Role of Mfd and GreA in Bacillus subtilis Base Excision Repair-Dependent Stationary-Phase Mutagenesis
ABSTRACT
We report that the absence of an oxidized guanine (GO) system or the apurinic/apyrimidinic (AP) endonucleases Nfo, ExoA, and Nth promoted stress-associated mutagenesis (SAM) in Bacillus subtilis YB955 (hisC952 metB5 leuC427). Moreover, MutY-promoted SAM was Mfd dependent, suggesting that transcriptional transactions over nonbulky DNA lesions promoted error-prone repair. Here, we inquired whether Mfd and GreA, which control transcription-coupled repair and transcription fidelity, influence the mutagenic events occurring in nutritionally stressed B. subtilis YB955 cells deficient in the GO or AP endonuclease repair proteins. To this end, mfd and greA were disabled in genetic backgrounds defective in the GO and AP endonuclease repair proteins, and the strains were tested for growth-associated and stress-associated mutagenesis. The results revealed that disruption of mfd or greA abrogated the production of stress-associated amino acid revertants in the GO and nfo exoA nth strains, respectively. These results suggest that in nutritionally stressed B. subtilis cells, spontaneous nonbulky DNA lesions are processed in an error-prone manner with the participation of Mfd and GreA. In support of this notion, stationary-phase ΔytkD ΔmutM ΔmutY (referred to here as ΔGO) and Δnfo ΔexoA Δnth (referred to here as ΔAP) cells accumulated 8-oxoguanine (8-OxoG) lesions, which increased significantly following Mfd disruption. In contrast, during exponential growth, disruption of mfd or greA increased the production of His+, Met+, or Leu+ prototrophs in both DNA repair-deficient strains. Thus, in addition to unveiling a role for GreA in mutagenesis, our results suggest that Mfd and GreA promote or prevent mutagenic events driven by spontaneous genetic lesions during the life cycle of B. subtilis.
IMPORTANCE In this paper, we report that spontaneous genetic lesions of an oxidative nature in growing and nutritionally stressed B. subtilis strain YB955 (hisC952 metB5 leuC427) cells drive Mfd- and GreA-dependent repair transactions. However, whereas Mfd and GreA elicit faithful repair events during growth to maintain genome fidelity, under starving conditions, both factors promote error-prone repair to produce genetic diversity, allowing B. subtilis to escape from growth-limiting conditions.
INTRODUCTION
Genetic variability is an intrinsic property of all organisms and plays a crucial role in evolution. It has been widely documented that under conditions of nutritional stress, such as those occurring during post-exponential-phase growth, bacteria deploy mutagenic processes to modify their genomes and escape from growth-limiting conditions (1–5). These cellular processes, commonly known as stress-associated-mutagenesis (SAM) or stationary-phase-associated mutagenesis (SPM), have been demonstrated to occur in distinct organisms, including Escherichia coli, Pseudomonas spp., and Bacillus subtilis (5–9).
In slow-growing or nondividing bacteria, where DNA replication is dramatically diminished or even absent, the process of transcription remains active and provides the cell with the blueprint for protein synthesis necessary to sustain cell homeostasis (10, 11). As such, the transcriptional machinery is likely to encounter DNA damage much more frequently than the replication apparatus, and such encounters can lead to deleterious consequences for the cell (12). It is well known that genetic damage is preferably repaired in actively transcribed genes, more specifically in the template transcribed strand, preventing the cytotoxic effects associated with these lesions. This repair process is conserved among the three domains of life and is known as transcription-coupled repair (TCR) (13). Previous studies with E. coli and B. subtilis have associated the process of transcription with the ability of cells to acquire mutations under conditions of stress (3, 14, 15). Employing different mutagenesis systems, recent studies have shown that transcriptional derepression of genes under selection potentiates SAM in B. subtilis (16–20).
The Mfd factor translocates along DNA in an ATP-dependent manner (13, 21) and guides the nucleotide excision repair (NER) machinery to DNA lesions that stall the RNA polymerase (RNAP) in actively transcribed genes (13). In B. subtilis, Mfd also affects additional processes, including recombination, carbon-catabolite repression, TCR, and tolerance of protein oxidation (22–24). Other reports have attributed a role to Mfd in novel pathways of mutagenesis in growing E. coli and B. subtilis cells, as well as during spore germination/outgrowth (25–27).
During the elongation phase of transcription, roadblocks posed by DNA-binding proteins or specific DNA sequences induce RNAP to slide backward along the template (backtrack), resulting in the extrusion of the 3′ terminus of the nascent RNA through the RNAP secondary channel (28). Several reports have shown that the GreA factor increases an endonucleolytic event of the nascent RNA to generate a new 3′-OH terminus that can be extended by RNAP; thus, this factor prevents transcription arrest during elongation and enhances transcription fidelity (29–31). Interestingly, experiments using a forward mutagenesis system selecting for trimethoprim resistance (Tmpr) showed that transcriptional derepression promoted mutations in stationary-phase B. subtilis. This process was dependent on Mfd and GreA (18). However, the mechanisms underlying these processes remain unclear. Of note, recent reports postulate that error-prone processing of DNA mismatches and oxidized bases leads to mutagenic events in transcriptionally active genes (32). In this work, we investigated whether the processing of DNA lesions that are substrates of the oxidized guanine (GO) system and the apurinic/apyrimidinic (AP) endonucleases Nfo, ExoA, and Nth modulates the Mfd- and GreA-dependent mutagenic events occurring in growth-limited cells of B. subtilis strain YB955. Overall, our results support the notion that in growth-limited B. subtilis cells, spontaneous DNA lesions occurring in transcriptionally active genes initiate mutagenic processes mediated by Mfd and GreA.
RESULTS
Mfd and GreA are required for SAM in Bacillus subtilis.
As reported previously (17), in B. subtilis strain YB955 (hisC952 metB5 leuC427), the production of stress-associated (SA) His+, Met+, and Leu+ revertants was severely affected following Mfd disruption (Fig. 1). A possible mechanism underlying these mutagenic events relies on the ability of Mfd to promote an RNA polymerase bypass over genetic lesions affecting transcriptionally active genes (21). However, the GreA factor can also influence transcriptional efficiency during mRNA elongation (30, 31, 33). Therefore, we generated a GreA-deficient YB955 strain and investigated how the absence of this protein impacted SAM in B. subtilis YB955. As shown in Fig. 1, the absence of GreA also decreased the production of SA His+, Met+, or Leu+ colonies relative to that by starved cells of the parental strain, YB955. These results strongly suggest that GreA promotes mutagenic events in starved cells of B. subtilis. Of note, the SA reversion frequencies of a Δmfd ΔgreA strain to His+, Met+, and Leu+ phenotypes were lower than those observed in strains with single deficiencies in Mfd or GreA (Fig. 1). Thus, while the transcription factors Mfd and GreA seem to work independently in promoting SAM, it remains unclear whether spontaneous genetic lesions such as those inflicted by oxidative stress influence this type of mutagenesis.
