, negative controls were included during extraction of the tick samples: one control sample for each six tick samples, with a minimum of two controls. In addition, each time that the PCR was performed, negative and positive control samples were included. In order to minimize contamination, the reagent setup, the extraction and sample addition, and the PCR and sample analysis were performed in three separate rooms, of which the first two rooms were kept at positive pressure and had airlocks.

Reverse line blot hybridization.

The reverse line blotting technique has been described before (11, 12, 25). Briefly, solutions with 5′ amino-linked oligonucleotide probes ranging from 10 to 800 pmol were coupled covalently to an activated Biodyne C membrane in a line pattern by using a miniblotter (Immunetics, Cambridge, Mass.). After binding of the oligonucleotide probes the membrane was taken from the miniblotter, washed in 2× SSPE (360 mM NaCl, 20 mM Na2HPO4 · H2O, 2 mM EDTA) with 0.1% sodium dodecyl sulfate (SDS) at 60°C, and again placed in the miniblotter with the oligonucleotide lines perpendicular to the slots. Ten microliters of the biotin-labeled PCR product was diluted in 150 μl of 2× SSPE–0.1% SDS, denatured for 10 min at 99°C, and cooled rapidly on ice. The slots of the miniblotter were filled with the denatured PCR product, and hybridization was performed for 1 h at 42°C. The membrane was removed from the miniblotter and was washed twice for 10 min each time in 2× SSPE–0.1% SDS at 51°C. Subsequently, the membrane was incubated for 30 min at 42°C with streptavidin-peroxidase (Boehringer Mannheim GmbH, Mannheim, Germany) diluted 1:4,000 in 2× SSPE–0.5% SDS and was washed twice for 10 min in 2× SSPE–0.5% SDS. Hybridization was visualized by incubating the membrane with enhanced chemiluminescence detection liquid (Amersham International plc, Den Bosch, The Netherlands) and exposing the membrane to X-ray film (Hyperfilm; Amersham). For species identification the biotinylated Ehrlichia PCR product was hybridized with seven different oligonucleotide probes in the reverse line blot assay. Similarly, the biotinylated spacer fragment of theBorrelia PCR was hybridized with five B. burgdorferi genospecies-specific oligonucleotide probes. For identification of Bartonella species a region between bases 964 and 1243 of the 16S rRNA gene was amplified and was used in a reverse line blot assay. All primers and probes are described in Table1.
Table 1.
Table 1. Oligonucleotide primers and probes used in PCR and hybridization assays
Oligonucleotide nameOligonucleotide sequenceaTarget organismTarget geneNucleotide positionReference
Primer
 5SCB5′-biotin-GAGAGTAGGTTATTGCCAGGGB. burgdorferi sensu lato23S-5S spacer243–26325
 23SN2ACCATAGACTCTTATTACTTTGACCAB. burgdorferi sensu lato23S-5S spacer469–44425
Probes
 SL5′-amino-CTTTGACCATATTTTTATCTTCCAB. burgdorferi sensu lato23S-5S spacer453–43025
 SS5′-amino-AACACCAATATTTAAAAAACATAAB. burgdorferisensu stricto23S-5S spacer322–29925
 GA5′-amino-AACATGAACATCTAAAAACATAAAB. garinii23S-5S spacer322–29825
 AF5′-amino-AACATTTAAAAAATAAATTCAAGGB. afzelii23S-5S spacer305–27825
 VS5′-amino-CATTAAAAAAATATAAAAAATAAATTTAAGGB. valaisiana23S-5S spacer303–27825
Primers
 16S8FEGGAATTCAGAGTTGGATCMTGGYTCAGEubacteria16S rRNA gene8–274
 16S1523RMCAGGAAACAGCTATGACCAAGGAGGTGATCCADCCVCAEubacteria16S rRNA gene1543–1523This study
 B-GA1B5′-biotin-CGGGATCCCGAGTTTGCCGGGACTTCTTCTEhrlichiagenus16S rRNA gene476–456This study
 GA1ICAGAAGAAGTCCCGGCAAACTCEhrlichiagenus16S rRNA gene456–476This study
Probes
 A-EhrAll5′-amino-TTATCGCTATTAGATGAGCCEhrlichiagenus16S rRNA gene203–222This study
 A-HGE5′-amino-GCTATAAAGAATAGTTAGTGGHGE16S rRNA gene87–107This study
 A-Phago5′-amino-TTGCTATAAAGAATAATTAGTGGE. phagocytophila16S rRNA gene85–107This study
 A-D-HGE5′-amino-GCTATGAAGAATAGTTAGTGHGE variant16S rRNA gene87–106This study
 A-D-Phago5′-amino-TTGCTATGAAGAATAATTAGTGE. phagocytophila variant16S rRNA gene87–106This study
 A-ESchot5′-amino-GCTGTAGTTTACTATGGGTAEhrlichia-like organism16S rRNA gene76–95This study
 A-ECan5′-amino-TCTGGCTATAGGAAATTGTTAE. canis16S rRNA gene85–105This study
 A-EChaf5′-amino-ACCTTTTGGTTATAAATAATTGTTAE. chaffeensis16S rRNA gene83–107This study
Primers
 P24EGGAATTCCCTCCTTCAGTTAGGCTGGBartonella16S rRNA gene966–98222
 P12BCGGGATCCCGAGATGGCTTTTGGAGATTABartonella16S rRNA gene1224–124322
Probes
 A-BartAll5′-amino-GTTGGGCACTCTARGGBartonellagenus16S rRNA gene1084–1099This study
 A-Hens5′-amino-TGCCAGCATTTGGTTGGB. henselae16S rRNA gene1072–1088This study
 A-Quin5′-amino-TTGCCATCATTAAGTTGGGB. quintana16S rRNA gene1071–1089This study
a
The underlined sequences represent theEcoRI and BamHI restriction sites. The double underlined sequence denotes the M13 sequence which was used for DNA sequencing.

