The Lactococcal Abortive Phage Infection System AbiP Prevents both Phage DNA Replication and Temporal Transcription Switch
ABSTRACT
MATERIALS AND METHODS
Bacterial strains, plasmids, phages, and media.
Molecular cloning and DNA sequence analysis.
DNA extraction and hybridization.
RNA extraction and Northern hybridization.
Long-range PCR DNA amplification.
RT-PCR analysis.
Mapping of the 5′ end of the transcript.
Plasmid constructions.
Nucleotide sequence accession numbers.
RESULTS
Cloning and identification of the AbiP determinant.
Sequence analysis of the AbiP determinant.
Functional analysis of the AbiP determinant.
Transcription of abiP.
Effect of AbiP on phage DNA replication.
Effect of AbiP on phage DNA transcription.
DISCUSSION





Primer | DNA | Accession no. | Coordinates (bp) | ||
---|---|---|---|---|---|
No. | Sequence (5′-3′)a | ||||
1 | ggaattccGTTGCGGATTGGATTAGTC | pIL2614 | U90222 | 9191-9209 | |
2 | gctctagagcCTTGTGTTTGGGTGTATTG | pIL2614 | U90222 | 10054-10036 | |
3 | GGGATTTGTGAGGGGTTATTATC | pIL2614 | U90222 | 8538-8553 | |
4 | GCTGAGATAATAACAACAAGC | pIL2614 | U90222 | 8686-8706 | |
5 | CGTACATTCTGAAACAAACCC | pIL2614 | U90222 | 9439-9459 | |
6 | ATGGATATTTTATTTTTAGAAAAAGC | pIL2614 | U90222 | 9239-9264 | |
7 | CTAGTTTCCTTTTATAAGTTCCTC | pIL2614 | U90222 | 9950-9973 | |
8 | CGAACGCTGGCGGCGTGCCT | IL1403 16S rRNA | NC_002662 | ||
9 | CACTCACGCGGCGTTGCTCG | IL1403 16S rRNA | NC_002662 | ||
10 | TCACTCGAATCTAATTCCTC | pIL2614 | U90222 | 9480-9461 | |
11 | CGTACATTCTGAAACAAACCC | pIL2614 | U90222 | 9459-9439 | |
12 | TTCTTGTCTACTTCTGGCTG | bIL66M1 | AY249139 | 5779-5798 | |
13 | GGGCTCGTATGAGCGTGTTT | bIL66 | L35175 | 2376-2395 | |
14 | AGTATGGCTTGCAATTAAGC | bIL66 | L35175 | 2124-2143 | |
15 | CCCAAAAAATCAAAAAGAAAAGTTTTAGCT | bIL170 | NC_001909 | 27-56 (late region) | |
16 | GCTTCTTTGCAAGAGTTAATGTATTATGGA | bIL170 | NC_001909 | 5761-5790 (late region) | |
17 | TCCATAATACATTAACTCTTGCAAAGAAGC | bIL170 | NC_001909 | 5790-5761 (late region) | |
18 | TCTTTGGTAATGAAGCTCTAATCGTAGCTG | bIL170 | NC_001909 | 8860-8889 (late region) | |
19 | CAGCTACGATTAGAGCTTCATTACCAAAGA | bIL170 | NC_001909 | 8889-8860 (late region) | |
20 | GCCATACTAATAGCCATAGCAATACGAACA | bIL170 | NC_001909 | 31642-31613 (middle region) | |
21 | GAAGAACAGCTACTATTTAAGCAAGAAACA | bIL170 | NC_001909 | 30158-30187 (middle region) | |
22 | GTTGCGTTTGGTCCAAATTCAGCGTCTAGT | bIL170 | NC_001909 | 17500-17471 (late region) | |
23 | TCAAAGGTTCTATGGTGGTAGGTTTACCAG | bIL170 | NC_001909 | 13151-13180 (late region) | |
24 | CTGGTAAACCTACCACCATAGAACCTTTGA | bIL170 | NC_001909 | 13180-13151 (late region) | |
25 | TTTTTGGGCTTTCTCTGCACGTTTAGCAAG | bIL170 | NC_001909 | 24021-24050 (early region) | |
26 | CTTGCTAAACGTGCAGAGAAAGCCCAAAAA | bIL170 | NC_001909 | 24050-24021 (early region) | |
27 | TTTTCTTCACTAATTCGTTGTTCTTCAAGT | bIL170 | NC_001909 | 18513-18542 (early region) | |
28 | GCTAATGAAATCGAACGCAAACTTAAAGAA | bIL170 | NC_001909 | 28705-28734 (early region) | |
29 | atcgaattcGATCTAAAACAAGTAAATATTT | pIL2614 | U90222 | 8360-8381 | |
30 | taaggatccTTAACTTAATATATGACTAATC | pIL2614 | U90222 | 9223-9202 |
Acknowledgments
REFERENCES
Information & Contributors
Information
Published In

Copyright
History
Contributors
Metrics & Citations
Metrics
Note:
- For recently published articles, the TOTAL download count will appear as zero until a new month starts.
- There is a 3- to 4-day delay in article usage, so article usage will not appear immediately after publication.
- Citation counts come from the Crossref Cited by service.
Citations
If you have the appropriate software installed, you can download article citation data to the citation manager of your choice. For an editable text file, please select Medlars format which will download as a .txt file. Simply select your manager software from the list below and click Download.