Free access
Brief Report
20 July 2015

Development and Evaluation of Novel Real-Time Reverse Transcription-PCR Assays with Locked Nucleic Acid Probes Targeting Leader Sequences of Human-Pathogenic Coronaviruses

ABSTRACT

Based on findings in small RNA-sequencing (Seq) data analysis, we developed highly sensitive and specific real-time reverse transcription (RT)-PCR assays with locked nucleic acid probes targeting the abundantly expressed leader sequences of Middle East respiratory syndrome coronavirus (MERS-CoV) and other human coronaviruses. Analytical and clinical evaluations showed their noninferiority to a commercial multiplex PCR test for the detection of these coronaviruses.

TEXT

Coronaviruses (CoVs) have repeatedly crossed species barriers, and some have emerged as important human pathogens (1, 2). Human coronavirus (HCoV)-229E, HCoV-OC43, HCoV-NL63, and HCoV-HKU1 predominantly cause mild upper respiratory tract infections, while severe acute respiratory syndrome CoV (SARS-CoV) and Middle East respiratory syndrome CoV (MERS-CoV) frequently cause severe pneumonia with extrapulmonary manifestations (36). Highly sensitive and specific laboratory diagnostic tests are essential for the control of emerging CoV outbreaks (7). The gold standard for the laboratory diagnosis of CoV infection is the isolation of infectious virus from the respiratory tract and/or other clinical specimens. However, most CoVs are either difficult or dangerous to culture in cell lines (8, 9). The need for convalescent-phase samples and potential false-positive results due to cross-reactivity with other CoVs limit the use of serum antibody detection assays in the acute setting (10). The overall sensitivity of antigen detection assays is inferior to that of molecular assays such as reverse transcription (RT)-PCR (11, 12). With the increasing availability of molecular diagnostic facilities and expertise in clinical microbiology laboratories worldwide, RT-PCR has become the test of choice for diagnosing CoV infections (7, 1315).
Traditionally, the preferred targets of RT-PCR assays are genes that are conserved and/or abundantly expressed from the viral genome (16). For CoVs, the most commonly employed targets include the structural nucleocapsid (N) and spike (S) genes, and the nonstructural RNA-dependent RNA polymerase (RdRp) and replicase ORF1a/b genes (4, 7). Recently, other unique noncoding genome regions not present in related CoVs have also been utilized to develop an RT-PCR for the emerging MERS-CoV (7, 1315). The World Health Organization (WHO) recommends using the upE assay (regions upstream of the envelope [E] gene) for laboratory screening of suspected MERS cases, followed by confirmation with either the ORF1a or ORF1b assay (7). Notably, a number of single nucleotide mismatches at different positions included in the upE assay forward primer and probe have been detected in recent strains of MERS-CoV and may affect the sensitivity of this assay (17). We hypothesize that additional gene targets may be suitable for design of RT-PCR assays for CoVs and would increase the options of molecular diagnosis for circulating and emerging CoV infections. In this study, we designed and evaluated novel real-time RT-PCR assays with locked nucleic acid (LNA) probes for clinically important CoVs based on the identification of the abundantly expressed leader sequence in the 5′-untranslated region (UTR) in small RNA-sequencing (Seq) data analysis.