DNA sequencing and data analysis.

The PCR products used for DNA sequencing were purified with Qiaquick PCR purification kits (Qiagen, Hilden, Germany). For DNA sequencing reactions, the fluorescence-labeled dideoxynucleotide technology was used (Perkin-Elmer, Applied Biosystems Division). The sequenced fragments were separated, and data were collected on an ABI 377 automated DNA sequencer (Perkin-Elmer, Applied Biosystems Division). The collected sequences were assembled, edited, and analyzed with the DNAStar package (DNAStar Inc., Madison, Wis.). The phylogenetic tree was constructed by using the Clustal analysis in the Megalign module of the DNAStar package.

Nucleotide sequence accession number.

The 16S rRNA gene sequence of the Ehrlichia-like organism found in this study is available in the GenBank database under accession no. AF104680 .

RESULTS

Sensitivity of the PCR for Ehrlichia andBorrelia.

The sensitivity of the PCR forEhrlichia and Borrelia was assessed by spiking the samples with known concentrations of previously produced PCR products. Extracts from ticks that were negative by previous PCRs were spiked with serial dilutions of E. phagocytophila orB. burgdorferi PCR products. All experiments were performed in duplicate. Repeatedly, the detection limit for both assays in which the PCR yielded a positive result was five copies of the target sequence (data not shown). The detection limit of the PCR forBartonella has been determined in another study and was shown to correspond to one genome copy (4).

Specificity of the reverse line blot hybridization.

