Research Article
1 June 2009

Detection of Streptococcus pneumoniae Strain Cocolonization in the Nasopharynx

ABSTRACT

Colonization with more than one distinct strain of the same species, also termed cocolonization, is a prerequisite for horizontal gene transfer between pneumococcal strains that may lead to change of the capsular serotype. Capsule switch has become an important issue since the introduction of conjugated pneumococcal polysaccharide vaccines. There is, however, a lack of techniques to detect multiple colonization by S. pneumoniae strains directly in nasopharyngeal samples. Two hundred eighty-seven nasopharyngeal swabs collected during the prevaccine era within a nationwide surveillance program were analyzed by a novel technique for the detection of cocolonization, based on PCR amplification of a noncoding region adjacent to the pneumolysin gene (plyNCR) and restriction fragment length polymorphism (RFLP) analysis. The numbers of strains and their relative abundance in cocolonized samples were determined by terminal RFLP. The pneumococcal carriage rate found by PCR was 51.6%, compared to 40.0% found by culture. Cocolonization was present in 9.5% (10/105) of samples, most (9/10) of which contained two strains in a ratio of between 1:1 and 17:1. Five of the 10 cocolonized samples showed combinations of vaccine types only (n = 2) or combinations of nonvaccine types only (n = 3). Carriers of multiple pneumococcal strains had received recent antibiotic treatment more often than those colonized with a single strain (33% versus 9%, P = 0.025). This new technique allows for the rapid and economical study of pneumococcal cocolonization in nasopharyngeal swabs. It will be valuable for the surveillance of S. pneumoniae epidemiology under vaccine selection pressure.
Streptococcus pneumoniae is among the most important of human pathogens and is responsible for bacterial meningitis, sepsis, pneumonia, and acute otitis media. The habitat of the pneumococcus is the mucosa of the human nasopharynx. Colonization of the nasopharynx occurs early in life, with a prevalence of about 40% in infants and 15% in adults (depending on the local epidemiology). A single strain can persist in the nasopharynx for weeks or months, to then be replaced by other strains. Colonization is the starting point for all relevant aspects of this pathogen, such as invasive disease, exchange of genetic material, genetic recombination, and transmission. By the age of two, more than 95% of children have been colonized with up to six different serotypes (8). Sometimes more than one pneumococcal strain colonizes the nasopharynx at the same time. This phenomenon is known as cocolonization, or multiple colonization with more than one distinct strain of the same species. Cocolonization is probably required for horizontal gene transfer between different pneumococcal strains. Such genetic exchange has been shown to occur for the capsule gene locus and has been observed in the past for dominant international multiresistant pneumococcal clones (5). There are few data on rates of multiple colonization, but existing estimates range from 1.3% (13) up to 20% (9, 26). Not only geographical variations in pneumococcal epidemiology but also the different techniques used to detect pneumococci may explain the differences in reported prevalence estimates for cocolonization.
A better understanding of the epidemiology of cocolonization and of the risk factors promoting cocolonization both for the human host and the pathogen is needed. Such data could help us understand and possibly even predict the emergence of new strains, for example, under vaccine selection pressure currently exerted by the conjugated pneumococcal polysaccharide vaccine.
Detection of multiple colonization has relied on culture and serotyping of individual colony subcultures. Due to its insufficient sensitivity, this approach is not practical for detecting cocolonization. Huebner et al. (13) estimated that 299 colonies must be typed to detect with 95% probability a serotype which represents 1% of the colonizing population. This laborious and expensive approach has limited the practical feasibility of detecting cocolonization. Also, direct determination of serotypes in the nasopharyngeal swab is impossible, as swabs have to be streaked out onto agar plates and grown overnight. This culture step could skew the results due to selection for better-growing strains.
Conventional culture-based techniques are biased to detect the most-abundant serotype and are prone to miss cocolonization with a less-abundant type, an effect referred to as masking (18). This probable underestimation of multiple colonization can lead to a false interpretation of strain distribution, especially under selective pressure due to antibiotics or vaccines. It has been argued that observed changes in serotype distribution may reflect unmasking of multiple colonization rather than true redistribution (17, 18).
We therefore developed a novel DNA-based method for the detection of colonization with multiple S. pneumoniae strains directly in nasopharyngeal swabs.

MATERIALS AND METHODS

Bacterial strains.

For establishment and validation of the test, clinical isolates of S. pneumoniae were selected from two nationwide surveillance programs collecting nasopharyngeal and invasive isolates (16, 23). They represented prevalent serotypes (1, 4, 6A, 6B, 9V, 14, 15, 18C, 19F, and 23F). In order to simulate cocolonization in vitro, chromosomal DNA of different strains was isolated as described previously (21) and mixed at different ratios (1:1, 1:2, 1:5, 1:10, 1:20, 1:25, 1:30, 1:40, 1:50, and 1:100).

Nasopharyngeal swabs.

