Limited Model Antigen Expression by Transgenic Fungi Induces Disparate Fates during Differentiation of Adoptively Transferred T Cell Receptor Transgenic CD4⁺ T Cells: Robust Activation and Proliferation with Weak Effector Function during Recall

Inbred strains of C57BL/6 mice (males 7 to 8 weeks old at the time of these experiments) and the T lymphocyte-specific Thy1.1 allele-carrying congenic C57BL/B6 strain B6.PL-Thy1^a/Cy (stock no. 000406) (12) were obtained from Jackson laboratories, Bar Harbor, ME. Two male TEa Tg mice of the C57BL/6J (B6; I-A^b, I-E⁻) background (13, 15) expressing the Thy1.2 allele were generously provided by A. Y. Rudensky at the Howard Hughes Medical Institute, University of Washington. The Tg TCR in TEa mouse lymphocytes recognizes a peptide representing residues 52 to 68 of the I-Eα chain (Eα peptide) bound to class II I-A^b molecules. TEa Tg mice expressing the Thy1.1 allele were produced at the University of Wisconsin by backcrossing the original TEa males two times to wild-type B6 females expressing the congenic Thy1.1 marker and screened for the Thy1 allele and transgene. To identify the transgene-positive progeny, lymphocytes from peripheral blood were stained with phycoerythrin (PE)-Cy7-labeled anti-CD4, fluorescein isothiocyanate (FITC)-labeled anti-Vα2, and PE-labeled anti-Vβ6 antibodies (BD Pharmingen) and analyzed by fluorescence-activated cell sorter (FACS) analysis as previously described (15). Blastomyces-specific TCR Tg strain 1807 mice were generated in the Klein lab and described elsewhere (37, 42, 43). Strain 1807 mice were backcrossed to congenic Thy1.1-positive (Thy1.1⁺) mice as described above. Mice were housed and cared for according to guidelines of the University of Wisconsin Animal Care Committee, who approved all aspects of this work.

Strains used were ATCC 26199 (American Type Culture Collection) (16), a wild-type virulent strain, and the isogenic, attenuated mutant lacking BAD1, designated strain 55 (6). Isolates of B. dermatitidis were maintained as yeast on Middlebrook 7H10 agar with oleic acid-albumin complex (Sigma Chemical Co., St. Louis, MO) at 39°C.