We included MERS-CoV (strain HCoV-EMC/2012, passage 8, provided by Ron Foucheir, Erasmus Medical Center), HCoV-229E, HCoV-OC43, HCoV-NL63, and HCoV-HKU1 in the study. SARS-CoV was not included as there has not been any human case since 2005. The MERS-CoV isolate was amplified by one additional passage in Vero cells to make working stocks of the virus (5.62 × 105 50% tissue culture infective doses [TCID50]/ml) as previously described (18). All experimental protocols involving live MERS-CoV followed the approved standard operating procedures of the biosafety level 3 facility at the Department of Microbiology, The University of Hong Kong, as previously described (19). High-titer stocks of HCoV-229E, HCoV-OC43, and other respiratory viruses were prepared, and their TCID50 values were determined using standard methods as previously described (20, 2123). Attempts to culture HCoV-NL63 and HCoV-HKU1 were unsuccessful because of their difficulty in growing in the cell lines available in our laboratories. Virus-positive clinical specimens (n = 14) and laboratory strains (n = 13) used for evaluating cross-reactivities with other respiratory viruses in the novel assays were obtained from nasopharyngeal aspirates archived at the clinical microbiology laboratory at Queen Mary Hospital, Hong Kong. Total nucleic acid extractions of clinical specimens and laboratory cell culture with virus strains were performed on 200 μl of sample using an EZ1 virus minikit v2.0 (Qiagen) according to the manufacturer's instructions. The elution volume was 60 μl. Extracts were stored at −70°C or below until use. Total nucleic acid extracts of ResPlex-II HCoV-positive (n = 49) and -negative (n = 180) respiratory clinical specimens prepared by using the QIAamp MinElute virus spin kit were provided by the Hong Kong Sanatorium and Hospital. A total of 229 fresh or frozen nasopharyngeal aspirates (NPAs) collected between 1 January 2012 and 31 October 2014 from 229 pediatric and adult patients, including 128 males and 101 females, aged 1 to 97 years, who were managed in Queen Mary Hospital and Hong Kong Sanatorium and Hospital for upper and/or lower respiratory tract symptoms were included in the study. The study was approved by the Institutional Review Board of The University of Hong Kong/Hospital Authority Hong Kong West Cluster.
The most abundantly expressed sequence in the MERS-CoV genome was determined by small RNA-Seq data analysis (see the supplemental material). Approximately 2.6% of the trimmed reads could be mapped onto the MERS-CoV genome. Among the mapped sequences, the mapping analysis revealed that most of these small RNA sequence reads, accounting for >6,000 sequences (6.3%), matched the 67-nucleotide leader sequence at the 5′ terminus of the genome (Fig. 1). In contrast, the other peaks at the ORF1a, S, and N gene regions accounted for <3.0% of the mapped small RNA sequence reads. Our mapping analysis also showed that the percentages of mapped small RNA sequence reads at the gene regions targeted by the previously described upE, ORF1a, ORF1b, N2, N3, NSeq, and RdRpSeq assays, which had longer sequences than the 67-nucleotide MERS-CoV leader sequence, were only 0.2%, 0.1%, <0.1%, 0.3%, 0.1%, 2.8%, and 0.2%, respectively (13, 14, 24). HCoV-229E, HCoV-OC43, HCoV-NL63, and HCoV-HKU1 similarly possess 70- to 72-nucleotide leader sequences at the same region in their respective genomes (Fig. 1) (2528). Although leader sequences of around 60 to 90 nucleotides in length are found at the 5′-UTR upstream to the transcription regulatory sequence in the genomes and at the subgenomic RNAs of all CoVs, the function of these leader sequences remains poorly understood (2931). In view of the abundance of the leader sequences and since infected cells are known to contain large amounts of viral subgenomic RNA at which the leader sequences are abundantly found (32, 33), we hypothesized that the leader sequence might be a valuable diagnostic target not only for MERS-CoV but also for other currently circulating HCoVs (Fig. 1).
FIG 1
FIG 1 Schematic diagram of the MERS-CoV genome, with the leader sequence at the 5′-untranslated region enlarged to illustrate the abundance of the small RNA sequences. The percentages of mapped small RNA sequence reads at the leader sequence, ORF1a, S, and N gene regions are quantified and shown. Leader sequences of 70 to 72 nucleotides in length are also present in other human coronaviruses (HCoV-229E, HCoV-OC43, HCoV-NL63, and HCoV-HKU1).