A total of 287 consecutive nasopharyngeal swabs were collected between December 2004 and February 2005, together with epidemiological information, within one of the above-mentioned surveillance programs (23). Swabs were streaked out onto CSBA (Columbia sheep blood agar) plates and were then put into a 1.5-ml polypropylene tube (Sarstedt, Sevelen, Switzerland) filled with 800 μl of transport medium for chlamydia and viruses (TMCV) and vortexed for 30 s at maximum speed. TMCV is composed of 0.2 M saccharose; 0.0025% phenol red sodium salt solution (0.5%); 0.0146 M potassium phosphate dibasic trihydrate; 0.0054 M potassium phosphate monobasic (Merck, Zug, Switzerland); 2.5 mg/liter amphothericin (Bristol-Myers Squibb, Baar, Switzerland); 1% bovine serum albumin, fraction V (Sigma, Buchs, Switzerland); and gentamicin (final concentration of 100 to 120 μg/liter) (Oxoid/Seromed, Pratteln, Switzerland). The swab was removed, and the solution was stored at −80°C until further use. Pneumococcal colonies growing on CSBA plates were identified and capsular serotypes determined as previously described (11).

DNA isolation from swab solution.

Chromosomal bacterial DNA was isolated from the nasopharyngeal swab solution by using a QIAamp DNA mini kit (Qiagen, Hilden, Germany) according to the manufacturer's instructions. In brief, 200 μl of swab solution was used with 20 μl of proteinase K and 200 μl of lysis buffer. The final elution step was performed with 100 μl of elution buffer.

plyNCR PCR.

The noncoding region adjacent to the pneumolysin gene (plyNCR) and between it and the preceding hypothetical protein gene (designated spr1738 in the R6 genome [NCBI Refseq NC_003098]) was amplified by PCR using the previously described primers NCRspanFor3 and NCRspanRev3 (Table 1) (10). The reaction mixture contained 5 μl of FastStart Taq reaction buffer without MgCl2, 4 μl of 25 mM MgCl2 stock solution, 8 μl of 1.25 mM deoxynucleoside triphosphates, 0.6 μl (3 U) of FastStart Taq polymerase (all from Roche Molecular Biochemicals, Rotkreuz, Switzerland), and 0.5 μl of each primer (Eurofins MWG Operon, Ebersberg, Germany) in a total volume of 50 μl. Approximately 0.001 to 100 ng of DNA from in vitro DNA mixtures or 31.4 μl of DNA extracted from swabs was added per reaction. The following cycling conditions were used: primary denaturation and enzyme activation for 6 min at 95°C, followed by 35 cycles of 95°C for 30 s, 62°C for 30 s, and 72°C for 2 min, and ending with a final extension for 7 min at 72°C.

Restriction fragment length polymorphism (RFLP) analysis.

The plyNCR PCR products, approximately 1.4 kb in size, were quantified by using a DNA 7500 kit with an Agilent 2100 bioanalyzer (Agilent Technologies, Palo Alto, CA). A 600-ng amount of each PCR product was digested separately with the different restriction endonucleases AflIII, ApoI, DdeI, and MseI (New England Biolabs, Ipswich, MA) in a total reaction mixture volume of 20 μl, according to the manufacturer's instructions. The digestion product was analyzed using the Agilent 2100 bioanalyzer. Samples for which the sum of the size of the bands obtained after restriction enzyme digestion was greater than the size of the undigested PCR product were further analyzed for cocolonization.
Rarely, plyNCR PCR showed bands that were out of the expected size range or more than one band (see below), probably due to an amplification of related sequences in other streptococcal species. In such situations, PCR of psaA was performed as a control, as described previously (22).

Sensitivity and specificity of plyNCR PCR.

The detection limit of plyNCR PCR was about 1 pg as assessed by visualization of the amplification peak in the electropherogram or the band produced in the Agilent 2100 bioanalyzer (Fig. 1A). Several other streptococcal species (S. gordonii, S. mitis, S. milleri, S. oralis, S. pyogenes, S. salivarius, S. sanguinis, and Group C and G streptococci) and nonstreptococcal species (Chlamydia pneumoniae, Corynebacterium pseudodiphtheriticum, Corynebacterium pseudotuberculosis, Corynebacterium xerosis, Escherichia coli, Enterococcus faecalis, Haemophilus influenza, Klebsiella pneumoniae, Moraxella catarrhalis, Mycobacterium fortuitum, Mycoplasma pneumoniae, Nocardia farcinica, Pseudomonas aeruginosa, Rhodococcus equi, Staphylococcus aureus, and Staphylococcus epidermidis) were tested with plyNCR PCR, and no amplification was observed (data not shown). Extracted DNA of C. pneumoniae and M. pneumoniae was kindly provided by Martin Altwegg (Bio-Analytica, Luzern, Switzerland). Pneumococcal plyNCR PCR products for 1,819 tested isolates had a mean size of 1,400 bp (standard deviation of 44.40 bp and 95% confidence interval of 1,398 to 1,402 bp; all quantified with the Agilent 2100 bioanalyzer).

DNA sequencing of plyNCR PCR products.

