Interleukin-23 Orchestrates Mucosal Responses to Salmonella enterica Serotype Typhimurium in the Intestine
ABSTRACT
Salmonella enterica serotype Typhimurium causes an acute inflammatory reaction in the ceca of streptomycin-pretreated mice that involves T-cell-dependent induction of gamma interferon (IFN-γ), interleukin-22 (IL-22), and IL-17 expression (genes Ifn-γ, Il-22, and Il-17, respectively). We investigated here the role of IL-23 in initiating these inflammatory responses using the streptomycin-pretreated mouse model. Compared to wild-type mice, the expression of IL-17 was abrogated, IL-22 expression was markedly reduced, but IFN-γ expression was normal in the ceca of IL-23p19-deficient mice during serotype Typhimurium infection. IL-23p19-deficient mice also exhibited a markedly reduced expression of regenerating islet-derived 3 gamma, keratinocyte-derived cytokine, and reduced neutrophil recruitment into the cecal mucosa during infection. Analysis of CD3+ lymphocytes in the intestinal mucosa by flow cytometry revealed that αβ T cells were the predominant cell type expressing the IL-23 receptor in naive mice. However, a marked increase in the number of IL-23 receptor-expressing γδ T cells was observed in the lamina propria during serotype Typhimurium infection. Compared to wild-type mice, γδ T-cell-receptor-deficient mice exhibited blunted expression of IL-17 during serotype Typhimurium infection, while IFN-γ expression was normal. These data suggested that γδ T cells are a significant source, but not the sole source, of IL-17 in the acutely inflamed cecal mucosa of mice. Collectively, our results point to IL-23 as an important player in initiating a T-cell-dependent amplification of inflammatory responses in the intestinal mucosa during serotype Typhimurium infection.
Salmonella enterica serotype Typhimurium elicits an acute inflammatory response in the intestinal mucosa of humans that can be modeled using streptomycin-pretreated mice (2). This inflammatory reaction is initiated by direct contact of serotype Typhimurium with host cells, such as epithelial cells, macrophages, or dendritic cells, followed by an amplification of inflammatory responses in tissue (31). Responses that are effectively amplified in tissue give rise to the most prominent changes in gene expression observed in the intestinal mucosa during serotype Typhimurium infection, including markedly increased mRNA levels of gamma interferon (IFN-γ [Ifn-γ gene]), interleukin-17 (IL-17 [Il-17 gene]), and IL-22 (Il-22 gene) (9, 24, 25). T cells play an important role in amplifying inflammatory responses in the cecal mucosa, because depletion of CD3+ cells causes in a dramatic reduction in cecal inflammation and neutrophil recruitment (9). T-cell depletion also results in a markedly blunted induction of Ifn-γ, Il-17, and Il-22 in the intestinal mucosa during serotype Typhimurium infection (9, 25). IL-17 and IL-22 help to orchestrate intestinal inflammation by inducing the production of neutrophil chemoattractants (e.g., keratinocyte-derived cytokine [KC] or IL-8), dendritic cell chemoattractants (e.g., CCL20), and antimicrobials (e.g., Lipocalin-2 and iNOS) in the mucosa (9, 25, 42). However, the mechanisms by which T-cell-dependent amplification of responses to serotype Typhimurium infection is initiated in the intestinal mucosa have not been explored experimentally.
In other models of infection, cytokines released by macrophages or dendritic cells have been implicated in stimulating cytokine production by T cells. For example, detection of bacterial flagellin by cytosolic pattern recognition receptors in macrophages activates caspase 1, resulting in the release of mature IL-18 (6, 20, 21, 34). IL-18 can stimulate antigen experienced T cells to rapidly secrete IFN-γ during bacterial infection by an antigen-independent mechanism, thereby significantly amplifying early effector responses in vivo (32). In a mouse model of Klebsiella pneumoniae lung infection, bacterial stimulation of Toll-like receptor 4 (TLR4) on dendritic cells results in IL-23 production (13). IL-23 in turn triggers the rapid production of IL-17 and IL-22 by T cells (1, 12), which is required for efficient neutrophil recruitment in this model (39, 40). IL-23 has also been implicated in enhancing inflammatory responses elicited by other bacterial pathogens, including Citrobacter rodentium, Pseudomonas aeruginosa, Mycoplasma pneumoniae, and Mycobacterium bovis (5, 36, 38, 42). The goal of the present study was to determine whether IL-23 contributes to an amplification of inflammatory responses in the cecal mucosa during serotype Typhimurium infection of streptomycin-pretreated mice.
MATERIALS AND METHODS
Bacterial strains and culture conditions.
Serotype Typhimurium strain IR715 is a fully virulent, nalidixic acid-resistant derivative of isolate ATCC 14028 and was used in all experiments (33). Bacteria were cultured aerobically at 37°C in Luria-Bertani (LB) broth.
Animal experiments.
Mice deficient in p19 (IL-23p19−/− mice) were generated by breeding B6.129S5-Il23p19tm1Lex mice with C57BL/6 mice under specific-pathogen-free conditions in a barrier facility. IL-23p19−/− mice and wild-type littermates were bred and genotyped at the Mutant Mouse Regional Resource Center at the University of California, Davis. Mice deficient for Tcd, the gene encoding the δ T-cell receptor chain, were obtained from the Jackson Laboratory (B6.129P2-Tcrdtm1Mom/J).
