Using Molecular Epidemiology To Trace Transmission of Nosocomial Norovirus Infection

Data on norovirus-positive cases diagnosed between 2002 and 2007 were retrieved from the database of the hospital laboratory and grouped as nosocomial cases, outpatient cases, and community-acquired cases (1). We used a conservative estimate to ensure high specificity by considering the possibility of nosocomial transmission only if a patient was diagnosed with NoV infection for the first time >4 days after admission. Patients who tested positive for NoV 0 to 1 day after admission were defined as having community-acquired cases. Patients with NoV-positive stools diagnosed 2 to 4 days after hospitalization were classified as indeterminate. On the basis of the >4-day cutoff, 22 nosocomial clusters had previously been obtained using epidemiological criteria (defined as ≥2 patients with nosocomial infection with NoV on the same ward within 5 days) (1). Background data listing the age of the patient, sex of the patient, ward where the patient was hospitalized, date of hospitalization, and date of onset of diarrhea were drawn from the hospital database. This extraction was done by an authorized person who also made the records anonymous prior to use by the research team, in compliance with regulations on use of patient data.

Stored fecal specimens (stored at −80°C) were retrieved, viral RNA was extracted, and strains were typed using a two-step approach. First, viruses were assigned to a genotype by sequencing region A of the polymerase gene (22). Subsequently, the corresponding P2 domains in the capsid gene were sequenced, using a specific P2 primer set for each genotype (24). This approach was necessary because the genetic diversity of norovirus P2 regions is so high that a single set of primers has an inherently low sensitivity.

Fecal samples were suspended (200 mg/200 μl) in Hanks' medium (800 μl) containing penicillin and were clarified for 30 min at 3,000 rpm and 4°C (8,000 relative centrifugal force [RCF]; Eppendorf 4515R centrifuge). Two hundred microliters of the supernatant was transferred to a Magna Pure LC plate for reverse transcription-PCR (RT-PCR) (total nucleic acid extraction program, performed according to the manufacturer's instructions) with an elution volume of 50 μl (Roche Diagnostics GmbH). For genotyping, 20 μl of RNA extract was reverse transcribed to cDNA with random hexamers by use of a MultiScribe reverse transcriptase kit (Applied Biosystems) according to the manufacturer's instructions. All of the obtained threshold cycle (C_T) values in our study correspond with real-time PCR results, as previously mentioned (1).

A seminested PCR was performed on the polymerase region (region A) to type the NoV strains. First-round PCRs were performed with the primer set FW-JV12 (ATACCACTATGATGCAGATTA) and COGREV (TCGACGCCATCTTCATTCACA) (10); 10 μl cDNA was added to a 40-μl reaction mix containing 5 μl PCR buffer, 1 μl (each) of forward and reverse primers (70 pmol), 2 μl MgCl₂, 29.5 μl Adest, 1 μl deoxynucleoside triphosphates (dNTPs) (10 mM), and 0.5 μl Hotstart Taq polymerase (2 units). The second-round PCR (seminested) was performed with primer set JV12-FW and JV15-REV (CTCATCCAYCTRAACATNGNYTCYTG). Two microliters of the first PCR product was added to a 48-μl reaction mix containing 5 μl PCR buffer, 1 μl (each) of forward and reverse primers (70 pmol), 2 μl MgCl₂, 37.5 μl Adest, 1 μl dNTPs (10 mM), and 0.5 μl Hotstart Taq polymerase (2 units). Both PCRs were performed using a Gene Amp 9700 thermal cycler (Applied Biosystems) under the following cycling conditions: 96°C for 15 min, 40 cycles of 96°C, 52°C, and 72°C for 1 min each, and 72°C for 10 min. PCR products were loaded on 2% agarose gels (stained with Syber Safe). When the target band was observed (approximately 650 bp), the PCR products were purified with ExoSAP-IT (USB Corporation, Cleveland, OH) (2 μl ExoSAP-IT for 5 μl PCR product), followed by sequencing with the same primers used for PCR, using the ABI Prism BigDye Terminator 3.1 approach (Applied Biosystems model 3730 DNA analyzer), with denaturation at 96°C for 10 s and 25 cycles of 96°C for 10 s, 50°C for 5 s, and 60°C for 4 min. After assignment of the genotype, type-specific primers were used to sequence a 794- to 818-nucleotide (nt) target covering the P2 domain (24). This was done only for the two most common genotypes, GII.3 and GII.4, for which sufficient background data were available for sequence similarity comparisons. Primers and PCR conditions were as described previously (24).

The obtained sequences were entered and aligned in Bionumerics (software package 5.1; Applied Maths) and were typed with a genotyping tool for noroviruses (http://www.rivm.nl/mpf/norovirus/typingtool). The sequences were connected with the available background data file listing age, sampling date, date of discharge from the hospital, and location (ward) where the patient stayed while hospitalized (19). The P2 domain sequences, with an average length of 550 nt, were compared using the neighbor-joining method (TREECON for Windows) to identify patients who had identical sequences in order to create molecular clusters. Sets of identical sequences were defined as clusters (Fig. 1). The community-acquired cases not only served as background sequence data in the comparison but also were used to link with nosocomial cases in order to detect the introduction of strains into the hospital.

To test for differences in proportions of nosocomial infection, the following steps were taken. First, the proportion of nosocomial cases within all cases (based on the cutoff of onset of norovirus illness >4 days after admission) was calculated for the genotype categories GII.4, GII.7, GII.3, remaining genotypes, and unknown. These were calculated separately for young children (0 to 5 years) and the remainder of patients (>5 years), as young children are potentially at increased risk for norovirus infection and therefore virus introduction into a hospital is more common for this age group. In these calculations, we excluded patients who had been diagnosed between 2 and 4 days after hospitalization, as the distinction between hospital-acquired and community-acquired infection was not always possible (n = 44). Second, using the chi-square test of independence, we tested whether the proportion of nosocomial infection was independent of (i) genotype, within each age group; (ii) age, within each genotype; (iii) genotype, within all ages; and (iv) age, within all genotypes. Because we were testing multiple hypotheses (nine in total), we needed to adjust the chi-square P values to control for false discoveries. We used the Benjamini-Hochberg method, as this method has more power than other Bonferroni-type procedures (2). A relationship was considered significant if the adjusted P value did not exceed 0.05.

Based on clustering of cases in time and place (two or more cases on the same ward within a 5-day interval), 22 clusters were previously identified in the original data set (1). Viruses from the two major genotypes of NoV (GII.4 and GII.3) were analyzed further. Sequence comparison of amplified P2 domains showed nine clusters of GII.4 strains, involving 17 different patients, and five clusters of GII.3 strains, involving 8 different patients (Fig. 1 and Table 3). Of the molecular clusters, three (two GII.3 and one GII.4) had previously been identified through epidemiological observation, as shown in Table 3. The other 11 identified clusters of patients had not previously been identified as such. This was explained by the fact that all clusters included patients from different wards and ages. Remarkably, for 5 patients, this included a link with a patient who had visited the hospital outpatient care department but was not admitted (clusters 3, 6, 9, 10, and 14).