FIG 1
Mfd and GreA induce mutagenic events in amino acid-starved B. subtilis cells deficient in the AP endonucleases Nfo, ExoA, and Nth.
In the absence of external DNA-damaging factors, Mfd and GreA were necessary for B. subtilis SAM (Fig. 1); hence, we reasoned that spontaneous genetic lesions elicited the mutagenic processes promoted by Mfd and GreA. The results in Fig. 2A support this notion; the numbers of His+, Met+, and Leu+ revertants were higher in a knockout strain deficient in the main AP endonucleases (ΔAP) of B. subtilis than in the parental strain, YB955, but were diminished in the Mfd– strain (Fig. 2A). These results suggest that the production of SA His+, Met+, and Leu+ colonies in the AP endonuclease-deficient strain is dependent on Mfd. Restoration of Mfd via expression of mfd from the isopropyl-β-d-thiogalactopyranoside (IPTG)-inducible Phs promoter partially restored the ability of the AP endonuclease-deficient strain to produce His+, Met+, and Leu+ revertants (Fig. 2B). Of note, this effect was not observed in a control strain harboring the empty Phs vector (data not shown).
FIG 2
We next analyzed the effect of GreA in promoting reversions in the hisC952, metB5, and leuC427 genes of the strain deficient in Nfo, ExoA, and Nth. As shown in Fig. 3A, genetic inactivation of greA in the AP endonuclease-deficient strain significantly decreased the production of revertants to three amino acid prototrophies. These effects can be attributed to the absence of GreA, since overexpression of the gene encoding GreA from the IPTG-inducible Phs promoter restored the ability of the ΔAP strain to produce His+, Met+, and Leu+ revertants (Fig. 3B). These results suggest that AP sites and single-strand breaks that may have accumulated in the AP endonuclease-deficient strain can modulate the GreA-dependent mutagenic events in nutritionally stressed B. subtilis cells.
FIG 3
Mfd and GreA promote mutagenic events in amino acid-starved B. subtilis cells deficient in the repair of oxidatively damaged guanine.
Reactive oxygen species (ROS) oxidize DNA and generate lesions, including the base analog 8-oxoguanine (8-OxoG) (34). In distinct bacteria, the mutagenic consequences of this lesion are counteracted by the oxidized guanine (GO) system (35). In B. subtilis, this repair system is composed of the DNA glycosylases MutY and MutM and the nucleotide diphosphohydrolase YtkD (36–38). Starved cells of the knockout strain deficient in the GO system displayed a dramatic increase in the production of His+ and Met+ revertants over that by the parental strain (Fig. 4A). Interestingly, a significant fraction of these mutagenic events was dependent on Mfd, as evidenced by the fact that inactivation of the mfd gene reduced the mutation frequency of SA his and met reversions in the ΔGO Δmfd strain ∼6- and ∼5-fold, respectively (Fig. 4A). These results suggest that 8-OxoG or its repair intermediates activate Mfd-dependent events that promote adaptive reversions at the hisC952 and metB5 genes. As demonstrated previously (39), the Leu+ reversion frequencies were similar in the YB955 and GO-deficient strains (Fig. 4A). However, disruption of mfd completely abolished the production of Leu+ revertants in the wild-type (WT) and GO system-deficient strains (Fig. 1 and 4A). The absence of GreA also affected the production of SA His+, Met+, and Leu+ revertants in the strain lacking a functional GO system. The numbers of His+ and Met+ revertants produced by the ΔGO ΔgreA strain were ∼8 and ∼17 times lower, respectively, than those produced by the ΔGO strain (Fig. 5A). These results suggest that mutagenic events giving rise to revertant His+ and Met+ colonies in nutritionally stressed cells lacking a functional GO system are influenced not only by Mfd but also by GreA (Fig. 5). The expression of mfd or greA using an IPTG expression system restored the ability of the ΔGO strain to increase the production of His+ and Met+ revertants (Fig. 4B and 5B) and provided additional support for this contention.
FIG 4
FIG 5
Mfd and GreA prevent mutagenesis in growing B. subtilis cells with disabled base excision repair (BER) systems.
The conditions that prevail in growing bacteria are conducive to high-fidelity repair of ROS-promoted genetic lesions (40, 41). Congruently, our results revealed that in actively growing B. subtilis strain YB955, the simultaneous absence of Nfo, ExoA, and Nth significantly increased the reversion rates of the hisC952, metB5, and leuC427 alleles (Fig. 6A). However, in stark contrast to what was observed in nutritionally stressed cells (Fig. 2 and 3), disruption of Mfd or GreA increased the mutation rates of the strain deficient in the AP endonucleases Nfo, ExoA, and Nth (Fig. 6A). These results strongly suggest that both transcriptional factors are part of high-fidelity repair pathways that process AP sites in growing B. subtilis cells. We extended our analysis to growing cells of the GO-deficient strain. This strain exhibited significantly higher reversion rates of the his, met, and leu genes than strain YB955 (Fig. 6B). Inactivation of mfd or greA induced further increases in the levels of His+ and Met+ revertants produced by the GO-deficient strain, while the reversion rates in the leuC allele showed distinct declines (Fig. 6B).
FIG 6
Analysis of suppressor mutations promoted by Mfd and GreA in starved BER-deficient B. subtilis cells.
A recent study revealed that growth-limited cells of B. subtilis deficient in Nfo, Exo, and Nth accumulated a higher proportion of nonsense suppressor mutations conferring His+ and Met+ phenotypes than the parental strain (42). Therefore, we investigated the combined effects of the AP system, mfd, and greA on the production of nonsense suppressors or true reversions giving rise to His+ and Met+ prototrophs. The results of these analyses revealed that in the strain deficient in the AP endonucleases and Mfd, ∼56% of the His+ colonies were also Met+; furthermore, 48% of the Met+ colonies were also prototrophic for histidine (Table 1). Disruption of GreA significantly affected the type of mutation produced by the Nfo-, ExoA-, and Nth-deficient strain: almost the totality of the SA His+ and Met+ revertants resulted from nonsense suppressor mutations (Table 2). Taken together, these results suggest that GreA modulates the production of His+ and Met+ revertants generated through true reversion in the AP endonuclease-deficient strain. In marked contrast, none of the Leu+ colonies in starved cells possessed a His+ or Met+ phenotype; therefore, the reversions in the leuC gene produced by the strains deficient in the three AP endonucleases and either mfd or greA were most probably generated by intragenic events (Table 2).
TABLE 1
| ΔAP mfd revertantsa | No. of revertants that grew/no. tested (% of revertants that grew) on a medium lacking: | ||
|---|---|---|---|
| His | Met | Leu | |
| His+ | 96/96 (100) | 54/96 (56) | 0/96 (0) |
| Met+ | 48/100 (48) | 100/100 (100) | 0/100 (0) |
| Leu+ | 0/18 (0) | 4/18 (22) | 18/18 (100) |
a
His, Met, and Leu revertant colonies from days 4, 5, and 6 were tested on 1× SMM missing one required amino acid (His, Met, or Leu) to screen for suppressor mutations. Plates were scored after 48 h.