PlyNCR PCR products from eight pneumococcal strains, including seven strains from cocolonized samples (see below) and one in-house reference strain (serotype 9V), were purified with a Promega Wizard SV gel and PCR clean-up system (Promega, Madison, WI). A dye terminator reaction (Applied Biosystems, Rotkreuz, Switzerland) was performed, and excess dye terminators were removed with a DyeEx 2.0 spin kit (Qiagen, Hilden, Germany) according to the manufacturer's instructions. Sequencing was performed on an ABI genetic analyzer 310 with performance-optimized polymer 6 (POP-6) by primer walking with six primer pairs (plyNCR_seq_for and plyNCR_rev) (Table 1). Sequences were analyzed with Lasergene SeqMan Pro software version 7.1.0. The choice of restriction enzymes for terminal RFLP (T-RFLP; see below) for strains R6 and TIGR4 and the nine sequenced clinical isolates was based on virtual restriction digestion with Lasergene SeqBuilder software, version 7.1.0.

T-RFLP.

As plyNCR RFLP may not allow for the determination of the exact number of cocolonizing pneumococcal strains, due to pattern overlapping, T-RFLP was established. The plyNCR region was amplified by PCR using fluorescently labeled primers (forward primer, NCRspanFor3_VIC, and reverse primer, NCRspanRev3_6-FAM) (Applied Biosystems, Rotkreuz, Switzerland). Amplification was performed as described above for plyNCR PCR. A 40-ng amount of PCR product was digested separately with the different restriction endonucleases BspMI, Bsu36I, BtsCI, HpaI, MnlI, and Tsp509I (New England Biolabs, Ipswich, MA) in a total reaction mixture volume of 20 μl, according to the manufacturer's instructions. Digestion products were purified and desalted by using the Wizard SV gel and PCR clean-up system (Promega, Madison, WI). A 3-μl amount of purified digestion product was diluted with 3 μl HiDi formamide (Applied Biosystems, Rotkreuz, Switzerland) and capped with a rubber septum. A 0.5-μl amount of the diluted sample was put in a 0.5-ml genetic analyzer sample tube together with 9 μl of HiDi formamide and 0.5 μl of LIZ 1200 size standard (Applied Biosystems, Rotkreuz, Switzerland). After the loading cocktail was heated for 3 min at 95°C, samples were immediately chilled on ice and then loaded into the 48-well rack. Capillary electrophoresis was performed on an ABI genetic analyzer 310, using the following run conditions: injection time, 4 s; injection voltage, 5 kV; run voltage, 15 kV; run time, 90 min; and run temperature, 60°C. A special module, GS_STR_POP-6_G5, was created to run the analysis with the POP-6. The parameters of this module were syringe pump time, 600 s, and preinjection electrophoresis, 300 s. Sizing was performed manually by comparing sample peaks to the neighboring ladder peaks.

Data analysis.

Proportions were compared with the Chi square test, using Prism 5 software (GraphPad, La Jolla, CA).

RESULTS

Detection of cocolonization in vitro.

The principles of plyNCR RFLP-based detection of multiple colonization are shown in Fig. 2A and B. Cocolonization was detected with plyNCR RFLP in vitro down to a strain ratio of 1:100 (Fig. 1B). plyNCR T-RFLP detected cocolonization with several strains (mixes with up to three strains tested) down to a strain ratio of 1:100 (data not shown). The relative peak heights in the electropherogram of T-RFLP corresponded with the relative amount of a strain in a mixture (Fig. 3).

Analysis of nasopharyngeal swabs for cocolonization.

A total of 287 nasopharyngeal swabs were analyzed. plyNCR PCR amplified one band of the expected size from 133 swabs and two or more bands, of which one had the expected size, from 15 swabs (Table 2). Therefore, the pneumococcal colonization rate determined by PCR was 51.6% (148/287), compared to a colonization rate of 40% (116/287) determined by culture (P = 0.007).
plyNCR RFLP analysis was performed on 105 swabs for which PCR yielded a single band of the expected size and for which sufficient PCR product was available. Cocolonization was found in 10 (9.5%) of these samples (Table 3). S. pneumoniae was grown by culture from all 10 samples, but cocolonization had not been suspected during routine workup. plyNCR T-RFLP showed that nine samples contained two pneumococcal strains and one contained three strains (Table 3). The ratios of strains ranged between 1:1 and 17:1. Comparison of plyNCR RFLP patterns showed that the dominant strain identified by PCR analysis was also the strain detected during routine culture in 9 of 10 cocolonized samples. In the remaining sample, the plyNCR RFLP pattern of the strain identified by culture was also identified by direct swab analysis, but not as the dominant peak. Retrospective plyNCR RFLP analysis of the 10 cultured and stored isolates originating from the 10 cocolonized samples detected a strain mixture in two samples (123 5037 and 123 5697). Subcultures confirmed serotypes 14 and 15 in one sample (123 5037) and serotypes 1 and 15 in the other (123 5697), as predicted by plyNCR RFLP.
Cocolonization was found in samples from children younger than 7 years (median age of 2.5 years, compared to a median age of 3 years for carriers of a single strain). Children with cocolonization were not more often attending day care (10%) than those carrying a single strain (25.3%, P > 0.05) and had not more often had more than one episode of acute otitis media during the past 12 months (10% versus 17%, P > 0.05). However, they had received antibiotic treatment significantly more often during the past 8 weeks (33.3% versus 9%, P = 0.025).