To study inflammation in the cecum, streptomycin-pretreated mice were orally infected with serotype Typhimurium as described previously (2). In brief, mice were inoculated with streptomycin (0.1 ml of a 200-mg/ml solution in sterile water) intragastrically. IL-23p19−/− mice (n = 16) and wild-type littermates (n = 9) were inoculated intragastrically 24 h later with bacteria (0.1 ml containing approximately 5 × 108 CFU). As a control, IL-23 p19−/− mice (n = 6) and wild-type littermates (n = 8) were inoculated with 0.1 ml of sterile LB broth (mock infection). Trd−/− (n = 6) and wild-type C57/B6 (n = 5) mice were infected as described above with serotype Typhimurium. As a control, wild-type (n = 6) and Trd−/− mice (n = 4) were inoculated with 0.1 ml of LB broth (mock infection). At 48 h after infection, mice were euthanized, and samples of the cecum collected for isolation of mRNA and for histopathological analysis. For bacteriologic analysis, cecal contents and Peyer's patches were homogenized, and serial 10-fold dilutions were spread on agar plates containing the appropriate antibiotics. For isolation of intraepithelial lymphocytes (IEL) and lamina propria lymphocytes (LPL) from infected mice, three groups of two 8- to 10-week-old mice (C57BL/6; Jackson Laboratory) were inoculated with streptomycin (0.1 ml of a 200-mg/ml solution in sterile water) intragastrically. After 24 h, the mice were inoculated with bacteria (0.1 ml containing approximately 5 × 108 CFU). IEL and LPL were isolated 48 h postinfection.
Real-time PCR.
For analysis of the changes in gene expression after serotype Typhimurium infection in the mouse cecum, tissue samples were collected and immediately snap-frozen in liquid nitrogen at the site of surgery and stored at −80οC until processing. RNA was then extracted from snap-frozen tissue with TriReagent (Molecular Research Center) according to the instructions of the manufacturer. Next, 1 μg from each sample was reverse transcribed in 50 μl of TaqMan reverse transcription reagent (Applied Biosystems), and 4 μl of cDNA was used for each real-time reaction. Real-time PCR was performed using Sybr green (Applied Biosystems) and the 7900HT fast real-time PCR system. The data were analyzed by using a comparative threshold cycle method (Applied Biosystems). Increases in cytokine expression in infected mice were calculated relative to the average level of the respective cytokine in eight mock-infected wild-type mice. A list of genes analyzed in the present study with the respective primers is provided in Table 1.
For analysis of absolute copy number expression for Il-17 and Reg3g (the gene encoding regenerating islet-derived 3 gamma), real-time PCR was performed using 1 μl of cDNA (as described above) for each reaction in a temperature cycler equipped with a fluorescence detection monitor (LightCycler; Roche Diagnostics, Mannheim, Germany). Thus, cDNA corresponding to 20 ng of RNA served as a template in a 10-μl reaction containing 4 mM MgCl2, 0.5 μM concentrations of each primer, and 1× LightCycler-Fast Start DNA Master Sybr Green I mix (Roche Diagnostics). A negative control reaction without cDNA template was included with each set of reaction to check for possible contamination. The PCR conditions were as follows: initial denaturation at 95°C for 10 min, followed by 45 cycles of 95°C for 15 s, annealing at 60°C for 5 s, and extension at 72°C for 10 s. The cycle-to-cycle fluorescence emission was monitored at 530 nm and analyzed by using LightCycler software. Gene-specific plasmid standards were included with every set of reactions, and standard curves generated for each gene product were used to quantify the expression of Il-17 and Reg3g. All reactions were run in duplicate, and the intersample variation was <10%.
Histopathology.
Tissue samples were fixed in formalin, processed according to standard procedures for paraffin embedding, sectioned at 5 μm, and stained with hematoxylin and eosin. A veterinary pathologist scored inflammatory changes using a blind-sample analysis. Neutrophil counts were determined per high (×400)-magnification microscopy, and numbers were averaged from 10 microscopic fields for each animal.
Isolation of intestinal lymphocytes.
IEL and LPL were isolated from C57BL/6 mice by standard procedures (4, 19, 30). Briefly, three groups of two naive mice and three groups of two serotype Typhimurium-infected mice were euthanized, and organs from each group of mice were combined. Intestines were removed beginning from the duodenum and ending at the proximal colon. Intestines were dissected by removing the remaining mesentery and vasculature. Each segment was then opened longitudinally, the luminal content was removed, and the tissue was cut into ∼5-mm sections with a scalpel. The sections were subsequently washed in cold 1× Hanks balanced salt solution (HBSS; Gibco catalog no. 14185) containing 0.015 M HEPES (Gibco catalog no.15630) a total of six times to remove mucus and remaining fecal matter.
For IEL isolation, tissue was placed and stirred for 15 min at room temperature in prewarmed (37°C) 1× HBSS containing 10% fetal bovine serum (Gibco catalog no. 10082), 0.015 M HEPES, and 5 mM EDTA and stirred for 15 min 37°C, followed by three 15-min washes with buffer adjusted to room temperature. The supernatant from each wash was pooled and poured through a nylon wool column to enrich for T cells and remove mucus. The resulting cell suspension was used to analyze IEL.
To isolate LPL, the tissue remaining after IEL isolation was stirred in prewarmed (37°C) 1× RPMI (Sigma catalog no. R1145) containing 10% fetal bovine serum, penicillin-streptomycin (Gibco catalog no.15240-062), 0.015 M HEPES, and 1.6 mg of collagenase (Sigma-Aldrich catalog no. C6885)/ml for 45 min in a 37°C incubator. The resulting cell suspension was washed twice with 1× HBSS containing 0.015 M HEPES, enriched for T cells using a nylon wool column, and used to analyze LPL.
Flow cytometry.