TABLE 2
| ΔAP greA revertants | No. of revertants that grew/no. tested (% of revertants that grew) on a medium lacking: | ||
|---|---|---|---|
| His | Met | Leu | |
| His+ | 100/100 (100) | 94/100 (94) | 0/100 (0) |
| Met+ | 100/100 (100) | 100/100 (100) | 0/100 (0) |
| Leu+ | 0/50 (0) | 0/50 (0) | 50/50 (100) |
a
His, Met, and Leu revertant colonies from days 4, 5, and 6 were tested on 1× SMM missing one required amino acid (His, Met, or Leu) to screen for suppressor mutations. Plates were scored after 48 h.
Interestingly, deficiencies in the GO system result in changes in the proportion of suppressor mutations conferring His+ and Met+ phenotypes (39). Our analyses revealed that the proportion of Met+ colonies that were also Leu+ revertants in the ΔGO strain was not affected by disruptions in mfd or greA. Accordingly, in both strains, 100% of the Met+ colonies were also capable of growing in a minimal medium lacking His (Tables 3 and 4). Further results revealed that 100% of the His+ revertant colonies produced by the ΔGO ΔgreA strain also grew in a medium lacking methionine; in contrast, disabling the mfd gene in the ΔGO strain reduced by 50% the number of His+ colonies that were also prototrophs for Met (Tables 3 and 4). Interestingly, whereas the ΔGO Δmfd strain showed a propensity to produce mostly true revertants in the leuC allele, a high proportion of the adaptive Leu+ revertants produced by the ΔGO ΔgreA strain exhibited a His+ Met+ phenotype (Table 4). Sequencing of the hisC952, metB5, and leuC427 genes of ∼30 independent His+, Met+, or Leu+ SA revertants of the ΔGO ΔgreA strain revealed that almost 100% of the His+ and Met+ reversions can be attributed to suppressor mutations (Table 5). However, a wide diversity of intragenic mutations was detected in the sequenced leuC revertants (Table 5). Interestingly, only ∼10% of the revertants exhibited true reversions in the mutant codon of the leuC427 gene (Table 5). Furthermore, the genetic changes associated with 38% of the triple Leu+ His+ Met+ revertants were not identified in the amplicons sequenced, suggesting that missense suppressors generated these types of revertants (Table 5). Therefore, in the GO-deficient genetic background, GreA seems to favor the production of true reversion in the leuC gene.
TABLE 3
| ΔGO Δmfd revertants | No. of revertants that grew/no. tested (% of revertants that grew) on a medium lacking: | ||
|---|---|---|---|
| His | Met | Leu | |
| His+ | 100/100 (100) | 50/100 (50) | 2/100 (2) |
| Met+ | 96/96 (100) | 96/96 (100) | 9/96 (9.3) |
| Leu+ | 1/33 (3) | 2/33 (6) | 33/33 (100) |
a
His, Met, and Leu revertant colonies from days 4, 5, and 6 were tested on 1× SMM missing one required amino acid (His, Met, or Leu) to screen for suppressor mutations. Plates were scored after 48 h.
TABLE 4
| ΔGO ΔgreA revertants | No. of revertants that grew/no. tested (% of revertants that grew) on a medium lacking: | ||
|---|---|---|---|
| His | Met | Leu | |
| His+ | 100/100 (100) | 100/100 (100) | 4/100 (4) |
| Met+ | 100/100 (100) | 100/100 (100) | 0/100 (0) |
| Leu+ | 47/50 (94) | 50/50 (100) | 50/50 (50) |
a
His, Met, and Leu revertant colonies from days 4, 5, and 6 were tested on 1× SMM missing one required amino acid (His, Met, or Leu) to screen for suppressor mutations. Plates were scored after 48 h.
TABLE 5
| Revertant allele | Position(s) of mutation (bp) | No. of revertants with mutation/no. of revertants sequenced | Type(s) of mutation(s) | DNA change(s) | Result(s) of mutation(s) |
|---|---|---|---|---|---|
| leuC | 427 | 3/29 | Transition | A → G | Arg → Gly |
| 364 | 1/29 | Transversion | C → A | Lys → Pro | |
| 337, 341 | 1/29, 1/29 | Transversion, transversion | C → G, A → C | Pro → Ala, Glu → Ala | |
| 341 | 4/29 | Transversion | A → C | Glu → Ala | |
| 406, 451 | 1/29, 1/29 | Transversion, transition | G → C, C → T | Ala → Pro, His → Tyr | |
| 337 | 2/29 | Transversion | C → A | Pro → Tyr | |
| 336, 341 | 1/29, 1/29 | Transition, transversion | A → G, A → C | Gly → Gly, Glu → Ala | |
| 341, 352 | 1/29, 1/29 | Transversion, transversion | A → C, A → T | Glu → Ala, Thr → Ser | |
| 332 | 1/29 | Transition | T → G | Val → Gly | |
| 333 | 1/29 | Transition | C → T | Val → Val | |
| 452 | 1/29 | Transversion | A → T | His → Leu | |
| 450, 451/452 | 1/29, 1/29 | Transversion | A → C, CA → TT | Glu → Asp, His → Phe | |
| NF | 11/29 | NF | NF | NF | |
| metB | NF | 32/33 | NF | NF | NF |
| 200 | 1/33 | Transversion | T → A | Phe → Tyr | |
| hisC | NF | 32/33 | NF | NF | NF |
| 1060 | 1/33 | Transition | G → A | Ala → Thr |
a
Revertants were tested for the ability to grow on 1× SMM lacking histidine, methionine, or leucine and were classified for their phenotypes. Fragments of the hisC, metB, and leuC genes were sequenced, depending on the reversion observed. NF, no changes were found in the sequenced fragment.
b
Revertants were selected in histidine dropout medium (33 revertants), methionine dropout medium (33 revertants), or leucine dropout medium (30 revertants).
Stationary-phase cells of B. subtilis deficient in BER, Mfd, and GreA accumulate oxidative DNA lesions.
As noted above, the absence of components of the BER pathway promoted SAM, presumably due to the accumulation of oxidative lesions. To test this notion, chromosomal DNA samples were isolated from nfo exoA nth, nfo exoA nth mfd, ΔGO, and ΔGO Δmfd strains and were treated with formamidopyrimidine-DNA glycosylase (Fpg), a DNA glycosylase that removes 8-OxoG, induces cleavage of the DNA backbone by beta-delta elimination, and generates a single-strand break (35). The reaction products were further analyzed by alkaline gel electrophoresis (AGE) to detect 8-OxoG lesions (43). The chromosomal DNA of the ΔGO strain exhibited an 8-OxoG content higher than that observed in DNA samples of the strain lacking Nfo, ExoA, and Nth (compare Fig. 7 and 8). An Mfd or GreA deficiency in the GO-deficient strain further increased the content of 8-OxoG lesions (Fig. 7). On the other hand, among AP-deficient strains (proficient for the GO system), those with defects in Mfd or GreA accumulated higher levels of 8-OxoG lesions than the strain carrying Mfd and GreA (Fig. 8). Of note, AGE analysis with chromosomal DNA isolated from the WT, Δmfd, and ΔgreA strains during the stationary phase revealed an 8-OxoG lesion content substantially lower than those detected in the mutant strains discussed above (see Fig. S3 in the supplemental material). Overall, these results revealed that under growth-limiting conditions, BER-deficient strains accumulate 8-OxoG lesions and that Mfd and GreA can influence the levels of these mutagenic lesions in these repair-deficient strains.
