Research Article
July 2012

Recombinase Polymerase Amplification Assay for Rapid Detection of Francisella tularensis

ABSTRACT

Several real-time PCR approaches to develop field detection for Francisella tularensis, the infectious agent causing tularemia, have been explored. We report the development of a novel qualitative real-time isothermal recombinase polymerase amplification (RPA) assay for use on a small ESEQuant Tube Scanner device. The analytical sensitivity and specificity were tested using a plasmid standard and DNA extracts from infected rabbit tissues. The assay showed a performance comparable to real-time PCR but reduced the assay time to 10 min. The rapid RPA method has great application potential for field use or point-of-care diagnostics.

INTRODUCTION

Because of its extraordinary infectiousness, the zoonotic pathogen Francisella tularensis causing tularemia was in the past the subject of state-run biowarfare research programs and therefore is included on the CDC category A list of biothreat agents. It causes disease in a vast range of animals, with relevant disease transmission to humans by direct contact or via vectors such as deer flies, horse flies, mosquitoes, and hard ticks. Infection due to inhalation of aerosols can occur through contact with infected hares. There are three F. tularensis subspecies, F. tularensis subsp. tularensis, F. tularensis subsp. holarctica, and F. tularensis subsp. mediasiatica, which can be found in several environments and geographical regions. The first two subspecies and Francisella novicida cause the bulk of human infections (7, 19). Infection by Francisella hispaniensis has also been described, and results of phylogenetic analysis suggest that F. novicida should be regrouped as a fourth subspecies of F. tularensis (3, 12).
In all scenarios dealing with intentional release of biothreat agents, timely diagnosis is regarded as essential to identifying and containing outbreaks of infectious disease (4). Many efforts have been made to reduce the assay time of PCR-based nucleic acid detection. In spite of engineering constraints regarding temperature cycling needed for the PCR assays, short protocols and miniaturized cyclers or chip platforms are being developed (5, 6, 18).
In recent years a variety of isothermal amplification methods have been developed which offer the possibility of developing even simpler point-of-care systems. One example is the ESEQuant Tube Scanner device (Qiagen Lake Constance GmbH, Stockach, Germany). This device contains a sophisticated fluorescence sensor which slides back and forth under a set of eight tubes, collecting fluorescence signals over time and allowing for real-time documentation of increasing fluorescence signals. A combined threshold and signal slope analysis is used for signal interpretation, which can be confirmed by second-derivative analysis (11; also ESEQuant Tube Scanner software [Qiagen]). The recombinase polymerase amplification (RPA) assay is an isothermal amplification method which can be combined with a sequence-specific fluorescent probe for real-time detection. In RPA the phage-derived recombinase UvsX, assisted by its cofactor UvsY, aggregates with oligonucleotide primers to scan for homologous sequences in a DNA template. Upon identifying the specific homologous sequence, strand invasion and consequent strand displacement amplification via Sau polymerase (Staphylococcus aureus) starting from opposite primers generate amplified double-stranded DNA (dsDNA) copies in a similar way as PCR. The real-time probe format used is a probe (TwistAmp exo Probe) with a longer upstream stretch (30 nucleotides [nt]) carrying the fluorophore at its 3′ end, which is connected via a tetrahydrofuran (THF) spacer (dTFAM-THF-dTQuencher; FAM is 6-carboxyfluorescein) to an adjacent downstream smaller oligonucleotide (15 nt) carrying a 5′ quencher. Upon binding to the complementary sequence, an exonuclease recognizes the double-strand hybridization complex and cuts the spacer, leading the smaller quencher probe to dissociate and thus allowing for real-time fluorescence development on the longer probe hybridized to the accumulating amplified copies (20). Here, we describe the development of a real-time RPA on an ESEQuant tube scanner device for the detection of F. tularensis.

MATERIALS AND METHODS

Preparation of F. tularensis genomic DNA and DNA from hare samples.