RFLP types and serotypes of cocolonizing strains.

plyNCR RFLP has been established as a molecular typing method which correlates well with pulsed-field gel electrophoresis, multilocus sequence typing (MLST), and serotyping for detection of S. pneumoniae strains (10). We have typed almost 2,000 clinical invasive and noninvasive pneumococcal isolates at our institution and have generated a database of RFLP types, with associated serotypes and MLST types where available (data not shown). Based on this database, we predicted serotypes for the strains detected in the 10 cocolonized swabs as follows. The bands corresponding to the pattern for the strain detected by culture were subtracted from the plyNCR RFLP pattern, and the remaining pattern was compared to patterns and associated serotypes in our database (Fig. 2C). This procedure works best for samples with not more than two strains and differences in RFLP patterns detected by one restriction enzyme only. The comparison of serotypes predicted by plyNCR RFLP and actual serotypes determined by serotyping is summarized in Table 3.

DISCUSSION

Earlier studies of rates of cocolonization by S. pneumoniae strains have used different methods, such as serotyping of multiple colonies from culture plates, immunoblots on culture plates, multiplex PCR, and more recently, microarray analysis (1-4, 9, 12, 13, 24, 26, 27). Here, we present a novel assay for the detection of nasopharyngeal cocolonization with Streptococcus pneumoniae strains. Advantages of this technique are that it can be applied directly to nasopharyngeal swabs, that it gives the number and relative amounts of cocolonizing strains in a given sample, and that it is relatively easy and economical to perform.
Comparison of a new method for the detection of cocolonization with reported techniques is hampered by the heterogeneity of technical approaches, a lack of data about the standardized performance of different techniques, and the heterogeneity of study populations to which various methods have been applied. In the future, the PneumoCarr Microbiology Project (www.pneumocarr.org ) may help to standardize the different assays.
The new technique presented here is based on plyNCR PCR, which is highly specific for S. pneumoniae. DNA of numerous commensals of the oral flora and respiratory pathogens was not amplified with the chosen primers. Only 5% of clinical samples could not be analyzed due to amplification of atypical bands, probably representing S. mitis group strains which may have acquired the pneumolysin gene by horizontal gene transfer from pneumococci (30). The sensitivity of plyNCR PCR for the detection of pneumococcal colonization was significantly higher than that of conventional culture (50% versus 40%). This corresponds to the results for other PCR-based methods for the detection of pneumococcal colonization directly in nasopharyngeal swabs (15, 28).
Methods for the detection of cocolonization are challenged by the presence of strains in different relative proportions. Our assay detected cocolonization in vitro down to a strain ratio of 1:100. This is comparable to the analysis of 299 colonies per sample in the conventional culture-based approach (13). A recently presented microarray-based genomic assay was of similar sensitivity; the immunoblot assay of Bogaert et al. had a detection limit of 1:1,000 for pneumococcal cocolonization, and the multiplex PCR technique of Rivera-Olivero et al. detected pneumococcal cocolonization down to a ratio of 1:20 (3, 12, 26). These methods all required culturing the bacteria.
plyNCR RFLP detects molecular types and not serotypes, although some prediction about serotypes was possible. In addition, plyNCR RFLP performed directly on a nasopharyngeal sample can be combined with a second step of culture-based multiplex PCR for the detection of serotypes in cocolonized samples. We are currently exploring this approach. The advantage of detecting cocolonization by amplification of a specific chromosomal region in a simple PCR step is its applicability directly to clinical samples without an intermediate culture step. The latter may lead to false-negative results, may not correctly identify the relative proportions of strains present, and is time consuming. A drawback of direct analysis of nasopharyngeal swabs without culture is the limited amount of DNA present in these samples. In this study, 28 of 133 (21%) swabs positive for S. pneumoniae could not be processed further by plyNCR RFLP because insufficient DNA was available.
Multiplex PCR is generally less sensitive than monoplex PCR, and differentiation of individual serotypes requires relatively large amounts of pneumococcal DNA in the samples. The only multiplex PCR so far used on nasopharyngeal swabs was designed to detect seven serotypes and three serogroups (2). It remains to be seen whether microarray-based techniques are sufficiently sensitive for use with clinical samples. The assay presented by Wang et al. needed a minimum of 10 ng of pneumococcal DNA; in comparison, our assay used 0.01 ng to 0.1 ng (29).