To overcome the relatively short length of the leader sequences, we employed LNA probes (Exiqon, Copenhagen, Denmark) to develop novel real-time RT-PCR assays for these human-pathogenic CoVs. LNA is a nucleic acid analogue with an extra bridge connecting the 2′ oxygen and 4′ carbon that has exceptionally high hybridization affinity toward cDNA and RNA and efficient mismatch discrimination (34). These properties are associated with an increased melting temperature of the oligonucleotides, which allows the application of shorter probes when LNA rather than DNA nucleotides are used in the nucleic acid amplification assays (34). In recent years, LNA probes have been increasingly used in the design of real-time PCR assays for other respiratory infections such as those caused by avian influenza A/H5N1 virus, rhinovirus, enteroviruses, respiratory syncytial virus, and Mycoplasma pneumoniae (3538). Using LNA probes, we developed five novel real-time RT-PCR assays (named MERS-CoV-LS, HCoV-229E-LS, HCoV-OC43-LS, HCoV-NL63-LS, and HCoV-HKU1-LS) targeting the short leader sequences of these CoVs (Table 1).
TABLE 1
TABLE 1 Primer and probe sequences of CoV real-time RT-PCR assays with LNA probes in the present studya
AssaybGenome targetNucleotide position in genomePrimer/probeSequence (5′ to 3′)GenBank accession no.
MERS-CoV-LSLeader sequence14–32ForwardAGCTTGGCTATCTCACTTCJX869059.2
  47–69ReverseAGTTCGTTAAAATCAAAGTTCTG 
  34–47ProbeC+CT+CGT+T+CT+CT+TGC 
HCoV-229E-LSLeader sequence20–41ForwardCTACAGATAGAAAAGTTGCTTTNC_002645.1
  57–75ReverseggTCGTTTAGTTGAGAAAAGT 
  44–59ProbeAGACT+T+TG+TG+TCT+A+CT 
HCoV-OC43-LSLeader sequence17–28ForwardaaaCGTGCGTGCATCNC_005147.1
  43–66ReverseAGATTACAAAAAGATCTAACAAGA 
  32–48ProbeC+TTCA+CTG+ATCT+C+T+TGT 
HCoV-NL63-LSLeader sequence23–46ForwardggAGATAGAGAATTTTCTTATTTAGANC_005831.2
  60–77ReverseggTTTCGTTTAGTTGAGAAG 
  50–66ProbeTGTGT+C+TAC+T+C+TTCT+CA 
HCoV-HKU1-LSLeader sequence21–37ForwardCGTACCGTCTATCAGCTNC_006577.2
  48–71ReverseGTTTAGATTTAATGAGATCTGACA 
  39–52ProbeACGA+T+CT+C+TTG+T+CA 
a
Probes were labeled at the 5′ end with the reporter molecule 6-carboxyfluorescein (6-FAM) and at the 3′ end with Iowa Black FQ (Integrated DNA Technologies, Inc.). Lowercase letters represent the additional bases added which are not from the original genome sequence. The letters following “+” represent LNA bases which are modified with an extra bridge connecting the 2′ oxygen and 4′ carbon. The bridge “locks” the ribose in the 3′-endo (north) conformations and significantly increases the hybridization properties of the probe.
b
HCoV, human coronavirus; MERS-CoV, Middle East respiratory syndrome coronavirus.
The analytical sensitivities and specificities of the assays were excellent. The limits of detection with in vitro RNA transcripts for MERS-CoV-LS, HCoV-229E-LS, and HCoV-OC43-LS were 10 RNA copies/reaction and those for HCoV-NL63-LS and HCoV-HKU1-LS were 5 RNA copies/reaction. Linear amplification was achieved over an 8-log dynamic range, from 101 to 108 RNA copies/reaction for all five assays, with calculated linear correlation coefficients (R2) of 0.99 to 1.00 and amplification efficiency values of 1.93 to 2.27. The limits of detection with viral RNA were approximately 5.62 × 10−2 TCID50/ml, 5.00 × 10−2 TCID50/ml, and 3.16 × 10−3 TCID50/ml for MERS-CoV-LS, HCoV-229E-LS, and HCoV-OC43-LS, respectively (see Tables S1 and S2 in the supplemental material). The limit of detection for the MERS-CoV-LS assay was about 1 log TCID50/ml higher than that for the MERS-CoV upE assay in parallel runs and was comparable with those for the other assays currently recommended for screening and/or confirmation of MERS by the WHO, including the ORF1a, ORF1b, RdRpSeq, and NSeq assays (see Table S1 in the supplemental material) (7, 14). Comparatively, the ORF1b assay for MERS-CoV has the least optimal limit of detection of 64 RNA copies/reaction (13, 14). Our assays showed no cross-reactivity among the individual CoVs and with other common respiratory viruses, including adenovirus, influenza A and B viruses, parainfluenza virus types 1 to 4, rhinovirus, respiratory syncytial virus, and human metapneumovirus (see Table S3 in the supplemental material).