A reverse line blot hybridization assay was designed to differentiate the variousEhrlichia, B. burgdorferi, andBartonella species. Some of the Ehrlichia species differ by only one nucleotide in the target sequence (Fig.1). The oligonucleotide probes were designed in such a way that the melting temperature of all oligonucleotides was approximately 55°C under the conditions used. As a result the oligonucleotide probes differ in length. In order to obtain specific and sensitive signals in the assay the optimal oligonucleotide probe concentrations and hybridization conditions were determined empirically. To assess the specificity of the assay, control samples were amplified and used in the reverse line blot hybridization assay under stringent hybridization conditions. Figure2 shows the reactivities of the control samples for Ehrlichia, B. burgdorferi, andBartonella species in the optimized reverse line blot assay. No cross-hybridization between the various species occurred, indicating that the system distinguished target sequences that differed by only a single base pair.
Fig. 1.
Fig. 1. Multiple alignment of the variable part of the 16S rRNA gene sequences of the E. phagocytophila group. The region where differences were detected is shown for E. phagocytophila, E. equi, HGE, and the variants ofE. phagocytophila and HGE. The positions of the residues that differ in the 16S rRNA gene are shown below the multiple alignment. Residues identical to those of the E. phagocytophila sequence are indicated by a dot. The sequence ofE. equi was obtained from GenBank (accession no. M73223 ). The 500 bp of the 5′ end of the 16S rRNA gene sequences of E. phagocytophila and HGE were determined in this study and compared with the sequences in the GenBank and EMBL database and were found to be identical to published sequences (accession nos. M73320 and U02521, respectively). The 16S rRNA sequences of the E. phagocytophila variant and the HGE variant were determined in this study.
Fig. 2.
Fig. 2. Reverse line blot hybridization assay analyses for the detection and identification of Ehrlichia, B. burgdorferi, and Bartonella spp. in ticks. (A) Membrane carrying Ehrlichia-specific oligonucleotide probes; (B) membrane carrying B. burgdorferi genospecies-specific probes; (C) combined membrane carrying probes for Ehrlichia,B. burgdorferi, and Bartonella species. The oligonucleotide probes are attached to the membrane in the horizontal direction, and the PCR samples were applied perpendicularly in the vertical direction. The numbered lanes represent tick-derived PCR products, and the lanes marked with letters show the PCR products obtained from the positive control samples. El,Ehrlichia-like; Eca, E. canis; Ech, E. chaffeensis; Epv, E. phagocytophila variant; Hv, HGE variant; Ep, E. phagocytophila; H, HGE; Bs, B. burgdorferi sensu stricto; Bg, B. garinii; Ba, B. afzelii; Bv, B. valaisiana; Bh, B. henselae; Bq, B. quintana.

PCR detection of Ehrlichia, Borrelia, andBartonella DNAs in ticks.

The various PCRs were applied to DNA extracts from 121 I. ricinus ticks collected from 38 different roe deer. The majority of the ticks were adults, mainly females; and some were nonengorged, some were semiengorged, and some were fully engorged (Table 2). Regardless of whether these PCRs yielded a visible fragment on agarose gels, all samples were analyzed by the reverse line blot assay. Fifty-four of the 121 samples (45%) reacted with one or more of theEhrlichia-specific probes (Table 2). Of these, 3 reacted with the HGE-specific probe, 3 reacted with the E. phagocytophila-specific probe, 11 reacted with the HGE variant-specific probe, 9 reacted with the E. phagocytophilavariant-specific probe, and 7 reacted with both the HGE variant-specific and the E. phagocytophila variant-specific probes. In addition, 19 of the samples reacted solely with theEhrlichia genus-specific probe. Sixteen of the same 121 tick samples (13%) reacted in the Borrelia PCR hybridization assay with the B. burgdorferi species-specific probes (Table2). Coinfection with two different B. burgdorferigenospecies was detected in four tick samples. None of the ticks analyzed was infected solely with B. garinii or withB. burgdorferi sensu stricto. However, these genospecies were found in ticks coinfected with different genospecies.