The IEL and LPL suspensions containing approximately 4 × 106 cells each were resuspended in cold phosphate-buffered saline and stained with Aqua Live/Dead cell discriminator (Invitrogen catalog no. L34597) according to the manufacturer's protocol. Cells were then stained for 1 h in the dark at 4°C with optimized concentrations of anti-CD3 Alexa750-APC (eBioscience clone 17A2), anti-CD8 Alexa700 (eBioscience clone 53-6.7), anti-CD4 Pacific Blue (eBioscience clone RM4-5), anti-TCR GD R-PE (BD Pharmingen clone GL3), and biotinylated polyclonal anti-IL-23R (BAF1686; R&D Systems). Cells were washed twice with PBS containing 1% bovine serum albumin (fluorescence-activated cell sorting [FACS] buffer). Cells were then stained for 1 h with streptavidin-conjugated Qdot 605 (Q10101MP; Invitrogen). Stained cells were washed once in FACS buffer and subsequently fixed in 4% formalin for 1 h. Cells were then washed once and resuspended in FACS buffer and analyzed using an LSR II flow cytometer (Becton Dickinson, San Jose, CA). The data were analyzed by using FlowJo software (Treestar, Inc., Ashland, OR). Gates were set on singlets and then on live lymphocytes. Subsequent gates were based on Fluorescence-Minus-One and unstained controls.
Statistical analysis.
Fold changes in mRNA levels measured by real-time PCR underwent logarithmic transformation, and percentage values underwent angular transformation prior to analysis by Student t test.
RESULTS
IL-23 is required for induction of Il-17, Il-22, and Reg3g expression but not for Ifn-γ expression in the cecal mucosa during serotype Typhimurium infection.
We have recently shown that Ifn-γ, Il-17, and Il-22 are among the genes whose transcript levels are increased most prominently in the ceca of streptomycin-pretreated mice during serotype Typhimurium infection (9). To study the contribution of IL-23 in triggering cytokine production in the cecal mucosa, we compared the mRNA levels of Ifn-γ, Il-17, and Il-22 in IL-23-deficient mice and their wild-type littermates in response to inoculation with serotype Typhimurium or sterile LB broth (mock infection). IL-23 is a heterodimer composed of p19 and p40. The p40 subunit is shared with IL-12, a heterodimer of p40 and p35. We used IL-23p19−/− mice to determine the role of IL-23 in amplifying inflammatory responses in the intestine. We recently established the time course of cytokine production in the streptomycin-pretreated mouse model, which shows that proinflammatory cytokines are strongly induced in the cecal mucosa by 48 h after serotype Typhimurium infection (9). We therefore chose the 48-h time point for experiments described in the present study.
We compared mRNA levels of cytokines to levels detected in mock-infected wild-type mice (Fig. 1). As expected, Il-23p19 mRNA was not detected in either mock-infected or serotype Typhimurium-infected IL-23p19−/− mice (Fig. 1A). Compared to mock-infected wild-type mice, Il-23p19 mRNA levels were increased ∼10-fold in wild-type mice infected with serotype Typhimurium. Importantly, while Il-17 mRNA levels were markedly increased in serotype Typhimurium-infected wild-type mice, no induction of Il-17 expression was observed in IL-23p19−/− mice (Fig. 1B). These data suggested that the induction of Il-17 expression in the cecal mucosa of mice 48 h after serotype Typhimurium infection was fully dependent on the presence of IL-23. While Il-22 mRNA levels were increased in response to serotype Typhimurium infection in both wild-type and IL-23p19−/− mice, induction was significantly greater (P < 0.001) in wild-type mice (Fig. 1C). These data suggested that IL-23-dependent mechanisms contributed to an induction of Il-22 expression in the cecal mucosa of mice. However, the increase in Il-22 mRNA levels observed in serotype Typhimurium-infected IL-23p19−/− mice suggested that IL-23-independent mechanisms also contributed to IL-22 production in vivo. Serotype Typhimurium infection induced Ifn-γ mRNA to similar levels in both wild-type mice and IL-23p19−/− mice (Fig. 1D), indicating that IFN-γ production is induced by IL-23-independent mechanisms in the cecal mucosa. The lower degree of Il-17 and Il-22 expression in the ceca in IL-23p19−/− mice was not due to differences in bacterial load because similar bacterial numbers were recovered from intestinal contents and the intestinal tissue of serotype Typhimurium-infected wild-type mice and IL-23p19−/− mice (Fig. 1E).
Next, we determined the absolute number of Il-17 transcripts by using quantitative real-time PCR (Fig. 2). In wild-type mice, the absolute number of Il-17 transcripts was markedly increased during serotype Typhimurium infection compared to mock infection. In contrast, mock-infected and serotype Typhimurium IL-23p19−/− mice had almost identical Il-17 transcript levels (Fig. 2A). These data further supported the idea that increases in Il-17 transcript levels were entirely IL-23-dependent. We also determined absolute transcript levels of Reg3g, a gene encoding an antimicrobial, whose production is induced by IL-22 in the cecal mucosa of mice during inflammation (42). During serotype Typhimurium infection, Reg3g was produced at high levels in the cecal mucosa of wild-type mice, averaging 11,000 copies/ng RNA compared to 470 copies/ng in mock-infected mice (Fig. 2B). Induction of Reg3g was largely IL-23 dependent, since IL-23p19−/− mice exhibited markedly reduced transcript levels during serotype Typhimurium infection. In summary, our results supported the idea that IL-23 helps to amplify inflammatory responses in the cecal mucosa by inducing expression of IL-17 and by contributing to a full induction of IL-22 expression during serotype Typhimurium infection.
IL-23 contributes to neutrophil recruitment in the cecal mucosa during serotype Typhimurium infection.