Additionally, we assessed the diagnostic performance of our assays and compared it with that of ResPlex-II in in-use evaluation using 229 NPAs. ResPlex-II is a commercially available multiplex PCR assay which detects 18 respiratory viruses, including HCoV-229E, HCoV-OC43, HCoV-NL63, and HCoV-HKU1 in a single run. It is commonly employed for the laboratory diagnosis of viral respiratory tract infections in many clinical laboratories worldwide (39, 40). Forty-nine NPAs which tested positive for HCoVs by ResPlex-II and another 180 NPAs which tested negative for respiratory viruses by ResPlex-II (Table 2) were tested in an operator-blinded manner. All 49 (100%) ResPlex-II HCoV-positive NPAs tested positive for the corresponding HCoVs in our assays with viral loads of 1.37 × 101 to 3.86 × 108 RNA copies/reaction (Table 2) (P = 1.00; Fisher's exact test). Moreover, our assays detected HCoVs in an additional 4/180 (2.2%) NPAs which initially tested negative by ResPlex-II, probably because of the low viral loads of 2.29 × 101 to 2.40 × 102 RNA copies/reaction (P = 0.12; Fisher's exact test). Sequencing analysis and two-step confirmatory real-time RT-PCR assays using specific primers targeting the N gene of HCoV-OC43 and HCoV-NL63 (see the supplemental material) confirmed that the results for these four ResPlex-II HCoV-negative specimens concurred with their CoV real-time RT-PCR assay results (two were positive for HCoV-OC43 and two were positive for HCoV-NL63). Overall, these results suggest that our assays are highly sensitive and specific and not inferior to ResPlex-II for the detection of HCoVs in vitro and in clinical samples. It is important to note that while ResPlex-II and other multiplex PCR assays have the advantage of being able to detect multiple viruses simultaneously, the sensitivity may be <50% and inferior to that of monoplex PCR assays for HCoVs and other respiratory viruses such as influenza A viruses (39, 41). This relatively poorer sensitivity would especially limit the application of these multiplex PCR assays for the detection of future emerging CoVs and avian influenza A viruses, which are potential pandemic agents that might have a significant public health impact if a case was misdiagnosed.
TABLE 2
TABLE 2 Comparison between CoV real-time RT-PCR assays with LNA probes and ResPlex-II for the detection of CoVs in nasopharyngeal aspirates
AssayResPlex-II HCoV-positive NPAsa (n = 49)bResplex-II HCoV-negative NPAs (n = 180)b
HCoV-229EHCoV-OC43HCoV-NL63HCoV-HKU1
MERS-CoV-LS0/10/170/270/40/180
HCoV-229E-LS1/1 (1.64 × 104)0/170/270/40/180
HCoV-OC43-LS0/117/17 (1.37 × 101−3.86 × 108)0/270/42/180 (1.84 × 102−2.40 × 102)
HCoV-NL63-LS0/10/1727/27 (9.20 × 102−3.47 × 107)0/42/180 (2.29 × 101−9.34 × 101)
HCoV-HKU1-LS0/10/170/274/4 (1.94 × 103−4.42 × 105)0/180
a
NPAs, nasopharyngeal aspirates.
b
Values in parentheses represent the ranges of quantitative results of positive samples in RNA copies/reaction.
Our study has demonstrated the previously unknown diagnostic value of the CoV leader sequence and the usefulness of small RNA-Seq data analysis in the selection of optimal gene targets for the development of molecular diagnostic assays. The application of LNA probes allowed the use of relatively short sequences such as the leader sequence of CoV genomes as a diagnostic target in RT-PCR assays. The same approach may be applied to identify and design real-time RT-PCR assays for other emerging viruses, including novel CoVs that are likely to emerge in the future, once their genomic data become available. As for any other gene targets used in RT-PCR assays, particular attention should be paid to the presence of polymorphisms in the leader sequences, which may affect the sensitivity of the assays. The novel CoV real-time RT-PCR assays with LNA probes described in the present study should be further evaluated in large-scale in-field evaluations. The development of these assays into multiplex assays with comparable sensitivity and specificity and additional detection of other novel or reemerging CoVs may further enhance their clinical utility.