Francisella strains (Table 1) were grown in chocolate agar supplemented with IsoVitaleX (Becton, Dickinson, Madrid, Spain) and l-cysteine (Sigma-Aldrich Quimica SA, Madrid, Spain). Plates were incubated for 48 h at 37°C in an atmosphere with 5% CO2. Colonies were resuspended in 200 μl of phosphate-buffered saline (PBS), and genomic DNA was extracted and purified with a QIAamp DNA minikit (Izasa S.A., Barcelona, Spain), following the instructions of the manufacturer. DNA was quantified by spectrophotometry with a Nano-Drop ND-1000 spectrophotometer (Nucliber, Madrid, Spain). DNA from naturally infected hare tissues was prepared in a biosafety level 3 (BSL-3) laboratory as follows. Snippets of hare tissue were homogenized in a pestle and incubated at 56°C overnight in 180 μl of the kit's ALT buffer (QIAamp DNA Kit Mini) and 20 μl of protease. DNA was subsequently extracted using the tissue protocol of the QIAamp DNA blood kit (Qiagen, Hilden, Germany) as recommended by the manufacturer.
Table 1
Table 1 Bacterial strains tested
StrainaSpeciesbRPA detection
LVSF. tularensis subsp. holarctica+
FT 7F. tularensis subsp. holarctica+
FT 10F. tularensis subsp. holarctica+
B38F. tularensis subsp. tularensis+
DuBa-1F. tularensis subsp. tularensis+
FHSPF. hispaniensis+
FX 1F. novicida+
FX 2F. novicida+
U112F. novicida+
CCUG4992F. philomiragia
03-1501Y. pestis
ATCC 55075Y. enterocolitica
ATCC 9610Y. enterocolitica
ATCC 29833Y. pseudotuberculosis
3007B. anthracis
ATCC 12759B. licheniformis
ATCC 6633B. subtilis
DSM 2046B. thuringiensis
ATCC 14581B. megaterium
DSM 299B. mycoides
ATCC 31325B. polymyxa
ATCC 53522B. cereus
DSM 9378B. cereus
DSM 6127B. cereus
DSM 31B. cereus
DSM 345B. cereus
DSM 487B. cereus
DSM 609B. cereus
DSM 626B. cereus
DSM 4490B. cereus
DSM 6791B. cereus
a
Genomic DNA of the strains was provided as follows: †, Laboratorio de Espiroquetas y Patógenos Especiales, Servicio de Bacteriología, Centro Nacional de Microbiología, Instituto de Salud Carlos III, Majadahonda, Madrid, Spain; ‡, Institute for Microbiology of the German Armed Forces. All other strains were provided by the Institute of Bacterial Infections and Zoonoses of the Federal Research Center for Animal Health. DNA concentrations of the DNA preparations ranged from 114,47 ng/μl to 563,59 ng/μl.
b
Y. pestis, Yersinia pestis; Y. enterocolitica, Yersinia enterocolitica; Y. pseudotuberculosis, Yersinia pseudotuberculosis; B. anthracis, Bacillus anthracis; B. licheniformis, Bacillus licheniformis; B. subtilis, Bacillus subtilis; B. thuringiensis, Bacillus thuringiensis; B. megaterium, Bacillus megaterium; B. mycoides, Bacillus mycoides; B. polymyxa, Bacillus polymyxa; B. cereus, Bacillus cereus.

Plasmid DNA standard and real-time PCR.