Table 2.
Table 2. Results of reverse line blot assay analysis of PCR products obtained from 121 ticks with Ehrlichia-specific andBorrelia-specific oligonucleotide probes
Sex and stageNo. of ticksNo. of ticks containing the followinga:
EhrlichiaspeciesBorrelia species
EhrlichiaHGEE.phagoHGEvarE.phagovarEhr-likeHGE + E.phagovarHGEvar + E.phagovarHGEvar + Ehr-likeB. burgdorferi sensu latoB. afzeliiB. valaisianaB. afzelii + B. valaisianaB. afzelii + B. gariniiB. burgdorferi sensu stricto + B. garinii
Nymph110        11
Male2613 134   11  1
Female
 Nonengorged2110  511 1 412 1
 Semiengorged248  113 2 42 1 1
 Engorged39233223414 651
Total121543311981711693211
a
E.phago, E. phagocytophila; E.phagovar, E. phagocytophila variant, HGEvar, HGE variant; Ehr-like, Ehrlichia-like organism.
The 121 ticks were collected from 38 roe deer, which implies that several ticks originated from the same animal. The distribution of theEhrlichia and Borrelia species found in the ticks and their origins are displayed in Table3. These results indicate that ticks collected from the same roe deer carried a variety ofEhrlichia and Borrelia species. This suggests that these bacterial species did not originate from the roe deer only but must have been taken up by the ticks during previous feeds on other animals.
Table 3.
Table 3. Origin of ticks and distribution of Ehrlichiaand Borrelia species in the ticks
Deer no.No. of ticksNo. of ticks containing the followingEhrlichia and Borreliaspeciesa:
EhrlichiaHGEE.phHGEvarE.phvarEhr-likeHGE + E.phHGEvar + E.phvarHGEvar + Ehr-likeEhr-UnspecB. burgdorferi.slB.afB.vaB.af + B.vaB.af + B.gaB.ss + B.ga
7581811 12 5   3321
76820         0
77010         0
775862  3 1   0
77832   2     3111
78342  11     0
78420         0
78730         11
79020         0
79110         0
79220         0
79511    1    0
79630         0
79810         0
79931    1    1   1
80020         0
801421       111
80420         11
80511        10
80911    1    0
81020         0
81220         11
81330         0
81420         0
81510         0
81632 1      10
81776 1 2    30
82321  1      0
82421  1      0
82520         0
82711  1      0
82920         0
83152      1 11 1
83222  2      0
83786  31  1 11 1
840106      51 211
86510         11
AA20         0
Total12154331198171111693211
a
E.ph, E. phagocytophila; HGEvar, HGE variant; E.phvar, E. phagocytophila variant, Ehr-like, Ehrlichia-like organism; Ehr-Unspec,Ehrlichia-like organism but the species was not determined; sl, sensu lato; B.af, B. afzelii; B.va, B. valaisiana; B.ga, B. garinii; B.ss, B. burgdorferi sensu stricto.
Five of the tick samples carried various Ehrlichia andB. burgdorferi species, indicating the occurrence of coinfection with these two pathogens (Table4). Hybridization of theBartonella PCR products yielded hybridization signals with the Bartonella genus-specific probe in 73 of the 121 samples (60%). However, none of these PCR products reacted with either theB. henselae-specific or the B. quintana-specific oligonucleotide probes.
Table 4.
Table 4. Combinations of Ehrlichia andBorrelia species found in ticks
Deer no.Ehrlichia speciesBorreliaspecies
778E. phagocytophila-variantB. afzelii + B. garinii
778E. phagocytophila-variantB. afzelii + B. valaisiana
837HGE variantB. valaisiana
840E. phagocytophila-variant + HGE variantB. valaisiana
840Ehrlichia-like spp. without species determinationB. afzelii