Since IL-17 and IL-22 play a major role in orchestrating inflammatory responses in the intestinal mucosa of mice (25, 42), we investigated the consequences of the IL-17 and IL-22 deficiency in IL-23p19−/− mice (Fig. 3). Since these cytokines orchestrate a mucosal inflammatory response resulting in neutrophil influx at the site of infection, we hypothesized that p19-deficient mice would exhibit reduced expression of neutrophil chemoattractants and reduced neutrophil influx in the cecal mucosa after infection with serotype Typhimurium. We first investigated the expression of the neutrophil chemoattractant KC in the ceca of wild-type mice and IL-23p19−/− mice 48 h after infection with serotype Typhimurium. Compared to mock-infected wild-type mice, KC gene (Kc) mRNA levels were markedly elevated (∼200-fold) in serotype Typhimurium-infected wild-type mice (Fig. 3A). The induction of Kc expression was notably blunted in the ceca of serotype Typhimurium-infected IL-23p19−/−mice compared to serotype Typhimurium-infected wild-type mice (P < 0.001). These data suggested that IL-23 is required for the full induction of neutrophil chemoattractants in the cecal mucosa during serotype Typhimurium infection.
Next, we quantified neutrophil recruitment in the cecal mucosa by determining counts per microscopic field at high magnification. Few neutrophils were detected in the cecal mucosa of mock-infected mice, whereas infection with serotype Typhimurium was accompanied by marked neutrophil recruitment. However, there were significantly (P = 0.02) fewer neutrophils per field in the serotype Typhimurium-infected ceca of IL-23p19−/− mice compared the serotype Typhimurium-infected ceca of wild-type mice (Fig. 3B). These results were in good agreement with the lower Kc expression observed in serotype Typhimurium-infected IL-23p19−/− mice (Fig. 3A). The severity of inflammatory changes was reduced in serotype Typhimurium-infected IL-23p19−/− mice (Fig. 3C) compared to serotype Typhimurium-infected wild-type mice (Fig. 3D). However, compared to mock-infected mice (Fig. 3E and F), serotype Typhimurium infection was associated with marked inflammatory changes (Fig. 3C and D). In summary, our data suggested that IL-23 contributed to the recruitment of neutrophils into the cecal mucosa during serotype Typhimurium infection.
The IL-23 receptor is expressed by a subset of intestinal T cells.
We have recently shown that depletion of T cells results in a marked reduction in the expression levels of Il-17 and Il-22 in the ceca of streptomycin-pretreated mice during serotype Typhimurium infection (9). These data suggest that the IL-17/IL-22 deficiency observed in IL-23p19−/− mice (Fig. 1) could be explained by hypothesizing that IL-23 stimulates a subset of intestinal T cells to produce IL-17 and IL-22. This hypothesis would predict that a subset of intestinal T cells expresses the receptor for IL-23. To test this prediction, we isolated IEL (Fig. 4A) and LPL (Fig. 4B) from the intestines of mice and analyzed expression of surface markers by flow cytometry. Intraepithelial CD3+ cells were divided into cells expressing the γδ T-cell receptor (γδ T cells) and γδ T-cell-receptor-negative cells (αβ T cells) (Fig. 4C). Finally, αβ T-cell subsets were defined based on expression of CD4 and CD8 (Fig. 4D). The same procedure was applied to lamina propria CD3+ cells (Fig. 4E and F).
Approximately 40% of the intraepithelial CD3+ cells expressed the γδ T-cell receptor in naive mice (i.e., CD8+ γδ+ T cells and CD8− γδ+ T cells constituted ca. 40% of intraepithelial CD3+ T cells) (Fig. 5A). In contrast, γδ T cells were only a minor population (ca. 10%) of the lamina propria CD3+ cell population, which was dominated by CD4+ T cells. That is, ca. 50% of CD3+ cells in the lamina propria were CD4+ CD8− γδ− T cells (Fig. 5B). These data were consistent with previous studies on the composition of intestinal intraepithelial and lamina propria CD3+ cell populations in the mouse (8). No significant differences in the relative proportions of T-cell subsets were observed during analysis of tissue collected from naive mice compared to tissue collected from serotype Typhimurium-infected mice (Fig. 5).
We next investigated the expression of the IL-23 receptor by T-cell subsets isolated from the intestinal mucosa (Fig. 6). In naive mice, the overall fraction of CD3+ IEL or CD3+ LPL that expressed the IL-23 receptor was ca. 10%. In the CD3+ IEL population, the majority of cells expressing the IL-23 receptor were CD4− CD8− γδ− cells, regardless of whether tissue had been collected from naive mice or from serotype Typhimurium-infected mice (Fig. 6A). Previous studies suggest that CD4− CD8− γδ− cells in the gut mucosa of mice comprise natural killer T (NKT) cells and CD4− CD8− T cells (15). In the CD3+ LPL population of naive mice, the majority of cells expressing the IL-23 receptor were either CD4− CD8− γδ− cells or CD4+ CD8− γδ− cells (potentially representing TH17 cells) (Fig. 6B).
Importantly, in serotype Typhimurium-infected tissue, we observed a marked increase in the CD3+ LPL population of CD8− γδ+ cells expressing the IL-23 receptor (Fig. 6C). This notable increase in IL-23 receptor-expressing γδ T cells during serotype Typhimurium infection raised the overall fraction of CD3+ LPL that expressed the receptor for IL-23 above 20%. In summary, our results show that a fraction (10 to 20%) of CD3+ lymphocytes in the intestinal mucosa of mice express the receptor for IL-23. Furthermore, 48 h after serotype Typhimurium infection, we observed a marked increase in IL-23 receptor-expressing γδ T cells.
γδ T cells contribute to Il-17 expression in the inflamed cecal mucosa of mice.