The discriminatory power of the plyNCR RFLP method depends on the sequence variability of the amplified DNA fragment. In an earlier study, the discriminatory power of plyNCR RFLP was similar to that of pulsed-field gel electrophoresis and MLST (10). Also, in our laboratory, typing of approximately 500 nasopharyngeal clinical pneumococcal isolates yielded a total of 50 different RFLP profiles, of which 9 profiles, with relative frequencies between 5% and 16%, accounted for approximately 90% of all isolates (data not shown). We cannot exclude the possibility that some cocolonization was missed due to identical RFLP patterns of cocolonizing strains. Combining plyNCR RFLP with RFLP of one or two other regions should enhance discrimination. This option is currently being explored in our laboratory.
We combined plyNCR RFLP with T-RFLP for the exact determination of the number of strains in cocolonized samples. T-RFLP analysis has been designed as a culture-independent technique for the analysis of mixed microbial communities in environmental samples, such as soil or seawater samples, using primers for 16S rRNA (6, 7, 14, 19, 25). T-RFLP analysis software to facilitate species identification and comparative analysis and to generate phylogenetic trees is available within the Ribosomal Database Project (RDP-II) (20). We are continually building a plyNCR T-RFLP database for molecular typing of S. pneumoniae. An extension of T-RFLP to other pneumococcal genomic regions could further enhance the discriminatory power and could be integrated into the growing database.
In this study, analysis of 287 consecutive nasopharyngeal swabs from Swiss outpatients with otitis media or pneumonia revealed a cocolonization rate of 9.5%. Comparison with other reported rates is hampered due to the different analytical methods used and populations studied. Using culture-based typing of samples from young children, cocolonization was found in 2.4% of samples from Israel (three colonies typed per sample), 1.2% of samples from South Africa (five colonies typed per sample), and 10.8% of samples from Portugal (six to eight colonies typed per sample) (13, 27). Relatively higher rates of cocolonization could have been expected from these three studies than from our study, since they were all performed in populations with higher degrees of crowding and higher pneumococcal carriage rates.
The distribution of serotypes detected in cocolonized samples reflected the most-prevalent pneumococcal strains in Switzerland (16). Five of the 10 cocolonized samples showed a combination of vaccine types only (n = 2) or combinations of nonvaccine types only (n = 3). It will be interesting to compare the results from this prevaccine study to analysis of samples obtained after the introduction of conjugated vaccine. We are currently generating such data.
In conclusion, this novel technique, based on a combination of plyNCR RFLP and T-RFLP, allows the detection of colonization with multiple S. pneumoniae strains directly from nasopharyngeal swabs, with high sensitivity and specificity. The limitation of detecting pneumococcal strains rather than serotypes can easily be overcome by adding a culture step for samples with cocolonization. This method will be especially useful for studies of pneumococcal colonization during an era of serotype redistribution under vaccine selection pressure (17).
FIG. 1.
FIG. 1. Sensitivity of plyNCR PCR for the detection of colonization and cocolonization by S. pneumoniae strains. (A) plyNCR PCR was performed with serial dilutions of chromosomal DNA. The limit of detection was 0.001 ng. Bands at 50 and 10,380 bp in each gel lane represent internal size markers used by the bioanalyzer for sizing. (B) plyNCR RFLP was performed on an in vitro mixture of two pneumococcal strains. The detection limit for pneumococcal cocolonization is reached at a strain ratio of 1:100, indicated by the fading intensity of the band at 580 bp (arrow). Ladder peaks are shown and sizes are indicated on the left (bp = base pairs).
FIG. 2.
FIG. 2. Detection of cocolonization by plyNCR PCR-RFLP is based on the comparison of the plyNCR PCR product size and the sum of fragment sizes obtained after restriction enzyme digestion of the PCR product. plyNCR stands for the undigested PCR product. (A) Example of a swab (sample 122 8799) without cocolonization: the sum of fragment sizes after enzyme digestion of the plyNCR PCR product is smaller than the size of the PCR product. (B) Example of a swab (sample 122 6470) with cocolonization: the sum of fragment sizes after enzyme digestion of the plyNCR PCR product exceeds the size of the PCR product. (C) Molecular types of cocolonizing strains can be inferred from plyNCR RFLP patterns by subtraction analysis if the following conditions are met: subtraction of the plyNCR RFLP pattern of a strain known to be in the mixture (due to culture results) allows determination of the pattern of the remaining strain(s) if cocolonization is indicated by only one restriction enzyme.