DNA sequence analysis.

In order to confirm the results obtained by the reverse line blot assay, 15 of theEhrlichia-positive samples were also analyzed by DNA sequencing. Sequencing of the PCR product obtained by PCR forEhrlichia revealed that we had correctly identified the various species by the reverse line blot hybridization assay. Furthermore, sequence analysis of the samples that reacted with both the HGE variant-specific and the E. phagocytophilavariant-specific probes revealed an ambiguous nucleotide at position 100 in the 16S rRNA gene. Cloning of these PCR products and subsequent reverse line blot assay analysis and DNA sequencing of the clones revealed the presence of two types of cloned 16S sequences, indicating that these tick samples indeed carried a mixture of two differentEhrlichia sequences.
Nineteen of the PCR products obtained by the PCR forEhrlichia reacted with the Ehrlichiagenus-specific probe only. To determine the phylogenetic positions of these Ehrlichia-like organisms, the complete 16S rRNA gene sequences of three of these samples were determined. For this purpose two PCR fragments from each tick sample were generated and sequenced. The first PCR fragment covered bases 8 through 476 and was amplified with primer set 16S8FE and B-GA1B. The second fragment was generated by PCR with oligonucleotides A-EhrAll and 16S1523R and covered the region from positions 203 through 1543 of the 16S rRNA gene. The 16S sequences of these three samples were identical, and comparison with the DNA sequences in the GenBank data bank revealed that this 16S rRNA gene sequence differed markedly from all other publishedEhrlichia sequences. The most closely related 16S rRNA gene sequences were those of Cowdria ruminantium (96% similarity) and those of members of the monocytic Ehrlichiagroup (Fig. 3). For this reason we designate this species Ehrlichia-like.
Fig. 3.
Fig. 3. Dendrogram showing the phylogenetic relationships of the 16S rRNA gene sequences of the newly identifiedEhrlichia-like and those of other rickettsiae. The tree was constructed by comparing sequences of the segment of the 16S rRNA gene ranging from bases 40 to 1434 (E. phagocytophilacoordinates). The scale beneath the tree measures the distance between sequences expressed as the number of substitution events. The sequences used for comparison were obtained from the GenBank and EMBL database.
On the basis of the sequence analysis, a new probe (A-Eschot) specific for this Ehrlichia-like organism was designed for use in the reverse line blot assay and was used to screen the products obtained from the tick samples by PCR for Ehrlichia. Hybridization showed that of the 19 samples that initially reacted with theEhrlichia genus-specific probe only, 8 reacted with the newly designed probe. Only one of the otherEhrlichia-positive samples reacted with this probe; this comprised a tick sample which reacted with both the E. phagocytophila variant-specific probe and the newly designed probe. As a result, the species infecting 11 of the samples that reacted with the Ehrlichia genus-specific probe remained undetermined.
Sequencing of 11 of the products obtained by PCR forBartonella revealed that none represented B. henselae or B. quintana but closely resembledBartonella vinsonii. However, the region of the 16S rRNA gene that was used for the PCR for Bartonella does not carry enough variation to reliably distinguish B. vinsoni from other closely related Bartonella and Rhizobiumspecies.