Yeast cells expressing either Eα or 2W1S Ag epitopes were generated by Agrobacterium-mediated transformation using a binary plasmid expressing a three-way fusion of the epitope, the red fluorescent protein (RFP) mCherrry (mCh) (32), and a truncated version of BAD1. To streamline the generation of chimeric genes expressing different epitopes, an Agrobacterium binary plasmid that contains unique cloning sites and the ccdB gene inserted into the NcoI site in the truncated BAD1 gene was constructed. The ccdB gene aids in the cloning of sequences of choice by preventing Escherichia coli clones harboring nonrecombinant, parental plasmids from growing (3). Primers were obtained from Integrated DNA Technologies (Coralville, IA). PCR for cloning was done using Elongase (Invitrogen, Carlsbad, CA). The starting plasmid was a derivative of pBAD1-6H, containing the truncated tandem repeat sequence (ΔTR20) of BAD1 (5), called pΔ5-6H. The ccdB gene was PCR amplified from an Invitrogen Gateway cassette-containing plasmid using primers that added NcoI and AscI sites at the 5′ end of the forward primer, tdsP182 (GCGCCCATGGCGCGCCTGGCCGGCCTACTAAAAGCCAGATAACAGT), and NcoI and SwaI at the 5′ end of the reverse primer, tdsP181 (GCGCCCATGGGATTTAAATCGGCCGGCCAGTCGTTCGGCTTCATCT). Following PCR, the 800-bp fragment was digested with NcoI and ligated with pΔ5-6H plasmid DNA that had also been digested with NcoI, and the ligated DNA was electroporated into an E. coli strain permissive for growth with the ccdB gene, DB3.1 (35). Transformants were screened for the presence of the insert and correct orientation. In addition, the cloned plasmids were tested for a functional ccdB gene by electroporating them into the nonpermissive strain DH10β and finding that transformants were severely restricted in growth. The ΔTR20-ccdB chimeric gene was excised with XbaI (filled in) and EcoRI and moved into the Agrobacterium binary vector pCTK4 (28) at the HindIII (filled in) and EcoRI sites, creating plasmid pCTS33. A fragment containing the Eα epitope region of pTrc-Eα-RFP (encoding amino acids 52 to 68 and 6 flanking amino acids of the Eα protein [19, 31] and the mCherry RFP gene [32]) was generated using splicing overlap (SOE) PCR (23) with Eα forward primer tdsP202 containing an incorporated AscI site at its 5′ end (CGCGGGCGCGCCGAAGAATTTGCAAAGTT), SOE fusion Eα-mCherry (Eα-mCh) reverse primer tdsP216 (AACCTGGATGTCATGGAGGTGAGCAAGGGCGAGGAG), SOE fusion Eα-mCherry forward primer tdsP217 (CTCCTCGCCCTTGCTCACCTCCATGACATCCAGGTT), and the mCherry reverse primer tdsP218 with a SmaI site at its 5′ end (CGCGCCCGGGCCTTGTACAGCTCGTCCAT). The fused fragment was digested with AscI and SmaI and ligated with pCTS33, which had been digested with AscI and SwaI, and the DNA was electroporated into E. coli strain DH10β. To create a 2W1S epitope-mCherry fusion, a 93-nucleotide (nt) oligomeric primer that contains sequence encoding the 14-amino-acid 2W1S epitope (29) flanked by 2 amino acids that match those flanking the comparable sequence of the Eα epitope and two glycine residue spacers was generated (composite amino acid sequence, GGSFEAWGALANWAVDSANLGG). In addition, this primer includes a 5′ end AscI site and 3′ end sequence for priming at the start of the mCherry sequence (tdsP615, GCGCGGCGCGCCGGCGGTAGCTTTGAGGCTTGGGGTGCACTGGCTAATTGGGCTGTGGACAGCGCTAACCTGGGCGGTGTGAGCAAGGGCGAG). Primer tdsP615 was used with tdsP618 (GGGCCTTGTACAGCTCGTCCAT) to amplify a cloned mCherry sequence and, in so doing, add the 2W1S epitope sequence. The fragment was digested with AscI, which cuts at the 5′ end of the fragment (the 3′ end was left blunt), and ligated to AscI- and SwaI-digested pCTS33. For both Eα and 2W1S, transformants were screened for plasmids with the new insert and sequenced to find those without PCR-induced mutations and to confirm that the Eα-mCherry or 2W1S-mCherry fragment had been inserted to create a single translational fusion in the ΔTR20 protein backbone. The plasmids were electroporated into Agrobacterium tumefaciens strain LBA1100 harboring the Ti plasmid pAL1100 (2, 10). Confirmed A. tumefaciens strains were used to transform yeast-phase cells of B. dermatitidis strain ATCC 26199 and strain 55, the BAD1-knockout derivative of ATCC 26199 (5, 35).

Transformants of strain 55 were initially screened for production of the fusion protein using an overlay assay to detect secreted BAD1 (6) and subsequently analyzed by Western blotting with anti-BAD1 antibodies on yeast cell extracts to confirm that the fusion protein is the predicted size (5) (data not shown). Positive yeast cell lines were also screened for red fluorescence microscopically on an Olympus BX60 fluorescence microscope (Center Valley, PA) and by FACS analysis using the dichroic mirror at 595LP and the PE-Texas Red band-pass filter (6). Finally, the strains showing high expression of the Tg protein were also noted to have visibly pink/red colonies when plated on 7H10 medium, and this characteristic was used to ensure that yeast cells used for in vivo and in vitro experiments were expressing the Eα- or 2W1S-mCherry-ΔTR20 (truncated BAD1) fusion protein at high levels. To identify transformants with the highest transgene expression, we stained them with 1 μg of anti-BAD1 monoclonal antibody (MAb) DD5-CB4 (44) and goat anti-mouse IgG FITC-conjugated secondary antibody (1:200 dilution; Sigma) for 30 min and analyzed the yeast for maximal fluorescence in the FITC (BAD1) and PE-Texas Red (mCh) channels by FACS analysis. Tg ATCC 26199 yeast cells were identified by using the red color as an indication for transgene expression as described above.

