Prosthetic Valve Endocarditis with Bartonella washoensis in a Human European Patient and Its Detection in Red Squirrels (Sciurus vulgaris)

Mitral valve tissue was plated on Columbia blood agar and chocolate agar and incubated with 5% CO₂ for 4 weeks. DNA was extracted using a QIAamp DNA minikit (Qiagen, Hilden, Germany). A broad-range PCR targeting the 16S rRNA gene was performed as described previously (7). Blood cultures were held for 4 weeks, applying a Bactec blood culture system (BD Diagnostics, Heidelberg, Germany). Mitral valve tissue and serum were sent for histopathological analysis and quantification of specific antibodies by the use of an immunofluorescence test detecting anti-B. henselae and anti-B. quintana IgG and IgM.

The infecting agent was further characterized by amplification and bidirectional sequencing of six housekeeping genes (16S rRNA, ftsZ, gltA, groEL, ribC, and rpoB), applying a MLST approach described previously (8). For amplification of a larger part of the 16S rRNA gene, primers Bw16Sgesf (GCCAAATCGAATTTTCAATATG) and Bw16Sgesr (TCCAATTCTTGATCATCCTTAG) were newly designed. DNA (2 μl) was used as a template in a 50-μl reaction mixture containing 50 mM KCl, 20 mM Tris-HCl (pH 8.4), 2 mM MgCl₂, 0.2 mM deoxynucleoside triphosphates, a 0.4 μM concentration of each primer, and 0.2 μl (1 U) of Taq DNA polymerase (Invitrogen, Karlsruhe, Germany). The PCR was performed by the use of a model 2720 GeneAmp thermal cycler (Applied Biosystems, Darmstadt, Germany) under the following conditions: an initial denaturation at 94°C for 3 min, followed by 40 cycles of denaturation at 94°C for 30 s, annealing at 54°C for 30 s, extension at 72°C for 1 min 30 s, and a final extension at 72°C for 10 min. For bidirectional sequencing, primers Bw16Sseqf (TTAGTTGCCAGCATTCAGTTG) and Bw16Sseqr (GCTGCTGGCACGAAGTTAG) were used additionally. Because the BhCS781.p and BhCS1137.n primers described previously by Norman et al. (9) did not yield any product due to primer mismatches, new primers BwgltAgesf (AAGGATCTGAAAGGAATATCTA) and BwgltArmod (ACGCGCTGCATAGCCTGTAT) had to be developed for the amplification of gltA, taking into account the whole-genome shotgun sequences of B. washoensis available at GenBank (accession numbers UAQI01000040, NZ_JH725101, and NZ_JH725022). The PCR conditions were the same as described above, with the exception of an annealing step at 50°C for 30 s. For bidirectional sequencing, primers BwgltAf (AATCAATCCAGTGCTTACTCG) and BwgltAr (CTG CATAGCCTGTATAGAGTT) were used additionally.

B. washoensis strain human_1487_18 reported here was compared to 20 B. washoensis isolates collected from squirrels in North America and China, described earlier (8). Phylogenetic analysis was performed using the program MEGA X (10). The concatenated sequences of six housekeeping genes were aligned by ClustalW, applying the IUB matrix. Tree construction was achieved by the neighbor-joining method using the Jukes-Cantor model with the complete-deletion option. Bootstrap analysis was conducted with 1,000 replicates. Pairwise distances between the concatenated housekeeping gene sequences were computed by using the Jukes-Cantor matrix and applying the complete deletion option.

One of the tasks of the Dutch Wildlife Health Center in Utrecht is pathogen surveillance in wildlife. Therefore, the public was asked to report squirrels found dead to the center. Sixty-two red squirrels (S. vulgaris) that were submitted between 2015 and 2017 were investigated for the B. washoensis strain described here. Collection site, year of collection, age status, and sex of the squirrels are given in Table 1. The collection sites of the squirrels are illustrated in Fig. 1. DNA was isolated from the spleen using a DNeasy blood and tissue kit (Qiagen, Hilden, Germany). Because primers BwgltAgesf and BwgltArmod yielded unspecific products, primers BwgltAf and BwgltAr were applied for amplification and bidirectional sequencing under the conditions described above, with the exception of an extension at 72°C for 1 min. For phylogenetic analysis, the obtained gltA sequences were compared to sequences from the three human strains known so far and to sequences from squirrel strains collected in North America and China under the conditions described above.

The sequences detected here were submitted to GenBank and are available under the accession numbers MN220719 and MN229488 to MN229502. A MLST database for B. washoensis was established. It is hosted on PubMLST (https://pubmlst.org/databases/) and contains the allelic profiles of the human strain 1487_18 and of the 20 B. washoensis isolates from squirrels described earlier (8).

In 2013, a female German patient received a biological mitral valve prosthesis because of mitral insufficiency. In 2018, at the age of 75, she presented with chronic cardiac decompensation because of mitral valve stenosis. No clinical or echocardiographic signs of endocarditis were evident. The indication for mitral valve re-replacement was made. Intraoperatively, cauliflower-like plaques were observed on the mitral valve leaflets. Conventional culture from prosthetic valve tissue and blood cultures did not yield any growth. However, the result of broad-range PCR analysis of the prosthetic valve tissue was positive and the respective 16S rRNA gene sequence was 99.8% (410/411 bp) identical to that of B. washoensis strain 08S-0475 (GenBank accession number FJ719017) from the patient with meningitis mentioned above (5). The histopathological analysis was consistent with active endocarditis. IgG antibody titers of 1:2048 against B. henselae and of 1:256 against B. quintana were found, whereas anti-Bartonella IgM antibodies were not detected. The patient denied contact with animals and their ectoparasites. Treatment with doxycycline for 6 weeks and gentamicin for 2 weeks was recommended. Unfortunately, the patient died of unspecified reasons 4 months later.