FIG 7
FIG 8
Mfd and GreA counteract the noxious effects of H2O2 in B. subtilis ΔAP and ΔGO cells.
To further test the concept that oxygen radicals are involved in eliciting DNA repair transactions dependent on Mfd and GreA, exponentially growing cells of the ΔGO and ΔAP strains, proficient or deficient for mfd or greA, were exposed to increasing amounts of the genotoxic agent H2O2. The GO-deficient and AP endonuclease-deficient strains exhibited higher susceptibilities to H2O2 than the parental strain, YB955 (Fig. 9). Remarkably, the susceptibilities of the two repair-deficient strains to the ROS promoter agent increased even more following the disruption of mfd or greA (Fig. 9). Of note, the strains with single deficiencies in Mfd or GreA were not significantly more susceptible than the parental strain, YB955, at the concentrations of H2O2 employed in these experiments (data not shown). In conjunction, these results unveil roles for Mfd and GreA in counteracting the cytotoxic and genotoxic effects of the ROS-promoted DNA lesions that are substrates of the GO system and the Nfo, ExoA, and Nth proteins in B. subtilis.
FIG 9
DISCUSSION
The results described in this work indicate that Mfd and GreA promote reversions in the mutant genes hisC952, metB5, and leuC425 in amino acid-starved cells of B. subtilis strain YB955 that lack a functional GO system or have the AP endonucleases Nfo, ExoA, and Nth disabled. Overall, our results suggest that under growth-limiting conditions, nonbulky DNA lesions of an oxidative nature drive mutagenic events through Mfd and GreA.
In B. subtilis, Mfd favors the accumulation of mutations in genes under selection that are highly transcribed (16–20). In agreement with previous results (17), we found that Mfd was required to generate reversions in the three mutant amino acid-biosynthetic genes of B. subtilis strain YB955. It must be pointed that in starved B. subtilis cells, mutagenic events promoted by MutY, a DNA glycosylase of the GO system, required a functional Mfd protein (32). On the basis of these results, it was postulated that G-A and C-A mispairs that accumulate in stationary phase are processed in an error-prone manner, employing components of the BER pathway and the Mfd protein (32, 40). Further results revealed that MutM, another component of the GO system, was involved in growth and SA mutagenesis in B. subtilis (44). Taken together, these observations suggested the existence of an active mechanism in which spontaneous lesions initiate the mutagenic pathway dependent on Mfd and components of the BER system. The results of this work (Fig. 1) and previous studies (18, 45) revealed that transcriptional factors in addition to Mfd, namely, GreA and NusA, impact stress-associated mutagenic processes in bacteria.
AP sites and single-strand breaks are common lesions resulting from spontaneous base loss and repair events of damaged DNA bases, and such lesions are processed by AP endonucleases (46). In B. subtilis, nfo, exoA, and nth encode the main proteins with AP endonuclease activity; accordingly, the simultaneous disruption of these genes was necessary to produce a genetic background susceptible to the oxidizing agent H2O2 (42). It has been shown that genetic inactivation of Nfo, ExoA, and Nth resulted in the accumulation of genomic AP sites during the stationary phase of B. subtilis strain YB955 (42). AP sites of spontaneous origin or derived from the processing of damaged DNA bases through DNA glycosylases are mutagenic and cytotoxic (46). Our assays subjected B. subtilis cells to starving conditions (see Fig. S1 and S2 in the supplemental material), which led to halted DNA replication but active transcription (10, 11). Under these conditions, the inactivation of AP endonucleases markedly increased the reversion rates of the his, met, and leu mutant genes. Notably, mfd and greA were directly or indirectly involved in these mutagenic processes, as evidenced by the fact that among AP endonuclease-deficient strains, the independent disruption of either of these factors resulted in the production of a significantly lower number of revertants than that for strains proficient in mfd or greA (Fig. 2 and 3). Based on these results, it is feasible to speculate that in growth-limited B. subtilis cells, Mfd and GreA promote SA mutagenesis in transcriptionally active genes carrying unprocessed AP sites and single-strand breaks.
In addition to AP sites and strand breaks, oxidized guanines (8-OxoG’s) are among the most prominent lesions inflicted by ROS (34, 35). Organisms in the three domains of life rely on the GO DNA repair system to avoid the cytotoxic and genotoxic effects of this type of lesion (35, 46). As shown here (Fig. 4 and 5) as well as in a previous report (39), starved B. subtilis cells with a disabled GO system dramatically increased the production of His+ and Met+ revertants. It has been proposed that genetic lesions of an oxidative nature elicit these amino acid reversions (39, 40, 44). The biochemical evidence described in this report supported this hypothesis; thus, stationary-phase cells of the ΔGO strain accumulated large amounts of chromosomal 8-OxoG lesions (Fig. 7). Our results also showed that Mfd and GreA were required to generate a significant proportion of the His+ and Met+ revertants produced by the ΔGO strain (Fig. 4 and 5). Accordingly, in the GO-deficient strain background, disruption of greA or mfd resulted in a significant decline in the reversion rates of His+ and Met+ colonies. These results strongly suggest that the processing of 8-OxoG’s through Mfd and GreA promotes error-prone repair events in transcriptionally active genes, consequently generating amino acid prototrophic reversions in starved B. subtilis cells. In support of this notion, the level of 8-OxoG lesions increased significantly after the disruption of mfd or greA in the GO-deficient strain (Fig. 7). Also, our genetic restoration experiments with mfd and greA, and our survival assays with the GO- and AP-deficient strains, showed that SAM was restored in the Mfd- or GreA-deficient strains once the genes encoding these factors were expressed in trans and that survival was not differentially affected in these strains (Fig. 2 to 5; also see Fig. S1 and S2 in the supplemental material).