The generation of recombinant E. coli expressing the Eα-RFP fusion protein containing the Eα and DsRed sequences, kindly provided by Marc Jenkins (Minneapolis, MN), was described elsewhere (19). Protein production was induced with 1 mM isopropyl-β-d-thiogalactopyranoside overnight, and the Eα-RFP fusion protein was purified from the bacterial lysate using either a chitin-bead affinity column (New England BioLabs) or an Ni²⁺ resin His-Bind column (Novagen).

The Y-Ae hybridoma was generously provided by Marc Jenkins (University of Minnesota) (19). Monoclonal antibody from ascites was ammonium sulfate precipitated, purified on protein A/G agarose according to the manufacturer's specifications for the isolation and purification of IgG (product 21001; Pierce Chemical, Rockford, IL), and quantified by measuring the optical density at 280 nm. The MAb was biotinylated using an EZ-Link N-hydroysulfosuccinimide long chain (sulfo-NHS-LC) kit (Thermo Fisher Scientific) according to the manufacturer's protocol. To detect Eα peptide-MHC class II (MHC-II) displayed in bone marrow-derived dendritic cells (BM-DCs), Y-Ae antibody was used at 50 to 100 μg per sample. Y-Ae staining was performed with a staining buffer of phosphate-buffered saline (PBS) containing 1% bovine serum albumin plus 2 mM EDTA.

The recombinant vesicular stomatitis virus (VSV) containing a gene cassette encoding the ovalbumin-derived peptide SIINFEKL, the Eα peptide (amino acid residues 52 to 68), and DsRed (VSV-SED) was kindly provided by Leo Lefrancois (Storrs, CT) (4). The recombinant Listeria monocytogenes strain expressing the 2W1S peptide was kindly provided by Marc Jenkins (11).

Unless otherwise stated, C57BL/6 mice were vaccinated subcutaneously (s.c.) at two sites, dorsally and at the base of the tail, using one injection of the following formulations, doses, and routes of delivery: recombinant yeast expressing Eα-mCh, 2W1S-mCh, or BAD1-null attenuated yeast was injected either live s.c. or in a heat-killed form intravenously (i.v.) using a dose range of 10⁵ to 10⁷ yeast per mouse. Soluble Eα-RFP from 0.8 μg to 100 μg recombinant protein was injected s.c. alone or as an emulsion with incomplete Freund's adjuvant (IFA). The 2W1S peptide (EAWGALANWAVDSA) was purchased from Biosynthesis, Lewisville, TX, and injected i.v. as a mixture containing 50 μg 2W1S peptide and 5 μg lipopolysaccharide (LPS; Sigma). VSV-SED was injected either i.v. using a dose of 10⁵ PFU (4) or s.c. at a range of 10⁵ to 10⁸ PFU recombinant L. monocytogenes expressing 2W1S peptide, which was injected i.v. using a range of 10 × 10⁶ to 100 × 10⁶ live bacteria.

Single-cell suspensions of splenocytes from TEa or 1807 mice (Thy1.1⁺ background) were labeled with 5- and 6-carboxyfluorescein diacetate succinimidyl ester (CFSE; Molecular Probes) as described previously (33), and various numbers of labeled cells were injected i.v. into wild-type congenic Thy1.2⁺ C57BL/6 male recipients. At various times after Ag injection, single-cell suspensions from draining inguinal and brachial lymph nodes of recipient mice were stained with monoclonal antibodies directed against the following surface markers; CD4, CD8, Thy1.1, CD44, CD62L, and B220 (as a dump marker). MAbs were obtained from BD Pharmingen (San Diego, CA) and eBioscience (San Diego, CA), and cytometry data were gathered with an LSRII flow cytometer (BD Biosciences, San Jose). Data were analyzed by using FlowJo software (Tree Star, Ashland, OR). The number of TEa and 1807 CD4⁺ T cells in a lymph node was calculated by multiplying the percentage of Thy1.1⁺ CD4⁺ cells by the number of viable cells determined by trypan blue dye exclusion.