Since an increase in IL-23 receptor expressing γδ T cells was the only notable change in mucosal T-cell populations observed during serotype Typhimurium infection (Fig. 6B and C), we investigated whether γδ T cells contribute to cytokine production in the inflamed murine cecum. To this end, we compared the mRNA levels of Ifn-γ and Il-17 in γδ T-cell-receptor-deficient (Trd−/−) mice and wild-type controls (C57BL/6 mice) in response to inoculation with serotype Typhimurium or sterile LB broth (mock infection) (Fig. 7). There was a compensatory increase in Il-23p19 mRNA expression in serotype Typhimurium-infected γδ T-cell-receptor-deficient mice (Fig. 7A). Il-17 mRNA levels induced during serotype Typhimurium infection were significantly lower in γδ T-cell-receptor-deficient mice than in the wild type (P < 0.05) (Fig. 7B). In contrast, serotype Typhimurium infection induced Ifn-γ mRNA (Fig. 7C) and Il-22 mRNA (Fig. 7D) to similar levels in both wild-type mice and γδ T-cell-receptor-deficient mice. Similar bacterial numbers were recovered from the intestinal contents of infected mice (Fig. 7E). These data suggested that γδ T cells contributed to Il-17 expression in the inflamed cecal mucosa. However, unlike IL-23p19−/− mice, γδ T-cell-receptor-deficient mice still exhibited increased Il-17 mRNA levels in response to serotype Typhimurium infection, suggesting that γδ T cells are not the sole source of IL-17 in the inflamed cecum.
The absolute number of Il-17 transcripts in the cecal mucosa was quantified by using real-time PCR (Fig. 8). Mice with γδ T-cell deficiency induced Il-17 expression in response to serovar Typhimurium infection (P = 0.003), but transcript levels were markedly reduced compared to those measured in wild-type mice infected with serotype Typhimurium (P = 0.03) (Fig. 8A). These data further supported the idea that γδ T cells contribute Il-17 expression in the cecal mucosa. Although the absolute transcript levels of Reg3g were reduced (Fig. 8B) and lower numbers of neutrophils were observed in cecal tissue of γδ T-cell-receptor-deficient mice during serotype Typhimurium infection (Fig. 8C), these differences were not statistically significant. Our data suggest that the partial inhibition of Il-17 expression (Fig. 7B and 8A), which was accompanied by normal expression of Il-22 (Fig. 7D), was not sufficient to significantly reduce Reg3g expression or neutrophil recruitment in γδ T-cell-receptor-deficient mice (Fig. 8B and C). Thus, while γδ T cells contribute to Il-17 expression, our data suggest that there must be additional cellular sources to fully account for the increased IL-17 and IL-22 production in the inflamed cecum of the mouse.
DISCUSSION
Acute intestinal inflammation characterized by a massive neutrophil influx is a hallmark of serotype Typhimurium infection (27, 35, 41). However, the precise mechanisms by which this host response is orchestrated in tissue have not been fully worked out. We have recently shown that depletion of CD3+ lymphocytes markedly reduces the ability of mice to recruit neutrophils into the cecal mucosa and to produce KC, IFN-γ, IL-22, and IL-17, which are among the most prominently induced cytokines in serotype Typhimurium-infected tissue (9). These data suggest that T cells are an important component of mechanisms that help to amplify inflammatory responses to serotype Typhimurium infection in the intestinal mucosa. However, little is known about how serotype Typhimurium infection initiates these T- cell-dependent amplification mechanisms. We show here that diverse subsets of T cells in the intestinal mucosa express the receptor for IL-23, a cytokine important for initiating the production of KC, REG3γ, IL-22, and IL-17 in response to serotype Typhimurium infection. IFN-γ production was not affected by IL-23 deficiency, suggesting that the early expression of this important cytokine by T cells (i.e., at 2 days after infection) is triggered through other pathways, perhaps involving IL-12 or IL-18 production. For example, IL-18 has recently been implicated in amplifying inflammatory responses early after serotype Typhimurium infection in the spleens of mice by triggering IFN-γ production in antigen experienced CD4 T cells by an antigen-independent mechanism (32).
Two important questions arise from the results of our study. First, which intestinal T-cell subsets contribute to IL-17 and IL-22 production during serotype Typhimurium infection? In the lung mucosa, γδ T cells have been implicated as an important source of IL-17 during Mycobacterium tuberculosis and M. bovis infection (18, 22, 36). Similarly, injection of Escherichia coli into the peritoneal cavity of naive mice triggers IL-23 production in a TLR4 signaling-dependent manner, and the resulting IL-17 production originates largely from γδ T cells (28). Our results suggest that γδ T cells are also one of the cellular sources of IL-17 in the serotype Typhimurium-infected mouse. However, γδ T-cell-deficient mice were still able to produce Il-17 mRNA, albeit at reduced levels, during serotype Typhimurium infection, suggesting that additional cell types contributed to production of this cytokine in the inflamed cecum. In addition to γδ T cells, the receptor for IL-23 was expressed predominantly by CD3+ CD4− CD8− γδ− cells (NKT cells and/or CD4− CD8− T cells) in the intestinal epithelium and by CD4+ T cells and CD3+ CD4− CD8− γδ− cells in the lamina propria. Each of these cell types has been implicated as a source of IL-17 production in different animal models of inflammation (3, 13, 16, 17, 23, 25). A distinct subset of CD4− NKT cells produces IL-17, contributing to infiltration of neutrophils in a galactosylceramide-induced model of airway inflammation (17). NKT cells constitutively express IL-23 receptor and rapidly produce IL-17 upon stimulation with IL-23 (23). IL-17 mRNA has been shown to be specifically expressed by a subset of murine CD4− CD8− T cells (16). In contrast, IL-17 is mainly derived from CD4+ T cells during M. pneumoniae lung infection (38). Both CD4+ T cells and CD8+ T cells are a source of IL-17 during infection of mice with Helicobacter pylori (3) or K. pneumoniae (13). Finally, depletion of memory CD4+ T cells by simian immunodeficiency virus blunts IL-17 responses elicited early (i.e., 5 h) after serotype Typhimurium infection of the ileal mucosa in rhesus macaques (25), pointing to an innate induction of these T-cell responses. Thus, TH17 cells contribute to IL-17 production in the ileal mucosa of a relevant animal species.