ACKNOWLEDGMENTS

We thank Johnson Lau and Manson Fok for their facilitation of the study.
This work was supported in part by the donations of Respiratory Viral Research Foundation Limited, Larry Chi-Kin Yung, and the Hui Hoy and Chow Sin Lan Charity Fund Limited and by funding from the Consultancy Service for Enhancing Laboratory Surveillance of Emerging Infectious Disease of the Department of Health, Hong Kong Special Administrative Region, China, the University Development Fund, and the Committee for Research and Conference Grant, The University of Hong Kong.
We declare no conflicts of interest.

Supplemental Material

File (zjm999094390so1.pdf)
ASM does not own the copyrights to Supplemental Material that may be linked to, or accessed through, an article. The authors have granted ASM a non-exclusive, world-wide license to publish the Supplemental Material files. Please contact the corresponding author directly for reuse.

REFERENCES

1.
Chan JF, To KK, Tse H, Jin DY, Yuen KY. 2013. Interspecies transmission and emergence of novel viruses: lessons from bats and birds. Trends Microbiol 21:544–555.
2.
Chan JF, To KK, Chen H, Yuen KY. 2015. Cross-species transmission and emergence of novel viruses from birds. Curr Opin Virol 10:63–69.
3.
Zaki AM, van Boheemen S, Bestebroer TM, Osterhaus AD, Fouchier RA. 2012. Isolation of a novel coronavirus from a man with pneumonia in Saudi Arabia. N Engl J Med 367:1814–1820.
4.
Cheng VC, Lau SK, Woo PC, Yuen KY. 2007. Severe acute respiratory syndrome coronavirus as an agent of emerging and reemerging infection. Clin Microbiol Rev 20:660–694.
5.
Chan JF, Li KS, To KK, Cheng VC, Chen H, Yuen KY. 2012. Is the discovery of the novel human betacoronavirus 2c EMC/2012 (HCoV-EMC) the beginning of another SARS-like pandemic? J Infect 65:477–489.
6.
Chan JF, Lau SK, Woo PC. 2013. The emerging novel Middle East respiratory syndrome coronavirus: the “knowns” and “unknowns”. J Formos Med Assoc 112:372–381.
7.
Chan JF, Lau SK, To KK, Cheng VC, Woo PC, Yuen KY. 2015. Middle east respiratory syndrome coronavirus: another zoonotic betacoronavirus causing SARS-like disease. Clin Microbiol Rev 28:465–522.
8.
Chan JF, Chan KH, Choi GK, To KK, Tse H, Cai JP, Yeung ML, Cheng VC, Chen H, Che XY, Lau SK, Woo PC, Yuen KY. 2013. Differential cell line susceptibility to the emerging novel human betacoronavirus 2c EMC/2012: implications for disease pathogenesis and clinical manifestation. J Infect Dis 207:1743–1752.
9.
Müller MA, Raj VS, Muth D, Meyer B, Kallies S, Smits SL, Wollny R, Bestebroer TM, Specht S, Suliman T, Zimmermann K, Binger T, Eckerle I, Tschapka M, Zaki AM, Osterhaus AD, Fouchier RA, Haagmans BL, Drosten C. 2012. Human coronavirus EMC does not require the SARS-coronavirus receptor and maintains broad replicative capability in mammalian cell lines. mBio 3(6):e00515-12.
10.
Chan KH, Chan JF, Tse H, Chen H, Lau CC, Cai JP, Tsang AK, Xiao X, To KK, Lau SK, Woo PC, Zheng BJ, Wang M, Yuen KY. 2013. Cross-reactive antibodies in convalescent SARS patients' sera against the emerging novel human coronavirus EMC (2012) by both immunofluorescent and neutralizing antibody tests. J Infect 67:130–140.
11.
Lau SK, Che XY, Woo PC, Wong BH, Cheng VC, Woo GK, Hung IF, Poon RW, Chan KH, Peiris JS, Yuen KY. 2005. SARS coronavirus detection methods. Emerg Infect Dis 11:1108–1111.
12.
Song D, Ha G, Serhan W, Eltahir Y, Yusof M, Hashem F, Elsayed E, Marzoug B, Abdelazim A, Al Muhairi S. 2015. Development and validation of a rapid immunochromatographic assay for the detection of Middle East respiratory syndrome coronavirus antigen in dromedary camels. J Clin Microbiol 53:1178–1182.