On the day of challenge and daily thereafter, mice were given 2 mg of 5′-bromo-2-deoxyuridine (BrdU) in PBS by intraperitoneal (i.p.) injection. Four days later, the mice were sacrificed and T cells from the lung and mediastinal lymph node (MLN) were stained for surface markers and stained for BrdU incorporation using an FITC BrdU flow kit from BD Pharmingen, San Diego, CA.

Lung and draining lymph node cells were obtained as described previously (39). An aliquot of isolated cells was stained for surface CD4 and Thy1.1 to determine the percentage of transferred TCR Tg cells. The numbers of Tg cells per lung or lymph nodes were derived by multiplying the percentage of cells by the total number of cells per organ isolated. The rest of the cells were stimulated with anti-CD3 and anti-CD28 MAbs. After the 4- to 6-h stimulation, cells were stained for surface markers, fixed, permeabilized with a Cytofix/Cytoperm kit (BD Pharmingen), and stained with anticytokine antibodies as previously described (41, 45).

The spleen and inguinal and brachial lymph nodes were harvested for each mouse analyzed. A single-cell suspension was prepared and enriched with PE-conjugated 2W1S tetramer as described previously (26, 27). The resulting enriched fractions were resuspended in 0.1 ml of sorter buffer, and a small volume was removed for cell counting, while the rest of the sample was stained with a cocktail of the following fluorescently labeled antibodies: CD3-FITC, 2W1S tetramer-PE, CD4-peridinin chlorophyll protein, CD44 Alexa 700, CD8 V780, and biotinylated B220, CD11c, and CD11b-Strep V450 (as a dump channel). The entire sample was collected on an LSRII flow cytometer and analyzed with FlowJo software using the gating strategy described previously (26, 27). The percentage of tetramer-positive events was multiplied by the total number of cells in the enriched fraction to calculate the total number of tetramer-positive cells in the organs harvested.

Cell culture supernatants were generated in 24-well plates in 1 ml containing 2 × 10⁵ TEa, OT-II, or naïve CD4⁺ T cells and BM-DCs (1:1 ratio), 10 μM Eα peptide, or 10⁵ Eα-RFP or TR20 yeast (38). Supernatants were collected after 48 h of coculture. Granulocyte-macrophage colony-stimulating factor (GM-CSF) and interleukin-2 (IL-2) (R&D System, Minneapolis, MN) were measured by enzyme-linked immunosorbent assay (ELISA) according to manufacturer specifications (detection limits, 0.05 ng/ml and 0.02 ng/ml, respectively).

At 4 to 5 weeks postvaccination, mice were infected intratracheally (i.t.) with 2 × 10³ to 2 × 10⁴ wild-type strain ATCC 26199 or Eα-mCh-expressing ATCC 26199 yeast cells as described previously (38). At day 4 postinfection, coinciding with the peak of T cell influx (39, 40), the mice were sacrificed and lung T cells were analyzed by FACS analysis.

The number and percentage of activated, proliferating, or cytokine-producing T cells and differences in numbers of CFU were analyzed using the Wilcoxon rank test for nonparametric data (14) or the t test when data were normally distributed. Contractions of T cells (number of T cells at the burst of expansion versus during the memory phase) were analyzed by the two-way analysis of variance test. A P value of <0.05 is considered statistically significant.

To enumerate, characterize, and track Ag-specific T cells, we expressed the model epitope Eα (for which TCR Tg TEa mice are available) fused to mCherry (Eα-mCh) in the vaccine strain of B. dermatitidis. Eα-mCh protein is a recombinant 32-kDa chimeric fusion protein consisting of amino acids 46 to 74 of the I-E^dα MHC-II subunit at the N terminus and the red fluorescent protein mCherry at the C terminus (32). We hypothesized that chimeric Eα-mCh protein expressed on a backbone of the signal sequence and 10 copies of the BAD1 tandem repeat (Fig. 1A) would be delivered to the cell surface and stain the yeast red. We assessed Tg yeast by microscopy and FACS analysis. Eα-mCh yeast stained red (Fig. 1B and C) and expressed BAD1 at levels comparable to TR20 control yeast, whereas BAD1-null yeast failed to stain red or express BAD1 (Fig. 1C). Thus, our Tg yeast displayed chimeric Eα-mCh-BAD1 in and on the yeast cell.