The tul4 gene was amplified using the primers FTUL UP/DP (Table 2) and the genomic DNA of F. tularensis strain DuBa-1 using the following PCR protocol. The reaction mixture (50 μl) contained 30 ng of DNA, 200 nM each primer, 200 μM each deoxynucleoside triphosphate (dNTP), 1U of Taq polymerase, and 1× Taq buffer (5 Prime, Hamburg, Germany). The temperature profile consisted of activation at 95°C for 1 min followed by 30 cycles of PCR at 95°C for 1 min, 60°C for 1 min, and 68°C for 1 min. The PCR product was ligated into pCRII and transformed into One Shot INVαF′ chemically competent E. coli cells (Invitrogen, Darmstadt, Germany). The plasmid was prepared, sequenced, and quantified using a PicoGreen reagent kit (Invitrogen, Darmstadt, Germany) as previously described (29). The standard was tested using real-time PCR for the tul4 gene as described previously (8). The rabbit samples were additionally tested with a second real-time PCR for the 23-kDa protein gene (16). The real-time PCR assays were performed on a LightCycler, version 2.0, using a FastStart TaqMan Probe Master Kit (Roche, Manheim, Germany) and the second-derivative method for analysis; the assays showed the same sensitivities as reported in the original publications.
Table 2
Table 2 Primers for the plasmid standard and for RPA
NameaSequence (5′–3′)
FTUL UPTTATCTTTATCAATCGCAGGTTTAGC
FTUL DPGGTTGGTGCACATGGCTAAGT
FT RPA FPCACAAGGAAGTGTAAGATTACAATGGCAGGCTCC
FT RPA RPCGCTACAGAAGTTATTACCTTGCTTAACTGTTA
FT RPA PGTGCCATGATACAAGCTTCCCAATTACTAAG(BHQ1-dT)(THF)(FAMdT)GCTGAGAAGAACGATA(phosphate)b
a
FTUL UP/DP, standard fragment upstream primer/downstream primer; FT RPA FP/RP, RPA forward and reverse primers; FT RPA P, RPA exo probe.
b
BHQ1-dT, thymidine nucleotide carrying Black Hole Quencher 1; THF, tetrahydrofuran spacer; FAM-dT, thymidine nucleotide carrying fluorescein; phosphate, 3′ phosphate to block elongation.

Real-time RPA amplicon design.

The RPA amplicon for the detection of the tul4 gene of F. tularensis was designed using the following available GenBank sequences: M32059, EF208970 to EF208977, and EF208979. In reference to sequence M32059 (tul4 from nt 551 to 1000), the RPA amplicon was placed between nt 792 and 936 (length, 144 nt). The RPA probe was synthesized by TIB Molbiol (Berlin, Germany) using an inverse arrangement of fluorophore and quencher (dTBHQ1-THF-dTFAM).

RPA conditions.

RPA was performed in a 50-μl volume using a TwistAmp exo kit (TwistDX, Cambridge, United Kingdom), 420 nM each RPA primer, 120 nM FAM-tagged RPA probe, 14 mM Mg acetate, and 1× rehydration buffer. All reagents except for the template or sample DNA and Mg acetate were prepared in a master mix, which was distributed into each 0.2-ml reaction tube containing a dried enzyme pellet. Mg acetate was pipetted into the tube lids. Subsequently, 1 μl of standard DNA or genomic DNA or 10 μl of DNA eluate extracted from rabbit tissues was added to the tubes. The lids were closed, the Mg acetate was centrifuged into the tubes using a minispin centrifuge, and the tubes were immediately placed into a ESEQuant Tube Scanner device (Qiagen Lake Constance, Stockach, Germany). Fluorescence measurements (excitation, 470 nm; detection, 520 nm [FAM channel]) were performed at 42°C for 20 min. This reaction temperature was found to yield the best performance in terms of sensitivity in a range tested from 39°C to 42°C. The tube scanner software offers threshold validation, i.e., evaluation of fluorescence by increase of fluorescence above three standard deviations over the background determined in minute 1 (adaptable) of the reaction. Additionally, the slope of the curve as mV/time can be used (slope adaptable). A second-derivative window calculating the turning point of the upward fluorescence development helps to verify curves with a very low slope.

Determination of sensitivity and specificity.

The F. tularensis tul4 gene plasmid standard was tested in eight replicates, the threshold time (in minutes) was plotted against the number of molecules detected, and a semilogarithmic regression was calculated. For exact determination, a probit regression (23) was performed using the Statistica software (StatSoft, Hamburg, Germany). The final assay was tested with DNA from bacterial strains listed in Table 1.

RESULTS

RPA sensitivity.