The 16S rRNA gene sequence from the patient was amplified with specific primers (8) and was found to be 99.9% (1,347/1,349 bp) identical to that from a B. washoensis strain from a red squirrel (S. vulgaris orientis) from China (GenBank accession number AB519066). When the longer 16S rRNA gene sequence generated with primers Bw16Sgesf and Bw16Sgesr was compared to GenBank, an identity of 99.5% (1,474/1,481 bp without one gap) to an uncharacterized Bartonella sp. from a Daurian ground squirrel (Spermophilus dauricus) (GenBank accession number DQ641912) was detected.

The gltA sequence was found to be 99.7% identical to a sequence from a B. washoensis strain from a red squirrel (S. vulgaris orientis) in China (335/336 bp; GenBank accession number AB444974) and to a sequence from a strain described as Bartonella sp. from a red squirrel (S. vulgaris) in the United Kingdom (329/330 bp, GenBank accession number AF449760). Comparison of the longer gltA sequence amplified with primers BwgltAgesf and BwgltArmod to GenBank showed that no significant match was obtained (90.1% identity to B. henselae).

An observation similar to that received with the shorter gltA sequence was made for the groEL gene, showing identity of 99.6% (1,180/1,185 bp) to the strain from China (GenBank accession number AB519097) and identity of 98.6% (1,189/1,206 bp) to the strain from the United Kingdom (GenBank accession number AF449762).

ftsZ, ribC, and rpoB sequences were available at GenBank only for the Chinese strain. Results of comparisons showed that 785/788 bp (99.6%) of the ftsZ gene (GenBank accession number AB519080), 586/618 bp (94.8%) of the ribC gene (GenBank accession number AB519114), and 818/825 bp (99.2%) of the rpoB gene (GenBank accession number AB519129) of the B. washoensis strain described here were identical to the corresponding sequences from the red squirrel strain (S. vulgaris orientis) from China.

The patient strain described here was also compared to the two human B. washoensis isolates from North America (4, 5). Their 16S rRNA gene sequences were 99.6% identical to those from the European strain as follows: 1,406/1,412 bp (without one gap) of human isolate NVH1 (GenBank accession number AF070463) and 1,318/1,323 (without one gap) of human isolate 08S-0475 (GenBank accession number FJ719017). A higher level of diversity was evident in the gltA and groEL sequences. For gltA, identity of 94.4% (319/338 bp) was observed for isolate NVH1 (GenBank accession number AF050108) and identity of 92.6% (311/316 bp) for isolate 08S-0475 (GenBank accession number FJ719016). A similar observation was made for groEL, with identity to the European patient strain of 93.6% (1,264/1,350 bp without six gaps) for isolate NVH1 (GenBank accession number AF071193) and identity of 95.2% (511/537 bp) for isolate 08S-0475 (GenBank accession number FJ695137).

The six housekeeping genes (16S rRNA, ftsZ, gltA, groEL, ribC, and rpoB) were concatenated in frame (5,097 bp) and compared to those from 20 B. washoensis strains from squirrels from North America and China reported earlier (8), and the results showed that the strain described here formed a separate cluster with red squirrel strain ER14-3 from China mentioned above (Fig. 2).

The 5,097 bp of the concatenated housekeeping gene sequence from the patient were 99.0% identical to the red squirrel (S. vulgaris orientis) strain from China. The 1,537 bp of the concatenated gltA and groEL sequences of red squirrel strain SC12uk from the United Kingdom mentioned above were compared to the B. washoensis strain described here, and the identity was found to be 98.8%.

The analyses showed that 2,185 bp of the concatenated 16S, gltA, and groEL sequences of the two human strains from North America, NVH1 (4) and 08S-0475 (5), were 99.6% identical to each other. Compared to European B. washoensis strain human_1487_18 described here, the identity was 97.5% for both North American isolates.

A total of 39% (24/62) red squirrel (S. vulgaris) spleen samples were positive for B. washoensis in experiments in which primers BwgltAf and BwgltAr, which amplify 584 bp (without primers) of the gltA gene, were used. Notably, primers BhCS781.p (four mismatches, one of them near the 3′ end) and BhCS1137.n (one mismatch), previously described by Norman et al. (9), did not yield any product because of mispriming. Ten positive PCR products were randomly chosen and bidirectionally sequenced. The respective sequences were 100% identical to each other and to the patient’s sequence.

For phylogenetic analysis, this unique European gltA sequence was compared to B. washoensis gltA sequences from humans and squirrels from North America and China (Fig. 3). Strains from red squirrels (S. vulgaris) and the European patient were separated (with high bootstrap support of 100%) from those from Californian ground squirrels (S. beecheyi) and the two North American patients. However, the significance of this conclusion is limited, because the final data set contained only 320 bp due to the different lengths of the gltA sequences available.