We tested whether chimeric Eα-mCh-BAD1 on yeast is processed and presented by antigen-presenting cells (APCs). When the Tg yeast was added to bone marrow-derived DCs in vitro, the fungi were processed and the pEα–I-A^b complexes were displayed on the DC surface and detected by FACS analysis with Y-Ae MAb (Fig. 2A). The findings with Eα-mCh yeast were comparable to results seen with a lysate of E. coli cells that express recombinant Eα-RFP-DsRed (25) or with His-tagged Eα-RFP purified from E. coli (data not shown). Importantly, Eα-mCh yeast cocultured with DC in vitro triggered activation and cytokine production in naïve and primed TEa cells when the T cells were added to cell culture wells (Fig. 2B). Thus, the DCs process and present Ag in Tg vaccine yeast and display model Eα peptide that can be detected within MHC-II on the DC surface by Y-Ae MAb, and these pEα–I-A^b complexes trigger Ag-specific T cells in vitro.

In view of these in vitro results, we undertook in vivo studies to explore activation, expansion, and tracking of TEa T cells after administration of Eα-mCh yeast vaccine (Fig. 2C). Here, we adoptively transferred 5 × 10⁶ Thy1.1 TEa cells into Thy1.2 congenic mice 2 h before vaccination. Four days later, T cells from draining lymph nodes and spleen were analyzed. Controls included the TR20 strain lacking the transgene (ΔTR20; negative control) and the purified Eα-RFP (positive control). Vaccination with Eα-mCh yeast specifically activated and expanded TEa T cells in the node and spleen. About 68 to 70% of the Thy1.1 TEa cells expressed the activation marker CD44 and proliferated (defined by loss of CFSE) (Fig. 2C). The results were similar after vaccination with the positive control, Eα-RFP. In contrast, vaccination with the negative-control yeast expressing only the ΔTR20-BAD1 fusion partner (lacking Eα-mCh) failed to activate TEa T cells.

The number of transferred Tg T cells and amount of available Ag can impact expansion and activation of naïve precursor cells (1, 17). To determine the optimal conditions for T cell activation and expansion, we determined by crisscross titration the frequency of naïve TEa precursors with the vaccine dose of recombinant yeast and protein. Decreasing numbers of TEa cells were transferred into recipients on the day of vaccination, and the expansion of these cells was assessed in the draining lymph nodes 4 days after vaccination (peak of expansion; data not shown) using a dose range of 10⁵ to 10⁷ vaccine yeast or 0.8 μg to 100 μg of Eα-RFP. Expansion and activation of TEa cells were assessed by calculating the number of total CFSE^low and CD44⁺ Thy1.1⁺ cells. Independent of the transferred frequency, >80% TEa precursors became activated (data not shown) and expanded in a vaccine dose-dependent and Ag-specific manner (Fig. 3A and B). TEa cells showed significantly greater activation and expansion in mice vaccinated with 10⁶ or 10⁷ Eα-mCh yeast than mice vaccinated with 10⁵ Eα-mCh yeast, TR20 yeast, or no vaccine. Even though TEa cell activation and expansion were the greatest with the highest vaccine dose, they approached a plateau with a dose of 10⁶ Tg yeast. The precursor frequency of 5 × 10⁵ TEa cells yielded the greatest T cell activation and expansion.

At a high precursor frequency, the amount of Ag may be limiting, thus reducing T cell activation and expansion. However, at lower precursor frequencies, in the absence of Eα Ag (e.g., the no-vaccine group), the number of TEa cells approaches the limit of detection, making the calculations for T cell expansion less accurate. Thus, we also calculated the ratio of total expanded TEa cells in mice that were vaccinated with the same dose and regimen but received log dilutions of TEa cell precursors. We calculated these ratios only for the two highest vaccine doses (10⁶ and 10⁷ yeast) since they drove significant expansion. The differences in TEa numbers were 5- to 6-fold less in Eα-mCh yeast-vaccinated mice that received 5 × 10⁶ precursors than in those vaccinated with 5 × 10⁵ precursors, indicating that TEa cells expanded relatively more at the lower precursor frequency (data not shown); in contrast, the relative expansion of TEa cells in mice that received 5 × 10⁵ versus 5 × 10⁴ precursors was nearly 10-fold, indicating that the lower precursor frequency did not yield increased proliferation. Thus, adoptive transfer of 1 × 10⁵ to 5 × 10⁵ TEa cells yielded maximal expansion, whereas a plateau was reached with transfer at higher frequencies.