Previous reports showed that nonreplicating cells of an E. coli strain deficient in Nfo and ExoA increased mutagenic events in response to AP sites, single-strand breaks, and oxidized bases such as 8-OxoG (47). Our results with B. subtilis agree with the observations for E. coli; however, this report is novel because it shows that Mfd and GreA are important for these mutational processes. As shown in this work, ROS-promoted DNA lesions, but not mispaired DNA bases, are involved in the GreA-dependent SA mutagenic events in B. subtilis (see Fig. S4 in the supplemental material). In contrast, oxidative DNA lesions (this work) and DNA mismatches did promote Mfd-dependent mutagenic events under conditions of nutritional stress in this microorganism (Fig. S4) (32). A previous study with GreA showed that this factor controls transcriptional fidelity and impacts the stability of prokaryotic genomes (30). Based on these observations, we propose that ROS-promoted DNA lesions in transcriptionally active genes induce incorrect matches in the 3′-terminal end of the growing mRNA chain, trapping the transcriptional machinery in an inactivated state (30). Following a GreA-dependent backtracking event (48), the RNAP activates a 3′–5′ exonucleolytic event to eliminate the misaligned mRNA (30). In growth-compromised bacteria, these events provide an opportunity for error-prone incorporation of nucleotides from a biased nucleoside triphosphate (NTP) pool (41) and bypass of the DNA lesion, which generates a mutant mRNA pool that promotes SAM through retromutagenesis. It is also possible that the stalled GreA-RNAP complex can signal the recruitment of Mfd to dissociate RNAP and engage components of the BER system to incise/excise the DNA lesion(s) and resynthesize a DNA patch in an error-prone manner. Evidence supporting the notion of transcriptional mutagenic mechanisms has been reported for eukaryotes and prokaryotes (12, 30, 49–51). The influence of factors associated with the process of transcription has been presented elsewhere; NusA, a transcriptional factor involved in termination/antitermination processes, was found to be necessary for the generation of Lac+ colonies under starving conditions in E. coli strain FC40 (45). Further studies proposed that these mutations could arise from an alternative TCR mechanism in which NusA recruits DinB to fill DNA gaps in the transcribed strand and to restore the template strand for transcription (49).
One other important observation from our experiments is that unrepaired AP sites, single-strand breaks, and 8-OxoG’s increased the reversion rates of the hisC, metB, and leuC genes in growing cells of the B. subtilis YB955 ΔGO and Δnfo ΔexoA Δnth strains. This observation agrees with previous observations (39, 42). However, we found that the effects of GreA and Mfd disruption on mutation prevention or promotion are growth phase dependent in B. subtilis. In rapidly growing cells, both transcriptional factors prevented mutagenesis during logarithmic growth (Fig. 6). We speculate that the metabolic conditions operating in growing cells of B. subtilis, including a properly balanced pool of precursors for RNA and DNA synthesis (41, 52), may elicit GreA- and Mfd-dependent high-fidelity repair in actively transcribed genes (17, 18, 30). In contrast, in nutritionally stressed bacteria, biased dNTP and NTP pools (41, 52) and/or the recruitment of low-fidelity DNA polymerases (32, 49) promotes error-prone repair and genetic variability that increases the likelihood of escaping growth-limiting conditions. Additionally, the production of Mfd-dependent Leu+ revertants was found to require the PolA and YqjH DNA polymerases in B. subtilis (32). Furthermore, SA his, met, and leu reversions in AP endonuclease-deficient B. subtilis cells required the low-fidelity polymerase PolX (42). Finally, a perturbed balance in the NTP levels associated with increased expression of ribonucleotide reductase (RNR) has promoted SAM in starved B. subtilis cells (41).
In conclusion, the results obtained in this report provide novel evidence suggesting that DNA lesions generated spontaneously by metabolic factors that are substrates of the BER system activate the Mfd and GreA function promoting divergent mutagenic events during the growth and stationary phases of B. subtilis.
MATERIALS AND METHODS
Bacterial strains and growth conditions.
The bacterial strains and plasmids used in this study are listed in Table 6. B. subtilis strains were routinely grown in Penassay broth (PAB) (Antibiotic Medium 3; Difco Laboratories, Sparks, MD). Liquid cultures were incubated at 37°C with vigorous aeration. Growth was monitored with a Pharmacia Ultrospec 2000 spectrophotometer set at 600 nm. When required, the medium was supplemented with erythromycin (Ery; 1 μg/ml), tetracycline (Tet; 10 μg/ml), neomycin (Neo; 10 μg/ml), spectinomycin (Sp; 100 μg/ml), chloramphenicol (Cm; 5 μg/ml), or isopropyl-β-d-thiogalactopyranoside (IPTG; 0.25 mM).
TABLE 6
| Strain or plasmid | Genotype or descriptiona | Reference, source, or transformationb |
|---|---|---|
| B. subtilis strains | ||
| YB955 | hisC952 metB5 leuC427 xin-1 SpβSENS | 9 |
| YB9801 | Δmfd::tet Tetr | 16 |
| PERM1386 | ΔgreA::cm Cmr | Laboratory stock |
| PERM1339 | Δmfd::tet ΔgreA::cm Tetr Cmr | pPERM1191 → YB9801 |
| PERM1036 | Δnfo::neo exoA::tet nth::ery Neor Tetr Eryr | 42 |
| PERM1409 | Δnfo::neo exoA::tet nth::ery mfd::cm Neor Tetr Eryr Cmr | pPERM1539 → PERM1036 |
| PERM1516 | ΔytkD::neo mutM::tet mutY::ery Neor Tetr Eryr | 39 |
| PERM1517 | ΔytkD::neo mutM::tet mutY::ery mfd::cm Neor Tetr Eryr Cmr | pPERM1539 → PERM1516 |
| PERM1577 | Δnfo::neo exoA::tet nth::ery mfd::cm amyE::Phs-mfd Neor Tetr Eryr Cmr Spcr | pPERM1043 → PERM1409 |
| PERM1578 | ΔytkD::neo mutM::tet mutY::ery mfd::cm amyE::Phs-mfd Neor Tetr Eryr Cmr Spcr | pPERM1539 → PERM1516 |
| PERM1580 | Δnfo::neo exoA::tet nth::ery greA::cm Neor Tetr Eryr Cmr | pPERM1191 → PERM1036 |
| PERM1581 | ΔytkD::neo mutM::tet mutY::ery greA::cm Neor Tetr Eryr Cmr | pPERM1191 → PERM1516 |
| PERM1649 | Δnfo::neo exoA::tet nth::ery greA::cm amyE::Phs-greA Neor Tetr Eryr Cmr Spcr | pPERM1490 → PERM1580 |
| PERM1650 | ΔytkD::neo mutM::tet mutY::ery greA::cm amyE::Phs-greA Neor Tetr Eryr Cmr Spcr | pPERM1490 → PERM1580 |
| PERM1661 | ΔytkD::neo mutM::tet mutY::ery mfd::cm amyE::Phs-mfd Neor Tetr Eryr Cmr Spcr | pPERM1043 → PERM1409 |
| PERM1662 | Δnfo::neo exoA::tet nth::ery mfd::cm amyE::Phs-mfd Neor Tetr Eryr Cmr Spcr | pPERM1539 → PERM1516 |
| PERMYB151 | ΔmutSL::neo Neor | 57 |
| PERM1724 | ΔmutLSL::neo mfd::cm Neor Cmr | pPERM1538 → PERMYB151 |
| PERM1723 | ΔmutLS::neo greA::cm Neor Cmr | pPERM1191 → PERMYB151 |
| Plasmids | ||
| pPERM1043 | pHyperspank-mfd integrative vector with mfd under the control of IPTG; Ampr Spr | 32 |
| pPERM1191 | pMUTIN4 with a 222-bp EcoRI/BamHI PCR fragment from the greA ORF; Cmr | 18 |
| pPERM1490 | pHyperspank-greA integrative vector with greA under the control of IPTG; Ampr Spcr | Laboratory stock |
| pPERM1539 | pJET1.2/blunt containing the chloramphenicol resistance cassette inside the mfd ORF; Cmr | Laboratory stock |
| pPERMYB140 | pUC19 carrying a 2.5-kbp SmaI/PmeI internal deletion of the mutSL operon containing a neomycin cassette | 57 |
a
Amp, ampicillin; Ery, erythromycin; Neo, neomycin; Tet, tetracycline; Cm, chloramphenicol; Spc, spectinomycin; ORF, open reading frame.
b
X → Y indicates that strain Y was transformed with plasmid DNA from source X.