The second question arising from the present study relates to the mechanisms that initiate IL-23 production during serotype Typhimurium infection. Electron microscopic analysis of serotype Typhimurium infection shows that all bacteria detected in the intestinal mucosa have an intracellular location, either within mononuclear phagocytes (macrophages and/or dendritic cells) or within neutrophils (7, 26). Since only a very small fraction of cells in infected tissue contain bacteria, the total capacity for cytokine production by these cells may be limited in scope. However, macrophages and dendritic cells infected with serotype Typhimurium are a potential source of IL-23, and our data suggest that this cytokine helps to amplify a subset of inflammatory responses in tissue. During K. pneumoniae infection, release of IL-23 by dendritic cells in the lung mucosa is triggered through stimulation of TLR4 by lipopolysaccharide (13). Similarly, production of IL-23 by murine bone marrow-derived dendritic cells in response to S. enterica serotype Enteritidis infection is TLR4 dependent (29). However, CD11c+ CX3CR1+ mucosal dendritic cells do not generate MyD88-dependent responses in the ceca of serotype Typhimurium-infected mice (10), suggesting that the signals produced at mucosal sites are not mimicked adequately by bone marrow-derived cells. A recent finding that points to macrophages as possible sources of IL-23 is the observation that the inflamed human intestine contains a unique subset of CD14+ intestinal macrophages, which produces larger amounts of IL-23 than the resident CD14− macrophages (14). Alternatively, serotype Typhimurium may stimulate mucosal dendritic cells or mucosal macrophages to produce IL-23 through MyD88-independent mechanisms, which have been proposed to contribute to cecal inflammation (11). One possible MyD88-independent mechanism leading to IL-23 production by dendritic cells is the activation of the intracellular bacterial sensor NOD2. IL-23 produced by this NOD2-dependent, MyD88-independent mechanism results in IL-17 production in human memory T cells (37). However, additional work is needed to understand the precise mechanisms by which the IL-23/IL-17 axis is triggered in the intestinal mucosa during serotype Typhimurium infection.
FIG. 1.
FIG. 2.
FIG. 3.
FIG. 4.
FIG. 5.
FIG. 6.
FIG. 7.
FIG. 8.
TABLE 1.
| Gene | Primer pair sequence (5′-3′) |
|---|---|
| Gapdh | TGTAGACCATGTAGTTGAGGTCA |
| AGGTCGGTGTGAACGGATTTG | |
| Il-23p19 | TGTGCCTAGGAGTAGCAGTCCTGA |
| TTGGCGGATCCTTTGCAAGCAGAA | |
| Il-17 (relative) | GCTCCAGAAGGCCCTCAGA |
| AGCTTTCCCTCCGCATTGA | |
| Il-22 | GGCCAGCCTTGCAGATAACA |
| GCTGATGTGACAGGAGCTGA | |
| Kc | TGCACCCAAACCGAAGTCAT |
| TTGTCAGAAGCCAGCGTTCAC | |
| Ifn-γ | TCAAGTGGCATAGATGTGGAAGAA |
| TGGCTCTGCAGGATTTTCATG | |
| Reg3g | CCTCAGGACATCTTGTGTC |
| TCCACCTCTGTTGGGTTCA | |
| Il-17 (absolute) | AACCCCCACGTTTCTCAGCAAAC |
| GGACCCCTTTACACCTTCTTTTCATTG |
Acknowledgments
We thank Sebastian Winter, Maria Winter, and Sean-Paul Nuccio for their help with the animal experiments. We also thank Monica Macal and Carol Oxford for their input in designing the flow cytometry panels.
This investigation was conducted in a facility constructed with support from Research Facilities Improvement Program Grant Number C06 RR12088-01 from the National Center for Research Resources, National Institutes of Health. Work in A.J.B.'s laboratory was supported by Public Health Service grants AI040124, AI044170, and AI079173. T.A.P. and R.L.S. are recipients of fellowships from the Conselho Nacional de Desenvolvimento Científico e Tecnológico, Brasília, Brazil. I.G. was supported by Public Health Service grant AI060555.
REFERENCES
1.
Aujla, S. J., Y. R. Chan, M. Zheng, M. Fei, D. J. Askew, D. A. Pociask, T. A. Reinhart, F. McAllister, J. Edeal, K. Gaus, S. Husain, J. L. Kreindler, P. J. Dubin, J. M. Pilewski, M. M. Myerburg, C. A. Mason, Y. Iwakura, and J. K. Kolls. 2008. IL-22 mediates mucosal host defense against gram-negative bacterial pneumonia. Nat. Med.14:275-281.
2.
Barthel, M., S. Hapfelmeier, L. Quintanilla-Martinez, M. Kremer, M. Rohde, M. Hogardt, K. Pfeffer, H. Russmann, and W. D. Hardt. 2003. Pretreatment of mice with streptomycin provides a Salmonella enterica serovar Typhimurium colitis model that allows analysis of both pathogen and host. Infect. Immun.71:2839-2858.
3.