FIG. 3.
FIG. 3. Pneumococcal cocolonization with two strains is detected by T-RFLP. The electropherogram shows results for two terminal fragments with labeled reverse primer (FAM [6-carboxyfluorescein], blue) and two fragments with labeled forward primer (VIC, green) which represent the two pneumococcal strains. The high resolution of T-RFLP is shown in the inset enlargements of the two VIC peaks. The two fragments are well separated, although their sizes differ by only 2 bp. The relative amounts of the two strains in the sample are indicated by the relative heights of the two peaks for a given primer. The estimation is best when the peaks lie close to each other, like the VIC peaks (strain ratio, 1.5:1) The red peaks represent the LIZ 1200 size standard, and the primer peak (unincorporated primers) is visible on the left. The y axis shows fluorescence units, and the x axis shows data collection points.
TABLE 1.
TABLE 1. Primers used in this study
PrimerSequence (5′ → 3′)PurposeSource
NCRspan_for_35′AAAGGCTGCACGGACATTG3′plyNCR RFLP10
NCRspan_rev_35′CCGATTTGCCACTAGTGCGTAAGC3′plyNCR RFLP10
NCRspan_for_3_VIC5′AAAGGCTGCACGGACATTG_VIC3′plyNCR T-RFLPThis study
NCRspan_rev_3_FAM5′CCGATTTGCCACTAGTGCGTAAGC_6-FAM3′plyNCR T-RFLPThis study
plyNCR_seq_for_15′AAGGCTGCACGGACATTGG3′plyNCR sequencingThis study
plyNCR_seq_for_25′TTTGGCACTTGGGCTTGTTTG3′plyNCR sequencingThis study
plyNCR_seq_for_35′GCTCCATCTTTAGCCGTTTTCTTG3′plyNCR sequencingThis study
plyNCR_seq_for_45′CATTCAAAAAACAAACTAGACCATTATC3′plyNCR sequencingThis study
plyNCR_seq_for_55′TTATAGGCGCTATTGTATTCTAAGA3′plyNCR sequencingThis study
plyNCR_seq_for_65′ATATTTCCGATACGTGTCATTCTTG3′plyNCR sequencingThis study
plyNCR_seq_rev_15′GCCAAGAAAACGGCTAAAGATG3′plyNCR sequencingThis study
plyNCR_seq_rev_25′TTGAATGTGGATGAGTGTCTGTTG3′plyNCR sequencingThis study
plyNCR_seq_rev_35′AAGGTGCAGTATGATTGTTTTTGTCG3′plyNCR sequencingThis study
plyNCR_seq_rev_45′CTATCCGCAACCTCAAAACAGTG3′plyNCR sequencingThis study
plyNCR_seq_rev_55′TGTAAAAAAGTAAAAAGGGTAGCC3′plyNCR sequencingThis study
plyNCR_seq_rev_65′GATTTGCCACTAGTGCGTAAGC3′plyNCR sequencingThis study
psaA_p1_for5′CTTTCTGCAATCATTCTTG3′psaA22
psaA_p2_rev5′GCCTTCTTTACCTTGTTCTGC3′psaA22
TABLE 2.
TABLE 2. plyNCR PCR analysis of 287 nasopharyngeal swabs for colonization with S. pneumoniae strains
No. of swabsplyNCR PCRControl psaA PCRInterpretation
121NegativeNot doneNot colonized
133Positive; one band of expected sizeNot doneColonized
15Positive; more than one band, one of expected sizePositiveaColonized
17Positive; one band, not of expected sizeNegativebNot colonized
1Positive; more than one band, none of expected sizeNegativeNot colonized
a
Insufficient DNA available for control PCR for one sample.
b
Insufficient DNA available for control PCR for three samples.
TABLE 3.
TABLE 3. Characteristics of 10 nasopharyngeal swabs with pneumococcal cocolonization
SampleStraina plyNCR RFLP type(s) (serotype[s]) obtained:   
   Direct from swab After culture 
 No.RatioDominant strainbAdditional strain(s)cCultured strainSubculture from frozen stock of cultured strain
122 647039.5:2:18 (7F/14/22)4 (19F); ?4 (19F)Original strain confirmed
123 109621.6:116 (23F)31 (3)16 (23F)Original strain confirmed
123 238627:13 (11)17 (3)3 (11)Original strain confirmed
123 503721:11 (14)4 (15)1 (14)Mixture of two strains: 1 (14); 4 (15)
123 504121.5:13 (3)17 (4)3 (3)Original strain confirmed
123 569727:120 (1)15 (15); 7; 4520 (1)Mixture of two strains: 20 (1); 15 (15)
123 633628:18 (22)18 (14)8 (22)Original strain confirmed
124 037224.5:117 (4)4 (19F)17 (4)Original strain confirmed
124 1352217:17 (3)15 (1/8/38)7 (3)Original strain confirmed
124 382922.5:114 (18C)4 (19F)14 (18C)Original strain confirmed
a
The number of strains and their relative quantities in a given sample as determined by plyNCR RFLP and T-RFLP.
b
Serotype for the dominant strain identified by direct swab analysis was inferred from serotyping of the (dominant) strain identified by culture if they showed identical RFLP types. For sample 122 6470, the strain identified by culture corresponded to an additional strain and not to the dominant strain identified by plyNCR RFLP.
c
RFLP types of additional strains were inferred after subtraction analysis of banding patterns as explained in the text and the Fig. 2C legend. For sample 122 6470, the RFLP type of the third strain could not be determined unequivocally; possible types were 1, 3, 17, 18, and 19. Serotypes of additional strains were predicted based on database analysis of RFLP types and associated serotypes, and for samples 123 5037 and 123 5697, the predicted serotype could be confirmed by serotyping of subcultures from frozen stock of the cultured strains.