Using the plasmid standard, the real-time PCR showed a sensitivity of 102 molecules detected, whereas the RPA showed a sensitivity of 102 to 101 molecules detected (Fig. 1A and B). Using the results of eight complete molecular standard runs, a probit model of regression predicted that in 95% of cases the RPA detects 19.01 molecules (Fig. 1C). The RPA was tested with several F. tularensis strains (Table 1). It detected strains of F. tularensis subsp. holarctica, F. tularensis subsp. tularensis, F. hispaniensis, and F. novicida, but it did not detect F. philomiragia (DNA concentration range, 114.47 ng/μl to 563.59 ng/μl).
Fig 1
Fig 1 Real-time recombinase polymerase amplification assay performance. (A) Original graph of fluorescence development over time from the tube scanner software. (B) Analytical sensitivity as determined on a plasmid standard. Semilogarithmic regression of data from eight runs is shown. (C) Probit regression with the data of eight runs. Triangle, calculated detection limit in 95% of cases. Int., intensity of fluorescence.

Specificity.

The RPA did not detect the genomic DNA of four Yersinia strains and 17 Bacillus strains. Nine hare tissue samples of naturally infected hares were tested for the presence of F. tularensis DNA. The DNA extracted from the samples was tested by two real-time PCRs and the new RPA. The RPA was almost as good as the tul4 PCR (8) but detected fewer samples than the 23-kDa gene PCR (16) (Table 3).
Table 3
Table 3 Rabbit tissues tested and test results
Sample no.aHare tissueqPCR for the indicated genebRPAd for tul4
23-kDa genetul4
10TO174 B2Bone marrow30.1329.077.7
10TO183 B10Tongue31.6329.709.3
10TO179 B7Spleen34.1232.6610.0
10TO173 B1Liver36.1234.7711.7
10TO176 B4Lymph node (gut)38.4637.25Neg
10TO180 B8Kidney41.3740.31Neg
10TO178 B6Muscle41.35NegcNeg
10TO175 B3Lung43.10NegNeg
10TO182 A2Brain41.28NegNeg
11T0351 (NI)SpleenNegNegNeg
11T0350 (NI)LiverNegNegNeg
a
DNA concentration of the extracts ranged from 2.32 to 6.77 ng/μl. NI, not infected.
b
qPCR, quantitative PCR. PCR results for the 23-kDa gene (16) and tul4 (8) are given as CT values analyzed with the fit points method on the LightCycler, version 2.0.
c
Neg, negative.
d
RPA values are given as threshold time values.