Caruso, R., D. Fina, O. A. Paoluzi, G. Del Vecchio Blanco, C. Stolfi, A. Rizzo, F. Caprioli, M. Sarra, F. Andrei, M. C. Fantini, T. T. MacDonald, F. Pallone, and G. Monteleone. 2008. IL-23-mediated regulation of IL-17 production in Helicobacter pylori-infected gastric mucosa. Eur. J. Immunol.38:470-478.
4.
Davies, M. D., and D. M. Parrott. 1981. Preparation and purification of lymphocytes from the epithelium and lamina propria of murine small intestine. Gut22:481-488.
5.
Dubin, P. J., and J. K. Kolls. 2007. IL-23 mediates inflammatory responses to mucoid Pseudomonas aeruginosa lung infection in mice. Am. J. Physiol. Lung Cell Mol. Physiol.292:L519-L528.
6.
Franchi, L., A. Amer, M. Body-Malapel, T. D. Kanneganti, N. Ozoren, R. Jagirdar, N. Inohara, P. Vandenabeele, J. Bertin, A. Coyle, E. P. Grant, and G. Nunez. 2006. Cytosolic flagellin requires Ipaf for activation of caspase-1 and interleukin 1β in Salmonella-infected macrophages. Nat. Immunol.7:576-582.
7.
Frost, A. J., A. P. Bland, and T. S. Wallis. 1997. The early dynamic response of the calf ileal epithelium to Salmonella typhimurium. Vet. Pathol.34:369-386.
8.
Gautreaux, M. D., E. A. Deitch, and R. D. Berg. 1994. T lymphocytes in host defense against bacterial translocation from the gastrointestinal tract. Infect. Immun.62:2874-2884.
9.
Godinez, I., T. Haneda, M. Raffatellu, M. D. George, T. A. Paixao, H. G. Rolan, R. L. Santos, S. Dandekar, R. M. Tsolis, and A. J. Bäumler. 2008. T cells help to amplify inflammatory responses induced by Salmonella enterica serotype Typhimurium in the intestinal mucosa. Infect. Immun.76:2008-2017.
10.
Hapfelmeier, S., A. J. Muller, B. Stecher, P. Kaiser, M. Barthel, K. Endt, M. Eberhard, R. Robbiani, C. A. Jacobi, M. Heikenwalder, C. Kirschning, S. Jung, T. Stallmach, M. Kremer, and W. D. Hardt. 2008. Microbe sampling by mucosal dendritic cells is a discrete, MyD88-independent step in DeltainvG serovar Typhimurium colitis. J. Exp. Med.205:437-450.
11.
Hapfelmeier, S., B. Stecher, M. Barthel, M. Kremer, A. J. Muller, M. Heikenwalder, T. Stallmach, M. Hensel, K. Pfeffer, S. Akira, and W. D. Hardt. 2005. The Salmonella pathogenicity island (SPI)-2 and SPI-1 type III secretion systems allow Salmonella serovar Typhimurium to trigger colitis via MyD88-dependent and MyD88-independent mechanisms. J. Immunol.174:1675-1685.
12.
Happel, K. I., P. J. Dubin, M. Zheng, N. Ghilardi, C. Lockhart, L. J. Quinton, A. R. Odden, J. E. Shellito, G. J. Bagby, S. Nelson, and J. K. Kolls. 2005. Divergent roles of IL-23 and IL-12 in host defense against Klebsiella pneumoniae. J. Exp. Med.202:761-769.
13.
Happel, K. I., M. Zheng, E. Young, L. J. Quinton, E. Lockhart, A. J. Ramsay, J. E. Shellito, J. R. Schurr, G. J. Bagby, S. Nelson, and J. K. Kolls. 2003. Cutting edge: roles of Toll-like receptor 4 and IL-23 in IL-17 expression in response to Klebsiella pneumoniae infection. J. Immunol.170:4432-4436.
14.
Kamada, N., T. Hisamatsu, S. Okamoto, H. Chinen, T. Kobayashi, T. Sato, A. Sakuraba, M. T. Kitazume, A. Sugita, K. Koganei, K. S. Akagawa, and T. Hibi. 2008. Unique CD14 intestinal macrophages contribute to the pathogenesis of Crohn disease via IL-23/IFN-gamma axis. J. Clin. Investig.118:2269-2280.
15.
Kawachi, I., J. Maldonado, C. Strader, and S. Gilfillan. 2006. MR1-restricted V alpha 19i mucosal-associated invariant T cells are innate T cells in the gut lamina propria that provide a rapid and diverse cytokine response. J. Immunol.176:1618-1627.
16.
Kennedy, J., D. L. Rossi, S. M. Zurawski, F. Vega, Jr., R. A. Kastelein, J. L. Wagner, C. H. Hannum, and A. Zlotnik. 1996. Mouse IL-17: a cytokine preferentially expressed by αβ TCR+ CD4− CD8− T cells. J. Interferon Cytokine Res.16:611-617.
17.
Lee, K. A., M. H. Kang, Y. S. Lee, Y. J. Kim, D. H. Kim, H. J. Ko, and C. Y. Kang. 2008. A distinct subset of natural killer T cells produces IL-17, contributing to airway infiltration of neutrophils but not to airway hyperreactivity. Cell. Immunol.251:50-55.
18.
Lockhart, E., A. M. Green, and J. L. Flynn. 2006. IL-17 production is dominated by γδ T cells rather than CD4 T cells during Mycobacterium tuberculosis infection. J. Immunol.177:4662-4669.
19.
Lycke, N. 1986. A sensitive method for the detection of specific antibody production in different isotypes from single lamina propria plasma cells. Scand. J. Immunol.24:393-403.
20.
Miao, E. A., C. M. Alpuche-Aranda, M. Dors, A. E. Clark, M. W. Bader, S. I. Miller, and A. Aderem. 2006. Cytoplasmic flagellin activates caspase-1 and secretion of interleukin 1β via Ipaf. Nat. Immunol.7:569-575.