DISCUSSION

We developed a PCR-based reverse line blot hybridization assay in which Ehrlichia, B. burgdorferi, andBartonella species can be detected and differentiated. The assay was specific enough to detect single-base-pair changes with immobilized oligonucleotide probes and enabled us to differentiateEhrlichia variants. The reverse line blot technique is a relatively easy and rapid method for the simultaneous detection and identification of microorganisms in field samples such as ticks. In its present form we can combine the hybridization of PCR products obtained in separate PCRs. We are now developing a multiplex PCR that will enable us to have an even more convenient method for the screening of samples. These samples could be tick lysates but could also be other material such as blood from patients suffering from a febrile disease with an unknown origin.
In the study presented here we used this method to detect and identifyEhrlichia and B. burgdorferi species in DutchI. ricinus ticks. Analysis of the ticks showed an unexpected high rate of infection with Ehrlichia species (45%). The high infection rate may be partly due to the fact that the ticks originated from roe deer, which may serve as a reservoir forEhrlichia. However, there was no significant correlation between sex and engorgement of the ticks and infection withEhrlichia species. In addition, ticks collected from the same roe deer carried a variety of Ehrlichia andBorrelia species. This suggests that the ticks may have been infected before feeding on the roe deer and that theEhrlichia spp. originated from other reservoirs. In order to get a more accurate impression of the prevalence ofEhrlichia infection in Dutch ticks, we are now analyzing a large number of ticks collected from the vegetation. Whatever the reservoir may be, the results obtained in this survey suggest that Dutch ticks may pose a serious health threat to both humans and animals and should be used to warn clinicians to be aware of the possible presence of ehrlichiosis in The Netherlands.
The majority of the Ehrlichia species found in this study belong to the E. phagocytophila group. As expected, neitherE. canis nor E. chaffeensis was found in any of the ticks. Analysis of PCR products revealed that the 16S rRNA gene sequences of the E. phagocytophila group showed slight variations. In total, four types of E. phagocytophila-like sequences were found: species with the E. phagocytophila or the HGE 16S rRNA gene sequences and two variants of these sequences that carried a substitution of a single base pair at position 92 of the 16S rRNA gene. This corroborates the findings of a Swedish group (28) and a group from the United States (2) that also found Ehrlichia species in which the A at position 92 of the 16S gene was substituted by a G. It remains to be determined whether the 16S rRNA variants represent different Ehrlichiaspecies. It is possible that the HGE agent, E. phagocytophila, and the variants found in this study all belong to the same species and should be designated E. phagocytophilasubspecies. Furthermore, it is unclear whether these variants can cause disease in humans or animals. It was remarkable that in none of the samples of the E. phagocytophila group from which the 16S rRNA gene sequences were determined was a C found at position 49 in the 16S rRNA gene. The presence of a C at this position may be characteristic for E. equi. This would corroborate earlier observations that E. equi was not found in Europe.
More than 6% of the ticks were infected with anEhrlichia-like organism not described before. This organism is closely related to but clearly distinct from the monocytic group ofEhrlichia species and C. ruminantium. It is unclear whether this organism can cause disease in mammals, but experimental infection of animals may confirm its infectious nature. The newly identified organism may represent an endosymbiont. Examples of such endosymbionts in ticks are the Francisella andWolbachia species, which are found at high rates in particular tick species (16-18). However, the relatively low frequency of infection of the ticks would argue against this hypothesis.
Analysis of the 121 ticks showed that 13% of the ticks carriedB. burgdorferi species and confirmed earlier findings that 10 to 35% of the Dutch I. ricinus ticks are infected withB. burgdorferi genospecies (24). Interestingly, 5 of the 121 ticks were coinfected with Ehrlichia and two genospecies of B. burgdorferi. Due to its immunosuppressive nature, coinfection with Ehrlichia and B. burgdorferi may increase the severity of Lyme borreliosis.
Transmission of Bartonella species by ticks is speculative. However, at least one study reports on three patients with B. henselae bacteremia. These patients had no history of contact with cats but sustained tick bites prior to the bacteremia (13). From the study presented here it is clear that a large proportion of the ticks carry Bartonella species or species closely related to Bartonella but not the human pathogens B. henselae and B. quintana. The Bartonellaspecies found might originate from small rodents on which the ticks may have been feeding. This could indicate that transmission ofBartonella species between rodents is, at least in some part, tick mediated. Further studies with other arthropods such as body lice and perhaps also blood from rodents such as rats may disclose the reservoirs and vectors for B. quintana.
Until now there have been no reports of ehrlichiosis in Dutch patients. Therefore, the high rate of infection of Dutch ticks withEhrlichia species raises the question of whether human ehrlichiosis does occur in The Netherlands. It is known thatEhrlichia species cause infections in cattle, sheep, and dogs in Europe. However, until now there have been very few reports on human ehrlichiosis in Europe (15, 20, 27). In fact, only recently was the first case of granulocytic ehrlichiosis infection reported, and that was in Slovenia (20). Although the seroprevalence in several European serosurveys suggest that infections with Ehrlichia do occur in Europe, there seems to be a paucity of reported cases. There may be several explanations for this phenomenon. First, it is possible that there really are very few cases of human ehrlichiosis. Second, the majority of cases may go unnoted because they are caused by less virulent variants of HGE that result in a mild course of disease. Finally, cases of ehrlichiosis may remain unnoted because clinicians do not recognize the disease. Relatively few clinicians know that the disease exists and therefore cannot make the correct diagnosis. Furthermore, the tools used to diagnose ehrlichiosis are usually lacking. Very few laboratories in The Netherlands are equipped to perform serology studies for Ehrlichia, and PCR is performed in none of these laboratories. Therefore, at least in The Netherlands, ehrlichiosis may have been overlooked. Recently, a Swedish group reported on three PCR-confirmed cases of HGE infection in humans (PROMED file 980418193622). Two of the three patients were seronegative, which forewarns us that serology may not suffice for the diagnosis of ehrlichiosis. The patients showed a variety of clinical symptoms, of which only fever and headache were seen in all three patients. Remarkably, the initial diagnosis for one of the patients was neuroborreliosis, and the patient was treated for this condition. These findings indicate that HGE infections do occur in Europe and suggest that there may indeed be an underdiagnosis of ehrlichiosis and that surveillance is required to determine the true extent of the problem.