DISCUSSION

There are several isothermal amplification methods that have been developed in the recent decade. Apart from T7 promoter-driven amplifications (transcription-mediated amplification [TMA], nucleic acid sequence-based amplification [NASBA], and single-primer isothermal amplification [SPIA]), there are strand displacement methods (strand displacement amplification [SDA] loop-mediated isothermal amplification [LAMP], and SmartAmp), helicase-dependent amplification (HDA), recombinase polymerase amplification (RPA), and several rolling circle amplification (RCA) methods (1, 2, 10, 13, 25).
Most fluorescent formats for isothermal amplification use nonspecific intercalating fluorophores or fluorescent primers (LAMP, SDA, HDA, and RCA). For specific detection, probe formats have been developed for NASBA, RCA, HDA, and RCA (14, 17, 20, 26, 28). We chose to test the RPA method for several reasons: (i) the RPA method allows verification of an exponentially amplified product using a fluorescent probe, (ii) the RPA mixture contains the single-strand binding protein GP32, which has been shown to enhance nucleic acid detection (30), and (iii) the reagents are commercially available in a dried pellet format which makes the reaction amenable to field use or point-of-care applications.
In the past, several real-time PCR protocols for the detection of F. tularensis have been described targeting the fopA, 23-kDa, and tul4 genes, the RD1 region, and the insertion element ISFtu2 (24). The tul4 gene detection assays appear to show the highest sensitivity. We established a published tul4 gene-targeting real-time PCR (8) and tested it using a tul4 gene plasmid standard created in our laboratory. It showed an analytical sensitivity of 10 molecules detected (data not shown). For this study, we designed an RPA for the same target region, tested it on the same plasmid standard, and achieved comparable analytical sensitivity (Fig. 1B), which we additionally analyzed by probit analysis (Fig. 1C). This clearly demonstrated that the isothermal real-time RPA has the same sensitivity as real-time PCR. The speed of the reaction, however, is much higher, yielding results in 10 min (Fig. 1A and B). Although in principle quantitative real-time RPA (qRPA) is possible, the TwistAmp exo kit currently has not yet been adapted for qRPA. The emphasis is on a robust reaction, which makes it an ideal tool for qualitative real-time RPA (20; also O. Piepenburg, personal communication).
Using several target genes simultaneously was shown to elevate the sensitivity of F. tularensis detection (27). We therefore additionally established a 23-kDa gene real-time PCR (16) and tested tissue samples of infected hares using both real-time PCRs and the new RPA. The 23-kDa gene real-time PCR detected F. tularensis in 9/9 rabbit tissue samples, the tul4 gene real-time PCR found 6/9 samples as positive, and the tul4 gene RPA found 4/9 samples positive. Thus, the 23-kDa gene real-time PCR appeared more sensitive than the tul4 gene real-time PCR, and the RPA did not detect samples that had tested positive in the real-time PCR assays between threshold cycles CT 35 and 40. In diagnostic real-time PCR assays, it is customary to regard results between CT 35 and 40 as equivocal and above CT 40 as negative. This particular RPA therefore is almost as sensitive as the real-time PCR, and the observed reduced sensitivity of the RPA assay misses the range of equivocal or false positives of the tested real-time PCRs.
Among the F. tularensis strains tested, all human pathogens were detected except for F. philomiragia, which in general is a fish pathogen and has been described to infect patients with an underlying chronic disease (9, 21, 22, 31). However, there may be more Francisella species or strains that potentially can infect humans, as a recent first report from the Southern Hemisphere indicates (http://www.promedmail.org/direct.php?id=20111105.3299).
This novel RPA therefore seems well suited for a biothreat first-line detection device able to detect pathogenic F. tularensis strains at high sensitivity.
The robust tube scanner device has a great potential to develop into an isothermal nucleic acid detection device for point-of-care detection and field use. It is much lighter and smaller than the R.A.P.I.D. or the RAZOR instrument for which real-time PCR assays for F. tularensis have been developed and evaluated (6, 16). RPAs have already been integrated onto a foil-based microfluidic LabDisc system (15). This could eventually lead to the development of RPA panels, e.g., for the simultaneous detection of category A infectious agents in small point-of-care devices.
In summary we have developed a very rapid and highly sensitive isothermal real-time RPA for the detection of F. tularensis on a mobile device. The results merit further investigation into this methodology.

ACKNOWLEDGMENTS

This work was supported by Federal Ministry of Education and Research funded project Potential Release-Oriented Biothreat Emergency Diagnostics under the research program for civil security of the German Federal Government as part of a high-tech strategy for Germany.
We thank Mandy Elschner of the Federal Research Center for Animal Health, Institute of Bacterial Infections and Zoonoses, for supporting us with the choice of bacterial strains for the cross-detection studies.