Acknowledgments

This study was supported by the Swiss National Science Foundation (research grant 320000-113912 to K.M. and M.D.-Ph.D. scholarship 323500-119214 to S.B.).
We thank Mary Voytek and Julie Kirshtein, U.S. Geological Survey, Reston, Virginia, and Marco Pirotta, Applied Biosystems, Switzerland, for advice on T-RFLP.

REFERENCES

1.
Abdullahi, O., E. Wanjiru, R. Musyimi, N. Glass, and J. A. Scott. 2007. Validation of nasopharyngeal sampling and culture techniques for detection of Streptococcus pneumoniae in children in Kenya. J. Clin. Microbiol.45:3408-3410.
2.
Billal, D. S., M. Hotomi, M. Suzumoto, K. Yamauchi, J. Arai, T. Katsurahara, S. Moriyama, K. Fujihara, and N. Yamanaka. 2008. Determination of pneumococcal serotypes/genotypes in nasopharyngeal secretions of otitis media children by multiplex PCR. Eur. J. Pediatr.167:401-407.
3.
Bogaert, D., R. H. Veenhoven, M. Sluijter, E. A. Sanders, R. de Groot, and P. W. Hermans. 2004. Colony blot assay: a useful method to detect multiple pneumococcal serotypes within clinical specimens. FEMS Immunol. Med. Microbiol.41:259-264.
4.
Bronsdon, M. A., K. L. O'Brien, R. R. Facklam, C. G. Whitney, B. Schwartz, and G. M. Carlone. 2004. Immunoblot method to detect Streptococcus pneumoniae and identify multiple serotypes from nasopharyngeal secretions. J. Clin. Microbiol.42:1596-1600.
5.
Brueggemann, A. B., R. Pai, D. W. Crook, and B. Beall. 2007. Vaccine escape recombinants emerge after pneumococcal vaccination in the United States. PLoS Pathog.3:e168.
6.
Dunbar, J., L. O. Ticknor, and C. R. Kuske. 2001. Phylogenetic specificity and reproducibility and new method for analysis of terminal restriction fragment profiles of 16S rRNA genes from bacterial communities. Appl. Environ. Microbiol.67:190-197.
7.
Fogarty, L. R., and M. A. Voytek. 2005. Comparison of Bacteroides-Prevotella 16S rRNA genetic markers for fecal samples from different animal species. Appl. Environ. Microbiol.71:5999-6007.
8.
Gray, B. M., G. M. Converse III, and H. C. Dillon, Jr. 1980. Epidemiologic studies of Streptococcus pneumoniae in infants: acquisition, carriage, and infection during the first 24 months of life. J. Infect. Dis.142:923-933.
9.
Hare, K. M., P. Morris, H. Smith-Vaughan, and A. J. Leach. 2008. Random colony selection versus colony morphology for detection of multiple pneumococcal serotypes in nasopharyngeal swabs. Pediatr. Infect. Dis. J.27:178-180.
10.
Hathaway, L. J., S. Brugger, A. Martynova, S. Aebi, and K. Muhlemann. 2007. Use of the Agilent 2100 bioanalyzer for rapid and reproducible molecular typing of Streptococcus pneumoniae. J. Clin. Microbiol.45:803-809.
11.
Hathaway, L. J., P. Stutzmann Meier, P. Battig, S. Aebi, and K. Muhlemann. 2004. A homologue of aliB is found in the capsule region of nonencapsulated Streptococcus pneumoniae. J. Bacteriol.186:3721-3729.
12.
Hinds, J., K. Gould, A. Witney, L. Lambertsen, M. Antonio, D. Aanensen, and S. Bentley. 2008. Abstr. S04-O3, p.47. Abstr. 6th Int. Symp. Pneumococci Pneumococcal Dis. (ISPPD-6), Reykjavik, Iceland.
13.
Huebner, R. E., R. Dagan, N. Porath, A. D. Wasas, and K. P. Klugman. 2000. Lack of utility of serotyping multiple colonies for detection of simultaneous nasopharyngeal carriage of different pneumococcal serotypes. Pediatr. Infect. Dis. J.19:1017-1020.
14.
Kitts, C. L. 2001. Terminal restriction fragment patterns: a tool for comparing microbial communities and assessing community dynamics. Curr. Issues Intest. Microbiol.2:17-25.
15.
Kontiokari, T., M. Renko, T. Kaijalainen, L. Kuisma, and M. Leinonen. 2000. Comparison of nasal swab culture, quantitative culture of nasal mucosal tissue and PCR in detecting Streptococcus pneumoniae carriage in rats. APMIS108:734-738.
16.
Kronenberg, A., P. Zucs, S. Droz, and K. Muhlemann. 2006. Distribution and invasiveness of Streptococcus pneumoniae serotypes in Switzerland, a country with low antibiotic selection pressure, from 2001 to 2004. J. Clin. Microbiol.44:2032-2038.
17.
Lipsitch, M. 1999. Bacterial vaccines and serotype replacement: lessons from Haemophilus influenzae and prospects for Streptococcus pneumoniae. Emerg. Infect. Dis.5:336-345.
18.
Lipsitch, M. 1997. Vaccination against colonizing bacteria with multiple serotypes. Proc. Natl. Acad. Sci. USA94:6571-6576.
19.
Marsh, T. L. 1999. Terminal restriction fragment length polymorphism (T-RFLP): an emerging method for characterizing diversity among homologous populations of amplification products. Curr. Opin. Microbiol.2:323-327.
20.
Marsh, T. L., P. Saxman, J. Cole, and J. Tiedje. 2000. Terminal restriction fragment length polymorphism analysis program, a web-based research tool for microbial community analysis. Appl. Environ. Microbiol.66:3616-3620.
21.
Meier, P. S., S. Utz, S. Aebi, and K. Muhlemann. 2003. Low-level resistance to rifampin in Streptococcus pneumoniae. Antimicrob. Agents Chemother.47:863-868.
22.
Morrison, K. E., D. Lake, J. Crook, G. M. Carlone, E. Ades, R. Facklam, and J. S. Sampson. 2000. Confirmation of psaA in all 90 serotypes of Streptococcus pneumoniae by PCR and potential of this assay for identification and diagnosis. J. Clin. Microbiol.38:434-437.
23.
Muhlemann, K., H. C. Matter, M. G. Tauber, and T. Bodmer. 2003. Nationwide surveillance of nasopharyngeal Streptococcus pneumoniae isolates from children with respiratory infection, Switzerland, 1998-1999. J. Infect. Dis.187:589-596.
24.
O'Brien, K. L., E. V. Millar, E. R. Zell, M. Bronsdon, R. Weatherholtz, R. Reid, J. Becenti, S. Kvamme, C. G. Whitney, and M. Santosham. 2007. Effect of pneumococcal conjugate vaccine on nasopharyngeal colonization among immunized and unimmunized children in a community-randomized trial. J. Infect. Dis.196:1211-1220.
25.
Osborn, A. M., E. R. Moore, and K. N. Timmis. 2000. An evaluation of terminal-restriction fragment length polymorphism (T-RFLP) analysis for the study of microbial community structure and dynamics. Environ. Microbiol.2:39-50.
26.
Rivera-Olivero, I., M. Blommaart, D. Bogaert, P. Hermans, and J. De Waard. 2008. Abstr. S05-O4, p. 51. Abstr. 6th Int. Symp. Pneumococci Pneumococcal Dis. (ISPPD-6), Reykjavik, Iceland.
27.
Sa-Leao, R., A. Tomasz, I. Santos Sanches, and H. de Lencastre. 2002. Pilot study of the genetic diversity of the pneumococcal nasopharyngeal flora among children attending day care centers. J. Clin. Microbiol.40:3577-3585.
28.
Stralin, K., E. Tornqvist, M. S. Kaltoft, P. Olcen, and H. Holmberg. 2006. Etiologic diagnosis of adult bacterial pneumonia by culture and PCR applied to respiratory tract samples. J. Clin. Microbiol.44:643-645.
29.
Wang, Q., M. Wang, F. Kong, G. L. Gilbert, B. Cao, L. Wang, and L. Feng. 2007. Development of a DNA microarray to identify the Streptococcus pneumoniae serotypes contained in the 23-valent pneumococcal polysaccharide vaccine and closely related serotypes. J. Microbiol. Methods68:128-136.
30.
Whatmore, A. M., A. Efstratiou, A. P. Pickerill, K. Broughton, G. Woodard, D. Sturgeon, R. George, and C. G. Dowson. 2000. Genetic relationships between clinical isolates of Streptococcus pneumoniae, Streptococcus oralis, and Streptococcus mitis: characterization of “atypical” pneumococci and organisms allied to S. mitis harboring S. pneumoniae virulence factor-encoding genes. Infect. Immun.68:1374-1382.