Genetic and molecular biology techniques.
The preparation and transformation of competent cells with chromosomal or plasmid DNA were performed as described previously (53, 54). Chromosomal DNA from B. subtilis was purified as described by Cutting and Vander Horn (55). Small-scale preparation of plasmid DNA from E. coli cells, enzymatic manipulations, and agarose gel electrophoresis were performed by standard techniques (54). PCR products were obtained with homologous oligonucleotide primers and Vent DNA polymerase (New England BioLabs).
Stationary-phase mutagenesis assays.
The strains of interest were propagated in sterile flasks containing PAB medium with vigorous aeration (250 rpm) at 37°C until 90 min after T0 (the time when the slopes of exponential growth and stationary phase intersected). The stationary-phase mutagenesis assays were performed as described previously (9, 17) by plating cell aliquots (0.1 ml) on six plates of solid Spizizen minimal medium (SMM; 1× Spizizen salts supplemented with 0.5% glucose, either 50 μg/ml or 200 ng/ml of the required amino acid, and 50 μg/ml each of isoleucine and glutamic acid). The concentration of the amino acid used depended on the reversion that was being selected. For instance, to select for His+ revertants, 50 μg/ml of methionine and leucine and 200 ng/ml of histidine were added to the medium. Isoleucine and glutamic acid were added as described previously (9) to protect the viability of the cells. When required, the selection medium was supplemented with IPTG (final concentration, 0.25 mM). The number of revertants from the six plates was scored daily. The initial number of bacteria for each experiment was determined by serial dilution of the bacterial cultures followed by plating of the cells on a minimal medium containing all three essential amino acids. The experiments were performed at least three times.
Analysis of mutation rates.
The growth-dependent reversion rates for the His+, Met+, and Leu+ revertants were measured by fluctuation tests with the Lea-Coulson formula, r/m – ln(m) = 1.24, where r is the observed number of mutants per culture and m is the number of mutations in a culture (56). Three parallel cultures were used to determine the total number of CFU plated onto each plate (Nt) by titration. The mutation rates were calculated as described previously using the formula m/2Nt (9, 57).
DNA sequencing.
Revertant colonies with the ΔGO ΔgreA background were collected from plates from the SAM assays on days 4 to 5 of incubation, independently propagated in liquid A3 medium, and subjected to DNA isolation. Internal fragments of the hisC952, metB5, and leuC427 genes were amplified by PCR using high-fidelity DNA polymerase and specific oligonucleotide primers (Table 7). Sequencing services were carried out by Functional Biosciences, Inc. (Madison, WI).
TABLE 7
| Primer no. | Oligonucleotidea | Sequence (5′ to 3′) | Amplified region |
|---|---|---|---|
| 1 | F-hisC | GCAGGCCTTCAGCAGTATTATGA | nt 840 to +88 relative to the translational stop codon of hisC |
| 2 | R-hisC | GACCGGCGAGCAATATTGTATCTTTCA | |
| 3 | F-metB | AAACGGGGAAATAATGGAGGTG | nt –27 to 516 of the metB open reading frame |
| 4 | R-metB | TCGGTGTGTTCGAACATACCGTT | |
| 5 | F-leuC | CAGTGTGGATCAAGGGATTGT | nt 303 to 655 of the leuC open reading frame |
| 6 | R-leuC | ACGATGGATGAACGAATGACTG |
a
F, forward; R, reverse.
Detection of 8-OxoG in chromosomal DNA.
Strains were propagated at 37°C in PAB, and samples (6 ml) were collected during exponential growth (optical density at 600 nm [OD600], 1.0) and 90 min after the cessation of exponential growth. Cell samples were collected by centrifugation at 18,200 × g for 1 min and were washed once with 0.05 M EDTA–0.1 M NaCl (pH 7.5), and the cell pellets were stored at −20°C. Chromosomal DNA was purified from the cells according to the protocol of Cutting and Vander Horn (55). To detect 8-OxoG’s and AP sites, 3-μg DNA samples were digested with 15 U of Fpg (New England BioLabs). To detect single-strand DNA breaks generated by Fpg cleavage at AP sites, enzymatically digested DNA samples were denatured with 0.3 N NaOH and were electrophoresed through a 0.8% alkaline agarose gel (54). The gels were stained with ethidium bromide and were photographed using a GeneGenius bioimaging system (Syngene, Frederick, MD); digital photographic images of the gels were scanned, and DNA was quantified by densitometry using ImageJ 1.47n software (http://imagej.nih.gov/ij/). The intensity of the chromosomal DNA band remaining in the gel well after endonuclease IV (Endo IV) treatment was determined by densitometry using ImageJ 1.47n software and was compared to the intensity of the chromosomal band from the untreated control reaction. These experiments were repeated at least twice with essentially similar (±20%) results.
Assays of sensitivity to hydrogen peroxide.
B. subtilis strains with distinct genotypes were grown in PAB medium with aeration (250 rpm) at 37°C. Growth was monitored with a spectrophotometer measuring the OD600. Before the cessation of exponential growth (OD600, 0.5), the cells were collected by centrifugation (6,500 × g, 5 min), washed twice with phosphate-buffered saline (PBS; pH 7.2), and resuspended in the same buffer. Cell aliquots of equal volumes (2 ml) were treated with different final concentrations of H2O2 and were incubated for 60 min at 37°C with shaking. After the elimination of the oxidizing agent, the total viable-cell numbers in each culture were determined by spotting serial dilutions of the cultures onto LB agar plates. The colonies were counted after 24 h of incubation at 37°C.
ACKNOWLEDGMENTS
This work was supported by the National Council of Science and Technology (CONACYT; grants 221231 and A1-S-27116) of Mexico, the University of Guanajuato (grant CIIC 228/2019), and the National Institutes of Health (NIH; grant R15GM13141). H.C.L.-S. and N.V.-N. were supported by scholarships from CONACyT.
We are grateful for the technical assistance of Norma Ramirez-Ramirez and Holly A. Martin, who provided invaluable help with the DNA sequencing experiments.