13.
Corman VM, Eckerle I, Bleicker T, Zaki A, Landt O, Eschbach-Bludau M, van Boheemen S, Gopal R, Ballhause M, Bestebroer TM, Muth D, Müller MA, Drexler JF, Zambon M, Osterhaus AD, Fouchier RM, Drosten C. 2012. Detection of a novel human coronavirus by real-time reverse-transcription polymerase chain reaction. Euro Surveill 17(39):pii=20285. http://www.eurosurveillance.org/ViewArticle.aspx?ArticleId=20285.
14.
Corman VM, Muller MA, Costabel U, Timm J, Binger T, Meyer B, Kreher P, Lattwein E, Eschbach-Bludau M, Nitsche A, Bleicker T, Landt O, Schweiger B, Drexler JF, Osterhaus AD, Haagmans BL, Dittmer U, Bonin F, Wolff T, Drosten C. 2012. Assays for laboratory confirmation of novel human coronavirus (hCoV-EMC) infections. Euro Surveill 17(49):pii=20334. http://www.eurosurveillance.org/ViewArticle.aspx?ArticleId=20334.
15.
de Sousa R, Reusken C, Koopmans M. 2014. MERS coronavirus: data gaps for laboratory preparedness. J Clin Virol 59:4–11.
16.
Sridhar S, To KK, Chan JF, Lau SK, Woo PC, Yuen KY. 2015. A systematic approach to novel virus discovery in emerging infectious disease outbreaks. J Mol Diagn 17:230–241.
17.
Corman VM, Olschlager S, Wendtner CM, Drexler JF, Hess M, Drosten C. 2014. Performance and clinical validation of the RealStar MERS-CoV kit for detection of Middle East respiratory syndrome coronavirus RNA. J Clin Virol 60:168–171.
18.
Chan JF, Chan KH, Kao RY, To KK, Zheng BJ, Li CP, Li PT, Dai J, Mok FK, Chen H, Hayden FG, Yuen KY. 2013. Broad-spectrum antivirals for the emerging Middle East respiratory syndrome coronavirus. J Infect 67:606–616.
19.
Zheng BJ, Chan KW, Lin YP, Zhao GY, Chan C, Zhang HJ, Chen HL, Wong SS, Lau SK, Woo PC, Chan KH, Jin DY, Yuen KY. 2008. Delayed antiviral plus immunomodulator treatment still reduces mortality in mice infected by high inoculum of influenza A/H5N1 virus. Proc Natl Acad Sci U S A 105:8091–8096.
20.
Che XY, Qiu LW, Liao ZY, Wang YD, Wen K, Pan YX, Hao W, Mei YB, Cheng VC, Yuen KY. 2005. Antigenic cross-reactivity between severe acute respiratory syndrome-associated coronavirus and human coronaviruses 229E and OC43. J Infect Dis 191:2033–2037.
21.
Li IW, Chan KH, To KW, Wong SS, Ho PL, Lau SK, Woo PC, Tsoi HW, Chan JF, Cheng VC, Zheng BJ, Chen H, Yuen KY. 2009. Differential susceptibility of different cell lines to swine-origin influenza A H1N1, seasonal human influenza A H1N1, and avian influenza A H5N1 viruses. J Clin Virol 46:325–330.
22.
Chan KH, Yan MK, To KK, Lau SK, Woo PC, Cheng VC, Li WS, Chan JF, Tse H, Yuen KY. 2013. Use of the human colorectal adenocarcinoma (Caco-2) cell line for isolating respiratory viruses from nasopharyngeal aspirates. J Med Virol 85:874–879.
23.
Li IW, To KK, Tang BS, Chan KH, Hui CK, Cheng VC, Yuen KY. 2008. Human metapneumovirus infection in an immunocompetent adult presenting as mononucleosis-like illness. J Infect 56:389–392.
24.
Lu X, Whitaker B, Sakthivel SK, Kamili S, Rose LE, Lowe L, Mohareb E, Elassal EM, Al-sanouri, Haddadin TA, Erdman DD. 2014. Real-time reverse transcription-PCR assay panel for Middle East respiratory syndrome coronavirus. J Clin Microbiol 52:67–75.
25.
Herold J, Raabe T, Siddell S. 1993. Molecular analysis of the human coronavirus (strain 229E) genome. Arch Virol Suppl 7:63–74.
26.
Pyrc K, Jebbink MF, Berkhout B, van der Hoek L. 2004. Genome structure and transcriptional regulation of human coronavirus NL63. Virol J 1:7.