Information & Contributors

Information

Published In

cover image Journal of Clinical Microbiology
Journal of Clinical Microbiology
Volume 47Number 6June 2009
Pages: 1750 - 1756
PubMed: 19386843

History

Received: 29 September 2008
Revision received: 12 March 2009
Accepted: 9 April 2009
Published online: 1 June 2009

Permissions

Request permissions for this article.

Contributors

Authors

Silvio D. Brugger
Institute for Infectious Diseases, University of Bern, Bern, Switzerland
Lucy J. Hathaway
Institute for Infectious Diseases, University of Bern, Bern, Switzerland
Kathrin Mühlemann [email protected]
Institute for Infectious Diseases, University of Bern, Bern, Switzerland
Department of Infectious Diseases, University Hospital, Bern, Switzerland

Metrics & Citations

Metrics

Note:

  • For recently published articles, the TOTAL download count will appear as zero until a new month starts.
  • There is a 3- to 4-day delay in article usage, so article usage will not appear immediately after publication.
  • Citation counts come from the Crossref Cited by service.

Citations

If you have the appropriate software installed, you can download article citation data to the citation manager of your choice. For an editable text file, please select Medlars format which will download as a .txt file. Simply select your manager software from the list below and click Download.

View Options

Figures and Media

Figures

Media

Tables

Share

Share

Share the article link

Share with email

Email a colleague

Share on social media

American Society for Microbiology ("ASM") is committed to maintaining your confidence and trust with respect to the information we collect from you on websites owned and operated by ASM ("ASM Web Sites") and other sources. This Privacy Policy sets forth the information we collect about you, how we use this information and the choices you have about how we use such information.
FIND OUT MORE about the privacy policy