REFERENCES

1.
Anderson B. E., Dawson J. E., Jones D. C., and Wilson K. H. Ehrlichia chaffeensis, a new species associated with human ehrlichiosis.J. Clin. Microbiol.2919912838-2842
2.
Belongia E. A., Reed K. D., Mitchell P. D., Kolbert C. P., Persing D. H., Gill J. S., and Kazmierczak J. J. Prevalence of granulocytic Ehrlichia infection among white-tailed deer in Wisconsin.J. Clin. Microbiol.3519971465-1468
3.
Bergmans A. M. C., Schellekens J. F. P., Vanembden J. D. A., and Schouls L. M. Predominance of two Bartonella henselae variants among cat-scratch disease patients in The Netherlands.J. Clin. Microbiol.341996254-260
4.
Bergmans A. M., Groothedde J. W., Schellekens J. F., van Embden J. D., Ossewaarde J. M., and Schouls L. M. Etiology of cat scratch disease: comparison of polymerase chain reaction detection of Bartonella (formerly Rochalimaea) and Afipia felis DNA with serology and skin tests.J. Infect. Dis.1711995916-923
5.
Brouqui P., Dumler J. S., Lienhard R., Brossard M., and Raoult D. Human granulocytic ehrlichiosis in Europe.Lancet3461995782-783
6.
Chen S. M., Dumler J. S., Bakken J. S., and Walker D. H. Identification of a granulocytotropic Ehrlichia species as the etiologic agent of human disease.J. Clin. Microbiol.321994589-595
7.
de Mik E. L., van Pelt W., Docters van Leeuwen B., van der Veen A., Schellekens J. F. P., and Borgdorff M. W. The geographic distribution of tick bites and erythema migrans in general practice in The Netherlands.Int. J. Epidemiol.261997451-457
8.
Dumler J. S., Dotevall L., Gustafson R., and Granstrom M. A population-based seroepidemiologic study of human granulocytic ehrlichiosis and Lyme borreliosis on the west coast of Sweden.J. Infect. Dis.1751997720-722
9.
Everett E. D., Evans K. A., Henry R. B., and McDonald G. Human ehrlichiosis in adults after tick exposure. Diagnosis using polymerase chain reaction.Ann. Intern. Med.1201994730-735
10.
Guy E. C. and Stanek G. Detection of Borrelia burgdorferi in patients with Lyme disease by the polymerase chain reaction.J. Clin. Pathol.441991610-611
11.
Kamerbeek J., Schouls L., Kolk A., Van Agterveld M., Van Soolingen D., Kuijper S., Bunschoten A., Molhuizen H., Shaw R., Goyal M., and Van Embden J. Simultaneous detection and strain differentiation of Mycobacterium tuberculosis for diagnosis and epidemiology.J. Clin. Microbiol.351997907-914
12.
Kaufhold A., Podbielski A., Baumgarten G., Blokpoel M., Top J., and Schouls L. Rapid typing of group A streptococci by the use of DNA amplification and non-radioactive allele-specific oligonucleotide probes.FEMS Microbiol. Lett.119199419-25
13.
Lucey D., Dolan M. J., Moss C. W., Garcia M., Hollis D. G., Wegner S., Morgan G., Almeida R., Leong D., Greisen K. S., Welch D. F., and Slater L. N. Relapsing illness due to Rochalimaea henselae in immunocompetent hosts: implication for therapy and new epidemiological associations.Clin. Infect. Dis.141992683-688
14.
Massung R. F., Slater K., Owens J. H., Nicholson W. L., Mather T. N., Solberg V. B., and Olson J. G. Nested PCR assay for detection of granulocytic ehrlichiae.J. Clin. Microbiol.3619981090-1095
15.
Morais J. D., Dawson J. E., Greene C., Filipe A. R., Galhardas L. C., and Bacellar F. First European case of ehrlichiosis.Lancet3381991633-634
16.
Niebylski M. L., Peacock M. G., Fischer E. R., Porcella S. F., and Schwan T. G. Characterization of an endosymbiont infecting wood ticks, Dermacentor andersoni, as a member of the genus Francisella.Appl. Environ. Microbiol.6319973933-3940
17.
Niebylski M. L., Schrumpf M. E., Burgdorfer W., Fischer E. R., Gage K. L., and Schwan T. G. Rickettsia peacockii sp. nov., a new species infecting wood ticks, Dermacentor andersoni, in western Montana.Int. J. Syst. Bacteriol.471997446-452
18.
Noda H., Munderloh U. G., and Kurtti T. J. Endosymbionts of ticks and their relationship to Wolbachia spp. and tick-borne pathogens of humans and animals.Appl. Environ. Microbiol.6319973926-3932
19.
Parola P., Beati L., Cambon M., Brouqui P., and Raoult D. Ehrlichial DNA amplified from Ixodes ricinus (Acari: Ixodidae) in France.J. Med. Entomol.351998180-183
20.
Petrovec M., Furlan S. L., Zupanc T. A., Strle F., Brouqui P., Roux V., and Dumler J. S. Human disease in Europe caused by a granulocytic Ehrlichia species.J. Clin. Microbiol.3519971556-1559
21.
Pierard D., Levtchenko E., Dawson J. E., and Lauwers S. Ehrlichiosis in Belgium.Lancet34619951233-1234
22.
Relman D. A., Loutit J. S., Schmidt T. M., Falkow S., and Tompkins L. S. The agent of bacillary angiomatosis. An approach to the identification of uncultured pathogens.N. Engl. J. Med.32319901573-1580
23.
Rijpkema S., Golubic D., Molkenboer M., Verbeek De Kruif N., and Schellekens J. Identification of four genomic groups of Borrelia burgdorferi sensu lato in Ixodes ricinus ticks collected in a Lyme borreliosis endemic region of northern Croatia.Exp. Appl. Acarol.20199623-30
24.
Rijpkema S., Nieuwenhuijs J., Franssen F. F., and Jongejan F. Infection rates of Borrelia burgdorferi in different instars of Ixodes ricinus ticks from the Dutch North Sea Island of Ameland.Exp. Appl. Acarol.181994531-542
25.
Rijpkema S. G., Molkenboer M. J., Schouls L. M., Jongejan F., and Schellekens J. F. Simultaneous detection and genotyping of three genomic groups of Borrelia burgdorferi sensu lato in Dutch Ixodes ricinus ticks by characterization of the amplified intergenic spacer region between 5S and 23S rRNA genes.J. Clin. Microbiol.3319953091-3095
26.
Rijpkema S. G. T., Herbes R. G., Verbeekdekruif N., and Schellekens J. F. P. Detection of four species of Borrelia burgdorferi sensu lato in Ixodes ricinus ticks collected from roe deer (Capreolus capreolus) in The Netherlands.Epidemiol. Infect.1171996563-566
27.
Sumption K. J., Wright D. J., Cutler S. J., and Dale B. A. Human ehrlichiosis in the UK.Lancet34619951487-1488
28.
von Stedingk L. V., Gurtelschmid M., Hanson H. S., Gustafson R., Dotevall L., Engval E. O., and Granstrom M. The human granulocytic ehrlichiosis (HGE) agent in Swedish ticks.Clin. Microbiol. Infect.31997573-574