27.
Woo PC, Lau SK, Chu CM, Chan KH, Tsoi HW, Huang Y, Wong BH, Poon RW, Cai JJ, Luk WK, Poon LL, Wong SS, Guan Y, Peiris JS, Yuen KY. 2005. Characterization and complete genome sequence of a novel coronavirus, coronavirus HKU1, from patients with pneumonia. J Virol 79:884–895.
28.
Lau SK, Lee P, Tsang AK, Yip CC, Tse H, Lee RA, So LY, Lau YL, Chan KH, Woo PC, Yuen KY. 2011. Molecular epidemiology of human coronavirus OC43 reveals evolution of different genotypes over time and recent emergence of a novel genotype due to natural recombination. J Virol 85:11325–11337.
29.
van Boheemen S, de Graaf M, Lauber C, Bestebroer TM, Raj VS, Zaki AM, Osterhaus AD, Haagmans BL, Gorbalenya AE, Snijder EJ, Fouchier RA. 2012. Genomic characterization of a newly discovered coronavirus associated with acute respiratory distress syndrome in humans. mBio 3(6):pii=e00473-12.
30.
Qian Z, Dominguez SR, Holmes KV. 2013. Role of the spike glycoprotein of human Middle East respiratory syndrome coronavirus (MERS-CoV) in virus entry and syncytia formation. PLoS One 8:e76469.
31.
Yang D, Leibowitz JL. 2015. The structure and functions of coronavirus genomic 3′ and 5′ ends. Virus Res, in press.
32.
Hui RK, Zeng F, Chan CM, Yuen KY, Peiris JS, Leung FC. 2004. Reverse transcriptase PCR diagnostic assay for the coronavirus associated with severe acute respiratory syndrome. J Clin Microbiol 42:1994–1999.
33.
Wu HY, Brian DA. 2010. Subgenomic messenger RNA amplification in coronaviruses. Proc Natl Acad Sci U S A 107:12257–12262.
34.
Petersen M, Wengel J. 2003. LNA: a versatile tool for therapeutics and genomics. Trends Biotechnol 21:74–81.
35.
Thanh TT, Pawestri HA, Ngoc NM, Hien VM, Syahrial H, Trung NV, van Doorn RH, Wertheim HF, Chau NV, Ha do Q, Farrar JJ, Hien TT, Sedyaningsih ER, de Jong MD. 2010. A real-time RT-PCR for detection of clade 1 and 2 H5N1 influenza A virus using locked nucleic acid (LNA) TaqMan probes. Virol J 7:46.
36.
Osterback R, Tevaluoto T, Ylinen T, Peltola V, Susi P, Hyypiä T, Waris M. 2013. Simultaneous detection and differentiation of human rhino- and enteroviruses in clinical specimens by real-time PCR with locked nucleic acid probes. J Clin Microbiol 51:3960–3967.
37.
Do LA, van Doorn HR, Bryant JE, Nghiem MN, Nguyen Van VC, Vo CK, Nguyen MD, Tran TH, Farrar J, de Jong MD. 2012. A sensitive real-time PCR for detection and subgrouping of human respiratory syncytial virus. J Virol Methods 179:250–255.
38.
Komatsu H, Tsunoda T, Inui A, Sogo T, Fujisawa T, Imura M, Tateno A. 2013. Successful use of saliva without DNA extraction for detection of macrolide-resistant Mycoplasma pneumoniae DNA in children using LNA probe-based real-time PCR. J Infect Chemother 19:1087–1092.
39.
Loens K, van Loon AM, Coenjaerts F, van Aarle Y, Goossens H, Wallace P, Claas EJ, Ieven M, Grace Study Group. 2012. Performance of different mono- and multiplex nucleic acid amplification tests on a multipathogen external quality assessment panel. J Clin Microbiol 50:977–987.
40.
Balada-Llasat JM, LaRue H, Kelly C, Rigali L, Pancholi P. 2011. Evaluation of commercial ResPlex II v2.0, MultiCode-PLx, and xTAG respiratory viral panels for the diagnosis of respiratory viral infections in adults. J Clin Virol 50:42–45.
41.
Chan KH, To KK, Chan JF, Li CP, Chen H, Yuen KY. 2013. Analytical sensitivity of seven point-of-care influenza virus detection tests and two molecular tests for detection of avian origin H7N9 and swine origin H3N2 variant influenza A viruses. J Clin Microbiol 51:3160–3161.