Supplemental Material
File (jb.00807-19-s0001.pdf)
- Download
- 455.84 KB
REFERENCES
1.
Ryan FJ. 1955. Spontaneous mutation in non-dividing bacteria. Genetics 40:726–738.
2.
Cairns J, Foster PL. 1991. Adaptive reversion of a frameshift mutation in Escherichia coli. Genetics 128:695–701.
3.
Foster PL, Cairns J. 1992. Mechanisms of directed mutation. Genetics 131:783–789.
4.
Robleto EA, Yasbin R, Ross C, Pedraza-Reyes M. 2007. Stationary phase mutagenesis in B. subtilis: a paradigm to study genetic diversity programs in cells under stress. Crit Rev Biochem Mol Biol 42:327–339.
5.
Kivisaar M. 2003. Stationary phase mutagenesis: mechanisms that accelerate adaptation of microbial populations under environmental stress. Environ Microbiol 5:814–827.
6.
Bull HJ, McKenzie GJ, Hastings PJ, Rosenberg SM. 2000. Evidence that stationary-phase hypermutation in the Escherichia coli chromosome is promoted by recombination. Genetics 154:1427–1437.
7.
Hendrickson H, Slechta ES, Bergthorsson U, Andersson DI, Roth JR. 2002. Amplification-mutagenesis: evidence that “directed” adaptive mutation and general hypermutability result from growth with a selected gene amplification. Proc Natl Acad Sci U S A 99:2164–2169.
8.
Wright BE. 2004. Stress-directed adaptive mutations and evolution. Mol Microbiol 52:643–650.
9.
Sung HM, Yasbin RE. 2002. Adaptive, or stationary-phase, mutagenesis, a component of bacterial differentiation in Bacillus subtilis. J Bacteriol 184:5641–5653.
10.
Jinks-Robertson S, Bhagwat AS. 2014. Transcription-associated mutagenesis. Annu Rev Genet 48:341–359.
11.
Robleto E, Martin H, Vallin C, Pedraza-Reyes M, Yasbin R. 2013. Transcription mediated mutagenic processes, p 41–58. In Mittelman D (ed), Stress-induced mutagenesis. Springer, New York, NY.
12.
Saxowsky TT, Doetsch PW. 2006. RNA polymerase encounters with DNA damage: transcription-coupled repair or transcriptional mutagenesis? Chem Rev 106:474–488.
13.
Selby CP, Sancar A. 1994. Mechanisms of transcription-repair coupling and mutation frequency decline. Microbiol Rev 58:317–329.
14.
Doetsch PW. 2002. Translesion synthesis by RNA polymerases: occurrence and biological implications for transcriptional mutagenesis. Mutat Res 510:131–140.
15.
Rudner R, Murray A, Huda N. 1999. Is there a link between mutation rates and the stringent response in Bacillus subtilis? Ann N Y Acad Sci 870:418–422.
16.
Pybus C, Pedraza-Reyes M, Ross CA, Martin H, Ona K, Yasbin RE, Robleto E. 2010. Transcription-associated mutation in Bacillus subtilis cells under stress. J Bacteriol 192:3321–3328.
17.
Ross C, Pybus C, Pedraza-Reyes M, Sung HM, Yasbin RE, Robleto E. 2006. Novel role of mfd: effects on stationary-phase mutagenesis in Bacillus subtilis. J Bacteriol 188:7512–7520.
18.
Villegas-Negrete N, Robleto EA, Obregón-Herrera A, Yasbin RE, Pedraza-Reyes M. 2017. Implementation of a loss-of-function system to determine growth and stress-associated mutagenesis in Bacillus subtilis. PLoS One 12:e0179625.
19.
Ambriz-Aviña V, Yasbin RE, Robleto EA, Pedraza-Reyes M. 2016. Role of base excision repair (BER) in transcription-associated-mutagenesis of nutritionally stressed non-growing Bacillus subtilis cell subpopulations. Curr Microbiol 73:721–726.
20.
Martin HA, Pedraza-Reyes M, Yasbin RE, Robleto EA. 2011. Transcriptional de-repression and Mfd are mutagenic in stressed Bacillus subtilis cells. J Mol Microbiol Biotechnol 21:45–58.
21.
Park JS, Marr MT, Roberts JW. 2002. E. coli transcription repair coupling factor (Mfd protein) rescues arrested complexes by promoting forward translocation. Cell 109:757–767.
22.
Ayora S, Rojo F, Ogasawara N, Nakai S, Alonso JC. 1996. The Mfd protein of Bacillus subtilis 168 is involved in both transcription-coupled DNA repair and DNA recombination. J Mol Biol 256:301–318.
23.
Zalieckas JM, Wray LV, Ferson AE, Fisher SH. 1998. Transcription-repair coupling factor is involved in carbon catabolite repression of the Bacillus subtilis hut and gnt operons. Mol Microbiol 27:1031–1038.
24.
Martin HA, Porter KE, Vallin C, Ermi T, Contreras N, Pedraza-Reyes M, Robleto EA. 2019. Mfd protects against oxidative stress in Bacillus subtilis independently of its canonical function in nucleotide excision repair. BMC Microbiol 19:26.
25.
Million-Weaver S, Samadpour AN, Moreno-Habel DA, Nugent P, Brittnacher MJ, Weiss E, Hayden HS, Miller SI, Liachko I, Merrikh H. 2015. An underlying mechanism for the increased mutagenesis of lagging-strand genes in Bacillus subtilis. Proc Natl Acad Sci U S A 112:E1096–E1105.
26.
Wimberly H, Shee C, Thornton PC, Sivaramakrishnan P, Rosenberg SM, Hastings PJ. 2013. R-loops and nicks initiate DNA breakage and genome instability in non-growing Escherichia coli. Nat Commun 4:2115.
27.
Valenzuela-García LI, Ayala-García VM, Regalado-García AG, Setlow P, Pedraza-Reyes M. 2018. Transcriptional coupling (Mfd) and DNA damage scanning (DisA) coordinate excision repair events for efficient Bacillus subtilis spore germination/outgrowth. Microbiologyopen 7:e00593.
28.
Fish RN, Kane CM. 2002. Promoting elongation with transcript cleavage stimulatory factors. Biochim Biophys Acta 1577:287–307.
29.
Borukhov S, Sagitov V, Goldfarb A. 1993. Transcript cleavage factors from Escherichia coli. Cell 72:459–466.
30.
Erie DA, Hajiseyedjavadi O, Young MC, von Hippel PH. 1993. Multiple RNA polymerase conformations and GreA: control of the fidelity of transcription. Science 262:867–873.
31.
Marr MT, Roberts JW. 2000. Function of transcription cleavage factors GreA and GreB at a regulatory pause site. Mol Cell 6:1275–1285.
32.
Gómez-Marroquín M, Martin H, Pepper A, Girard M, Kidman A, Vallin C, Yasbin R, Pedraza-Reyes M, Robleto E. 2016. Stationary- phase mutagenesis in stressed Bacillus subtilis cells operates by Mfd-dependent mutagenic pathways. Genes 7:E33.