Information & Contributors

Information

Published In

cover image Journal of Clinical Microbiology
Journal of Clinical Microbiology
Volume 37Number 71 July 1999
Pages: 2215 - 2222
PubMed: 10364588

History

Received: 14 December 1998
Returned for modification: 8 March 1999
Accepted: 6 April 1999
Published online: 1 July 1999

Permissions

Request permissions for this article.

Contributors

Authors

Leo M. Schouls
Research Laboratory for Infectious Diseases, National Institute of Public Health and the Environment, Bilthoven, The Netherlands
Ingrid Van De Pol
Research Laboratory for Infectious Diseases, National Institute of Public Health and the Environment, Bilthoven, The Netherlands
Sjoerd G. T. Rijpkema
Research Laboratory for Infectious Diseases, National Institute of Public Health and the Environment, Bilthoven, The Netherlands
Present address: Division of Bacteriology, National Institute of Biological Standards and Control, Potters Bar, EN6 3QG United Kingdom.
Corrie S. Schot
Research Laboratory for Infectious Diseases, National Institute of Public Health and the Environment, Bilthoven, The Netherlands

Metrics & Citations

Metrics

Note:

  • For recently published articles, the TOTAL download count will appear as zero until a new month starts.
  • There is a 3- to 4-day delay in article usage, so article usage will not appear immediately after publication.
  • Citation counts come from the Crossref Cited by service.

Citations

If you have the appropriate software installed, you can download article citation data to the citation manager of your choice. For an editable text file, please select Medlars format which will download as a .txt file. Simply select your manager software from the list below and click Download.

View Options

Figures and Media

Figures

Media

Tables

Share

Share

Share the article link

Share with email

Email a colleague

Share on social media

American Society for Microbiology ("ASM") is committed to maintaining your confidence and trust with respect to the information we collect from you on websites owned and operated by ASM ("ASM Web Sites") and other sources. This Privacy Policy sets forth the information we collect about you, how we use this information and the choices you have about how we use such information.
FIND OUT MORE about the privacy policy