Information & Contributors

Information

Published In

cover image Journal of Clinical Microbiology
Journal of Clinical Microbiology
Volume 53Number 8August 2015
Pages: 2722 - 2726
Editor: M. J. Loeffelholz
PubMed: 26019210

History

Received: 7 May 2015
Returned for modification: 16 May 2015
Accepted: 19 May 2015
Published online: 20 July 2015

Permissions

Request permissions for this article.

Contributors

Authors

Jasper Fuk-Woo Chan
State Key Laboratory of Emerging Infectious Diseases, The University of Hong Kong, Hong Kong Special Administrative Region, China
Department of Microbiology, The University of Hong Kong, Hong Kong Special Administrative Region, China
Research Centre of Infection and Immunology, The University of Hong Kong, Hong Kong Special Administrative Region, China
Carol Yu Centre for Infection, The University of Hong Kong, Hong Kong Special Administrative Region, China
Garnet Kwan-Yue Choi
Department of Microbiology, The University of Hong Kong, Hong Kong Special Administrative Region, China
Alan Ka-Lun Tsang
Department of Microbiology, The University of Hong Kong, Hong Kong Special Administrative Region, China
Kah-Meng Tee
Department of Microbiology, The University of Hong Kong, Hong Kong Special Administrative Region, China
Ho-Yin Lam
Department of Pathology, Hong Kong Sanatorium and Hospital, Hong Kong Special Administrative Region, China
Cyril Chik-Yan Yip
Department of Microbiology, The University of Hong Kong, Hong Kong Special Administrative Region, China
Kelvin Kai-Wang To
State Key Laboratory of Emerging Infectious Diseases, The University of Hong Kong, Hong Kong Special Administrative Region, China
Department of Microbiology, The University of Hong Kong, Hong Kong Special Administrative Region, China
Research Centre of Infection and Immunology, The University of Hong Kong, Hong Kong Special Administrative Region, China
Carol Yu Centre for Infection, The University of Hong Kong, Hong Kong Special Administrative Region, China
Vincent Chi-Chung Cheng
Department of Microbiology, The University of Hong Kong, Hong Kong Special Administrative Region, China
Man-Lung Yeung
Department of Microbiology, The University of Hong Kong, Hong Kong Special Administrative Region, China
Susanna Kar-Pui Lau
State Key Laboratory of Emerging Infectious Diseases, The University of Hong Kong, Hong Kong Special Administrative Region, China
Department of Microbiology, The University of Hong Kong, Hong Kong Special Administrative Region, China
Research Centre of Infection and Immunology, The University of Hong Kong, Hong Kong Special Administrative Region, China
Carol Yu Centre for Infection, The University of Hong Kong, Hong Kong Special Administrative Region, China
Patrick Chiu-Yat Woo
State Key Laboratory of Emerging Infectious Diseases, The University of Hong Kong, Hong Kong Special Administrative Region, China
Department of Microbiology, The University of Hong Kong, Hong Kong Special Administrative Region, China
Research Centre of Infection and Immunology, The University of Hong Kong, Hong Kong Special Administrative Region, China
Carol Yu Centre for Infection, The University of Hong Kong, Hong Kong Special Administrative Region, China
Kwok-Hung Chan
Department of Microbiology, The University of Hong Kong, Hong Kong Special Administrative Region, China
Bone Siu-Fai Tang
Department of Pathology, Hong Kong Sanatorium and Hospital, Hong Kong Special Administrative Region, China
Kwok-Yung Yuen
State Key Laboratory of Emerging Infectious Diseases, The University of Hong Kong, Hong Kong Special Administrative Region, China
Department of Microbiology, The University of Hong Kong, Hong Kong Special Administrative Region, China
Research Centre of Infection and Immunology, The University of Hong Kong, Hong Kong Special Administrative Region, China
Carol Yu Centre for Infection, The University of Hong Kong, Hong Kong Special Administrative Region, China

Editor

M. J. Loeffelholz
Editor

Notes

Address correspondence to Kwok-Yung Yuen, [email protected].

Metrics & Citations

Metrics

Note: There is a 3- to 4-day delay in article usage, so article usage will not appear immediately after publication.

Citation counts come from the Crossref Cited by service.

Citations

If you have the appropriate software installed, you can download article citation data to the citation manager of your choice. For an editable text file, please select Medlars format which will download as a .txt file. Simply select your manager software from the list below and click Download.

View Options

Figures and Media

Figures

Media

Tables

Share

Share

Share the article link

Share with email

Email a colleague

Share on social media

American Society for Microbiology ("ASM") is committed to maintaining your confidence and trust with respect to the information we collect from you on websites owned and operated by ASM ("ASM Web Sites") and other sources. This Privacy Policy sets forth the information we collect about you, how we use this information and the choices you have about how we use such information.
FIND OUT MORE about the privacy policy