REFERENCES

1.
Andras SC, Power JB, Cocking EC, and Davey MR. 2001. Strategies for signal amplification in nucleic acid detection. Mol. Biotechnol. 19:29–44.
2.
Asiello PJ and Baeumner AJ. 2011. Miniaturized isothermal nucleic acid amplification, a review. Lab Chip 11:1420–1430.
3.
Birdsell DN et al. 2009. Francisella tularensis subsp. novicida isolated from a human in Arizona. BMC Res. Notes 2:223. doi:.
4.
Buehler JW, Berkelman RL, Hartley DM, and Peters CJ. 2003. Syndromic surveillance and bioterrorism-related epidemics. Emerg. Infect. Dis. 9:1197–1204.
5.
Cady NC, Stelick S, Kunnavakkam MV, Liu Y, and Batt CA. 2004. A microchip-based DNA purification and real-timer PCR biosensor for bacterial detection, p 1191–1194. In Rocha D, Sarro PM, and Vellekop JM (ed), Proceedings of IEEE Sensors, 2004. Institute of Electrical and Electronics Engineers, Piscataway, NJ.
6.
Christensen DR et al. 2006. Detection of biological threat agents by real-time PCR: comparison of assay performance on the R.A.P.I.D., the LightCycler, and the Smart Cycler platforms. Clin. Chem. 52:141–145.
7.
Dennis DT et al. 2001. Tularemia as a biological weapon: medical and public health management. JAMA 285:2763–2773.
8.
Emanuel PA et al. 2003. Detection of Francisella tularensis within infected mouse tissues by using a hand-held PCR thermocycler. J. Clin. Microbiol. 41:689–693.
9.
Friis-Moller A, Lemming LE, Valerius NH, and Bruun B. 2004. Problems in identification of Francisella philomiragia associated with fatal bacteremia in a patient with chronic granulomatous disease. J. Clin. Microbiol. 42:1840–1842.
10.
Gill P and Ghaemi A. 2008. Nucleic acid isothermal amplification technologies: a review. Nucleosides Nucleotides Nucleic Acids 27:224–243.
11.
Haberstroh K and Reiff E-C. 2007. Fluoreszenzmessung wird alltagstauglich, p 29–33. In Schanz GW (ed), Sensortechnik aktuell 2007. Oldenbourg Industrieverlag GmbH, Munich, Germany.
12.
Huber B et al. 2010. Description of Francisella hispaniensis sp. nov., isolated from human blood, reclassification of Francisella novicida (Larson et al. 1955) Olsufiev et al. 1959 as Francisella tularensis subsp. novicida comb. nov. and emended description of the genus Francisella. Int. J. Syst. Evol. Microbiol. 60:1887–1896.
13.
Kim J and Easley CJ. 2011. Isothermal DNA amplification in bioanalysis: strategies and applications. Bioanalysis 3:227–239.
14.
Leone G, van Schijndel H, van Gemen B, Kramer FR, and Schoen CD. 1998. Molecular beacon probes combined with amplification by NASBA enable homogeneous, real-time detection of RNA. Nucleic Acids Res. 26:2150–2155.
15.
Lutz S et al. 2010. Microfluidic lab-on-a-foil for nucleic acid analysis based on isothermal recombinase polymerase amplification (RPA). Lab Chip. 10:887–893.
16.
Matero P et al. 2011. Rapid field detection assays for Bacillus anthracis, Brucella spp., Francisella tularensis and Yersinia pestis. Clin. Microbiol. Infect. 17:34–43.
17.
Nilsson M, Gullberg M, Dahl F, Szuhai K, and Raap AK. 2002. Real-time monitoring of rolling-circle amplification using a modified molecular beacon design. Nucleic Acids Res. 30:e66.
18.
Park S, Zhang Y, Lin S, Wang TH, and Yang S. 2011. Advances in microfluidic PCR for point-of-care infectious disease diagnostics. Biotechnol. Adv. 29:830–839.
19.
Petersen JM, Mead PS, and Schriefer ME. 2009. Francisella tularensis: an arthropod-borne pathogen. Vet. Res. 40:7. doi:.
20.
Piepenburg O, Williams CH, Stemple DL, and Armes NA. 2006. DNA detection using recombination proteins. PLoS Biology. 4:e204. doi:.
21.
Polack FP, Harrington SM, Winkelstein JA, Merz WG, and Willoughby RE. 1998. Recurrent Francisella philomiragia sepsis in chronic granulomatous disease. Pediatr. Infect. Dis. J. 17:442–443.
22.
Sicherer SH, Asturias EJ, Winkelstein JA, Dick JD, and Willoughby RE. 1997. Francisella philomiragia sepsis in chronic granulomatous disease. Pediatr. Infect. Dis. J. 16:420–422.
23.
Smieja M et al. 2001. Replicate PCR testing and probit analysis for detection and quantitation of Chlamydia pneumoniae in clinical specimens. J. Clin. Microbiol. 39:1796–1801.
24.
Splettstoesser WD, Tomaso H, Al Dahouk S, Neubauer H, and Schuff-Werner P. 2005. Diagnostic procedures in tularaemia with special focus on molecular and immunological techniques. J. Vet. Med. B Infect. Dis. Vet. Public Health 52:249–261.
25.
Stougaard M, Juul S, Andersen FF, and Knudsen BR. 2011. Strategies for highly sensitive biomarker detection by rolling circle amplification of signals from nucleic acid composed sensors. Integr. Biol. (Camb.) 3:982–992.
26.
Tong Y et al. 2008. Development of isothermal TaqMan assays for detection of biothreat organisms. Biotechniques 45:543–557.
27.
Versage JL, Severin DD, Chu MC, and Petersen JM. 2003. Development of a multitarget real-time TaqMan PCR assay for enhanced detection of Francisella tularensis in complex specimens. J. Clin. Microbiol. 41:5492–5499.
28.
Vincent M, Xu Y, and Kong H. 2004. Helicase-dependent isothermal DNA amplification. EMBO Rep. 5:795–800.
29.
Weidmann M, Meyer-Konig U, and Hufert FT. 2003. Rapid detection of herpes simplex virus and varicella-zoster virus infections by real-time PCR. J. Clin. Microbiol. 41:1565–1568.
30.
Weidmann M, Rudaz V, Nunes MR, Vasconcelos PF, and Hufert FT. 2003. Rapid detection of human pathogenic orthobunyaviruses. J. Clin. Microbiol. 41:3299–3305.
31.
Wenger JD et al. 1989. Infection caused by Francisella philomiragia (formerly Yersinia philomiragia): a newly recognized human pathogen. Ann. Intern. Med. 110:888–892.