33.
Toulme F, Mosrin-Huaman C, Sparkowski J, Das A, Leng M, Rahmouni AR. 2000. GreA and GreB proteins revive backtracked RNA polymerase in vivo by promoting transcript trimming. EMBO J 19:6853–6859.
34.
Sekiguchi M, Tsuzuki T. 2002. Oxidative nucleotide damage: consequences and prevention. Oncogene 21:8895–8904.
35.
Michaels M, Miller J. 1992. The GO system protects organisms from the mutagenic effect of the spontaneous lesion 8-hydroxyguanine (7,8-dihydro-8-oxoguanine). J Bacteriol 174:6321–6325.
36.
Ramírez M, Castellanos-Juárez F, Yasbin R, Pedraza-Reyes M. 2004. The ytkD (mutTA) gene of Bacillus subtilis encodes a functional antimutator 8-oxo-(dGTP/GTP)ase and is under dual control of sigma A and sigma F RNA polymerases. J Bacteriol 186:1050–1059.
37.
Castellanos-Juárez F, Alvarez-Alvarez C, Yasbin R, Setlow B, Setlow P, Pedraza-Reyes M. 2006. YtkD and MutT protect vegetative cells but not spores of Bacillus subtilis from oxidative stress. J Bacteriol 188:2285–2289.
38.
Sasaki M, Yonemura Y, Kurusu Y. 2000. Genetic analysis of Bacillus subtilis mutator genes. J Gen Appl Microbiol 46:183–187.
39.
Vidales LE, Cárdenas LC, Robleto E, Yasbin RE, Pedraza-Reyes M. 2009. Defects in the error prevention oxidized guanine system potentiate stationary-phase mutagenesis in Bacillus subtilis. J Bacteriol 191:506–513.
40.
Debora BN, Vidales LE, Ramírez R, Ramírez M, Robleto EA, Yasbin RE, Pedraza-Reyes M. 2011. Mismatch repair modulation of MutY activity drives Bacillus subtilis stationary-phase mutagenesis. J Bacteriol 193:236–245.
41.
Castro-Cerritos KV, Yasbin RE, Robleto EA, Pedraza-Reyes M. 2017. Role of ribonucleotide reductase in Bacillus subtilis stress-associated mutagenesis. J Bacteriol 99:e00715-16.
42.
Barajas-Ornelas RDC, Ramírez-Guadiana FH, Juárez-Godínez R, Ayala-García VM, Robleto EA, Yasbin RE, Pedraza-Reyes M. 2014. Error-prone processing of apurinic/apyrimidinic (AP) sites by PolX underlies a novel mechanism that promotes adaptive mutagenesis in Bacillus subtilis. J Bacteriol 196:3012–3022.
43.
Campos SS, Ibarra-Rodriguez JR, Barajas-Ornelas RC, Ramírez-Guadiana FH, Obregón-Herrera A, Setlow P, Pedraza-Reyes M. 2014. Interaction of apurinic/apyrimidinic endonucleases Nfo and ExoA with the DNA integrity scanning protein DisA in the processing of oxidative DNA damage during Bacillus subtilis spore outgrowth. J Bacteriol 196:568–578.
44.
Gómez-Marroquín M, Vidales LE, Debora BN, Santos-Escobar F, Obregón-Herrera A, Robleto EA, Pedraza-Reyes M. 2015. Role of Bacillus subtilis DNA glycosylase MutM in counteracting oxidatively induced DNA damage and in stationary-phase-associated mutagenesis. J Bacteriol 197:1963–1971.
45.
Cohen SE, Walker GC. 2010. The transcription elongation factor NusA is required for stress-induced mutagenesis in Escherichia coli. Curr Biol 20:80–85.
46.
Friedberg EC, Walker GC, Siede W, Wood RD, Schultz RA, Ellenberger T. 2006. DNA repair and mutagenesis, 2nd ed. ASM Press, Washington, DC.
47.
Clauson CL, Oestreich KJ, Austin JW, Doetsch PW. 2010. Abasic sites and strand breaks in DNA cause transcriptional mutagenesis in Escherichia coli. Proc Natl Acad Sci U S A 107:3657–3662.
48.
Kusuya Y, Kurokawa K, Ishikawa S, Ogasawara N, Oshima T. 2011. Transcription factor GreA contributes to resolving promoter-proximal pausing of RNA polymerase in Bacillus subtilis cells. J Bacteriol 193:3090–3099.
49.
Cohen SE, Godoy VG, Walker GC. 2009. Transcriptional modulator nusA interacts with translesion DNA polymerases in Escherichia coli. J Bacteriol 191:665–672.
50.
Pastoriza-Gallego M, Armier J, Sarasin A. 2007. Transcription through 8-oxoguanine in DNA repair proficient and Csb–/Ogg1– DNA repair-deficient mouse embryonic fibroblasts is dependent upon promoter strength and sequence context. Mutagenesis 22:343–351.
51.
Charlet-Berguerand N, Feuerhahn S, Kong SE, Ziserman H, Conaway JW, Conaway R, Egly JM. 2006. RNA polymerase II bypass of oxidative DNA damage is regulated by transcription elongation factors. EMBO J 25:5481–5491.
52.
Mathews CK. 2006. DNA precursor metabolism and genomic stability. FASEB J 20:1300–1314.
53.
Boylan RJ, Mendelson NH, Brooks D, Young FE. 1972. Regulation of the bacterial cell wall: analysis of a mutant of Bacillus subtilis defective in biosynthesis of teichoic acid. J Bacteriol 110:281–290.
54.
Sambrook J, Russell DW. 2001. Molecular cloning: a laboratory manual, 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
55.
Cutting SM, Vander Horn PB. 1990. Genetic analysis, p 27–74. In Harwood CR, Cutting SM (ed), Molecular biological methods for Bacillus. John Wiley & Sons, Chichester, Sussex, England.
56.
Lea DE, Coulson CA. 1949. The distribution of the numbers of mutants in bacterial populations. J Genet 49:264–285.
57.
Pedraza-Reyes M, Yasbin RE. 2004. Contribution of the mismatch DNA repair system to the generation of stationary-phase-induced mutants of Bacillus subtilis. J Bacteriol 186:6485–6491.
Information & Contributors
Information
Published In
Journal of Bacteriology
Volume 202 • Number 9 • 9 April 2020
eLocator: 10.1128/jb.00807-19
Editor: Tina M. Henkin, Ohio State University
Copyright
© 2020 American Society for Microbiology. All Rights Reserved.
History
Received: 2 January 2020
Accepted: 5 February 2020
Published online: 9 April 2020
Keywords
Contributors
Editor
Tina M. Henkin
Editor
Ohio State University
Metrics & Citations
Metrics
Note: There is a 3- to 4-day delay in article usage, so article usage will not appear immediately after publication.
Citation counts come from the Crossref Cited by service.
Citations
If you have the appropriate software installed, you can download article citation data to the citation manager of your choice. Simply select your manager software from the list below and click Download.