Vaccination with Eα-RFP at ≥4 μg yielded maximal TEa cell activation and expansion, whereas a dose of 0.8 μg was limiting. Similar to yeast vaccination, TEa cells expanded most when they were transferred at a frequency of 5 × 10⁵ precursors, likely for the reasons noted above. On the basis of these findings, in subsequent experiments, we chose to transfer 1 × 10⁵ to 5 × 10⁵ TEa cells unless otherwise stated, and we vaccinated mice with 10⁶ Eα-mCh yeast or 20 μg of Eα-RFP because those doses induced maximal proliferation and activation at this precursor frequency.

To see if primed antifungal TEa cells are functional during challenge and migrate to the lung and express cytokine, we analyzed the influx of Tg CD4⁺ T cells at 4 days postinfection. Few to no TEa cells migrated to the lungs when we transferred 10⁵ naïve Tg cells prior to vaccination (Fig. 4A). Since effector T cell development requires higher Ag loads than proliferation (18, 20), we speculated that the deficits of primed TEa cells described above might stem from a limited amount or duration of Eα Ag presentation. To test this idea, mice that received 10⁵ naïve TEa cells were vaccinated i.v. with 10⁵ VSV expressing Eα peptide (4). These conditions are known to induce TEa cell proliferation and promote memory development (4). Here, we found that TEa cells elicited by the VSV-SED vaccine were recruited to the lung on heterologous challenge with Blastomyces Eα-mCh yeast (Fig. 4A), indicating that functional TEa memory can develop if sufficient Ag is present during priming. These results suggest that Eα peptide is expressed by recombinant yeast, but perhaps in amounts too small to promote the development of functional memory. Nevertheless, the amount of Eα peptide expressed by wild-type Eα-mCh yeast upon lung rechallenge was sufficient to recruit T cells initially primed by VSV-SED but not Eα-mCh yeast. Thus, it is possible that the amount of Eα peptide expressed by Blastomyces Tg yeast limited the initial priming but not the recruitment of already primed TEa cells during the recall response.

The preceding studies required adoptive transfer of relatively large numbers of Ag-specific T cells from TCR Tg mice. In that approach, T cells may receive less intense stimulation when present in large numbers due to intraclonal competition and the limiting amounts of Ag available per naïve T cell precursor (1, 4, 17, 24). To see if poor T cell recall to the lung and function may be due to the limiting amount of recombinant Ag expressed by Blastomyces yeast, we investigated the activation and expansion of an endogenous Ag-specific CD4⁺ T cell. We engineered yeast that expresses 2W1S peptide (29). Tetramer-based enrichment recently showed the pool size of naïve 2W1S–I-A^b-specific CD4⁺ T cells in C57BL/6 mice to be 190 precursors in the spleen and lymph nodes (27). An i.v. injection of 2W1S peptide plus LPS increased the population of 2W1S–I-A^b-specific T cells 300-fold to a peak of ∼80,000 cells by day 6 (27).

To see if 2W1S-expressing yeast induced proliferation and activation of corresponding endogenous Ag-specific CD4⁺ T cells, we vaccinated mice s.c. with live yeast or i.v. with heat-killed yeast that expresses surface 2W1S. As positive controls, mice were vaccinated with 50 μg 2W1S peptide plus LPS- or 2W1S-expressing L. monocytogenes. The spleen and draining nodes were harvested and tetramer enriched, and the number and activation of 2W1S tetramer-positive cells were analyzed (26, 27). Vaccination with 2W1S peptide plus LPS or recombinant L. monocytogenes increased the numbers of total and CD44^hi tetramer-positive cells by 40- and 80-fold, respectively, compared to those for naïve mice (Fig. 4B). In contrast, s.c. or i.v. vaccination with yeast expressing 2W1S increased the number of tetramer-positive cells by 32- and 3.4-fold compared to that for control vaccine yeast. Remarkably, only 15% ± 2% of the tetramer-positive cells showed increased surface expression of CD44 after s.c. vaccination with recombinant yeast, suggesting that the primed cells had not been fully activated. Although Ag-specific T cells expanded less in mice vaccinated i.v. with recombinant yeast, about half of the tetramer-positive cells expressed elevated CD44. Similarly, about half of the tetramer-positive cells in the groups vaccinated with peptide or recombinant L. monocytogenes exhibited an activated phenotype (CD44^hi). Thus, 2W1S yeast did modestly expand endogenous Ag-specific CD4⁺ T cells, but the activation state of these T cells was surprisingly low, as measured by CD44 expression.