Information & Contributors

Information

Published In

cover image Journal of Clinical Microbiology
Journal of Clinical Microbiology
Volume 50Number 7July 2012
Pages: 2234 - 2238
PubMed: 22518861

History

Received: 28 November 2011
Returned for modification: 15 February 2012
Accepted: 8 April 2012
Published online: 21 December 2020

Permissions

Request permissions for this article.

Contributors

Authors

Milena Euler
University Medical Center, Department of Virology, Göttingen, Germany
Yongjie Wang
Laboratory of Marine and Food Microbiology, College of Food Science and Technology, Shanghai Ocean University, Shanghai, China
Peter Otto
Friedrich Loeffler Institut, Jena, Germany
Herbert Tomaso
Friedrich Loeffler Institut, Jena, Germany
Raquel Escudero
Laboratorio de Espiroquetas y Patógenos Especiales, Servicio de Bacteriología, Centro Nacional de Microbiología, Instituto de Salud Carlos III, Majadahonda, Madrid, Spain
Pedro Anda
Laboratorio de Espiroquetas y Patógenos Especiales, Servicio de Bacteriología, Centro Nacional de Microbiología, Instituto de Salud Carlos III, Majadahonda, Madrid, Spain
Frank T. Hufert
University Medical Center, Department of Virology, Göttingen, Germany
Manfred Weidmann
University Medical Center, Department of Virology, Göttingen, Germany

Notes

Address correspondence to Manfred Weidmann, [email protected].

Metrics & Citations

Metrics

Note:

  • For recently published articles, the TOTAL download count will appear as zero until a new month starts.
  • There is a 3- to 4-day delay in article usage, so article usage will not appear immediately after publication.
  • Citation counts come from the Crossref Cited by service.

Citations

If you have the appropriate software installed, you can download article citation data to the citation manager of your choice. For an editable text file, please select Medlars format which will download as a .txt file. Simply select your manager software from the list below and click Download.

View Options

Figures and Media

Figures

Media

Tables

Share

Share

Share the article link

Share with email

Email a colleague

Share on social media

American Society for Microbiology ("ASM") is committed to maintaining your confidence and trust with respect to the information we collect from you on websites owned and operated by ASM ("ASM Web Sites") and other sources. This Privacy Policy sets forth the information we collect about you, how we use this information and the choices you have about how we use such information.
FIND OUT MORE about the privacy policy