The preceding studies with Tg yeasts expressing Eα and 2W1S suggest that low antigen expression may have limited the development of effector T cells. To investigate whether endogenous fungal antigens prime naïve CD4⁺ T cells more efficiently than the model antigens, we adoptively transferred naïve B. dermatitidis-specific 1807 cells into mice prior to vaccination with BAD1-null yeasts that do not express model antigens (6, 37). Comparable numbers of polyclonal CD4⁺ T cells migrated into the lungs after challenge and expressed gamma interferon (IFN-γ) in mice that had received adoptively transferred TEa or 1807 cells and were vaccinated with Eα-mCh yeast or BAD1-null yeast (Fig. 4C). In contrast, 10-fold fewer antifungal TEa cells than 1807 cells migrated into the lung and produced cytokine. Thus, the limited recall response by model Ag-specific TEa cells was not observed with endogenous yeast Ag-specific 1807 cells.

To further explore the impact of Ag limitation on the recall response to the lung, we took a third approach. We regulated the dose of Ag by providing supplemental Eα protein with Eα-mCh yeast vaccine, and we prolonged the duration of Ag delivery by emulsifying Eα-RFP in IFA. Eα-RFP emulsified in IFA induced the maximal generation of effector/memory cells in the draining lymph nodes at 5 weeks postvaccination (Fig. 5A). The addition of Eα-RFP alone or with IFA to mice vaccinated with Eα-mCh yeast also increased the number of effector TEa cells in the draining nodes. However, the lung recall response was weak after vaccination with Eα-RFP plus IFA, similar to that after vaccination with Eα-mCh yeast (Fig. 5B). The addition of exogenous Eα-RFP alone or in conjunction with IFA to the Eα-mCh vaccine significantly enhanced the numbers of IFN-γ- and IL-17-producing TEa cells upon lung recall. These results indicate that Ag dose and duration influence the quantity and quality of the TEa recall response and illustrate that the amount of model Ag expressed by the recombinant vaccine is likely insufficient to drive an efficient recall of TEa effector cells into the lung. However, vaccination with Eα-RFP alone was insufficient to induce maximal responses, and Tg yeast in conjunction with high Ag loads delivered by Eα-RFP led to maximal recruitment of TEa effectors to the lung.

To investigate whether a lack of secondary expansion upon lung rechallenge contributes to the reduced numbers of TEa cells in mice vaccinated with Eα-mCh yeast, we measured TEa cell proliferation in the lung and MLN at day 4 postinfection. In all three groups of vaccinated mice (mice vaccinated with TR20, Eα-mCh, and Eα-mCh–Eα-RFP–IFA), >90% of the CD44⁺ CD62L^low TEa cells in the lung and MLN underwent proliferation, as measured by BrdU staining (Fig. 5C). Similarly, >90% of activated 1807 cells from vaccinated mice underwent secondary proliferation in the lung and MLN upon rechallenge. Since BrdU incorporation does not indicate the number of cell divisions, we cannot exclude the possibility that T cells expanded to different degrees among the vaccine groups. Interestingly, we observed an inverse relationship between the number of proliferated and activated T cells in the lung versus the MLN among the different groups of mice. Mice vaccinated with Eα-mCh–Eα-RFP–IFA or BAD1-null yeast showed efficient recruitment and/or secondary expansion of TEa and 1807 cells into the lung but poor secondary expansion into the MLN. On the other hand, poor recruitment of T cells into the lungs of Eα-mCh yeast-vaccinated mice or unvaccinated mice was accompanied by increased secondary expansion in the MLN. In summary, recruitment and/or secondary expansion is the determining factor for the number of TEa and 1807 cells found in the lung of rechallenged mice.