21.
Molofsky, A. B., B. G. Byrne, N. N. Whitfield, C. A. Madigan, E. T. Fuse, K. Tateda, and M. S. Swanson. 2006. Cytosolic recognition of flagellin by mouse macrophages restricts Legionella pneumophila infection. J. Exp. Med.203:1093-1104.
22.
Peng, M. Y., Z. H. Wang, C. Y. Yao, L. N. Jiang, Q. L. Jin, J. Wang, and B. Q. Li. 2008. Interleukin 17-producing γδ T cells increased in patients with active pulmonary tuberculosis. Cell Mol. Immunol.5:203-208.
23.
Rachitskaya, A. V., A. M. Hansen, R. Horai, Z. Li, R. Villasmil, D. Luger, R. B. Nussenblatt, and R. R. Caspi. 2008. Cutting edge: NKT cells constitutively express IL-23 receptor and RORgammat and rapidly produce IL-17 upon receptor ligation in an IL-6-independent fashion. J. Immunol.180:5167-5171.
24.
Raffatellu, M., R. L. Santos, D. Chessa, R. P. Wilson, S. E. Winter, C. A. Rossetti, S. D. Lawhon, H. Chu, T. Lau, C. L. Bevins, L. G. Adams, and A. J. Bäumler. 2007. The capsule encoding the viaB locus reduces interleukin-17 expression and mucosal innate responses in the bovine intestinal mucosa during infection with Salmonella enterica serotype Typhi. Infect. Immun.75:4342-4350.
25.
Raffatellu, M., R. L. Santos, D. E. Verhoeven, M. D. George, R. P. Wilson, S. E. Winter, I. Godinez, S. Sankaran, T. A. Paixao, M. A. Gordon, J. K. Kolls, S. Dandekar, and A. J. Bäumler. 2008. Simian immunodeficiency virus-induced mucosal interleukin-17 deficiency promotes Salmonella dissemination from the gut. Nat. Med.14:421-428.
26.
Santos, R. L., S. Zhang, R. M. Tsolis, A. J. Bäumler, and L. G. Adams. 2002. Morphologic and molecular characterization of Salmonella typhimurium infection in neonatal calves. Vet. Pathol.39:200-215.
27.
Santos, R. L., S. Zhang, R. M. Tsolis, R. A. Kingsley, L. G. Adams, and A. J. Bäumler. 2001. Animal models of Salmonella infections: enteritis versus typhoid fever. Microb. Infect.3:1335-1344.
28.
Shibata, K., H. Yamada, H. Hara, K. Kishihara, and Y. Yoshikai. 2007. Resident Vδ1+ δγ T cells control early infiltration of neutrophils after Escherichia coli infection via IL-17 production. J. Immunol.178:4466-4472.
29.
Siegemund, S., N. Schutze, M. A. Freudenberg, M. B. Lutz, R. K. Straubinger, and G. Alber. 2007. Production of IL-12, IL-23, and IL-27p28 by bone marrow-derived conventional dendritic cells rather than macrophages after LPS/TLR4-dependent induction by Salmonella Enteritidis. Immunobiology212:739-750.
30.
Spalding, D. M., W. J. Koopman, J. H. Eldridge, J. R. McGhee, and R. M. Steinman. 1983. Accessory cells in murine Peyer's patch. I. Identification and enrichment of a functional dendritic cell.J. Exp. Med.157:1646-1659.
31.
Srikanth, C. V., and B. J. Cherayil. 2007. Intestinal innate immunity and the pathogenesis of Salmonella enteritis. Immunol. Res.37:61-78.
32.
Srinivasan, A., R. M. Salazar-Gonzalez, M. Jarcho, M. M. Sandau, L. Lefrancois, and S. J. McSorley. 2007. Innate immune activation of CD4 T cells in Salmonella-infected mice is dependent on IL-18. J. Immunol.178:6342-6349.
33.
Stojiljkovic, I., A. J. Bäumler, and F. Heffron. 1995. Ethanolamine utilization in Salmonella typhimurium: nucleotide sequence, protein expression and mutational analysis of the cchA cchB eutE eutJ eutG eutH gene cluster. J. Bacteriol.177:1357-1366.
34.
Sun, Y. H., H. G. Rolan, and R. M. Tsolis. 2007. Injection of flagellin into the host cell cytosol by Salmonella enterica serotype Typhimurium. J. Biol. Chem.282:33897-33901.
35.
Tükel, C., M. Raffatellu, D. Chessa, R. P. Wilson, M. Akcelik, and A. J. Bäumler. 2006. Neutrophil influx during non-typhoidal salmonellosis: who is in the driver's seat? FEMS Immunol. Med. Microbiol.46:320-329.
36.
Umemura, M., A. Yahagi, S. Hamada, M. D. Begum, H. Watanabe, K. Kawakami, T. Suda, K. Sudo, S. Nakae, Y. Iwakura, and G. Matsuzaki. 2007. IL-17-mediated regulation of innate and acquired immune response against pulmonary Mycobacterium bovis bacille Calmette-Guerin infection. J. Immunol.178:3786-3796.
37.
van Beelen, A. J., Z. Zelinkova, E. W. Taanman-Kueter, F. J. Muller, D. W. Hommes, S. A. Zaat, M. L. Kapsenberg, and E. C. de Jong. 2007. Stimulation of the intracellular bacterial sensor NOD2 programs dendritic cells to promote interleukin-17 production in human memory T cells. Immunity27:660-669.
38.
Wu, Q., R. J. Martin, J. G. Rino, R. Breed, R. M. Torres, and H. W. Chu. 2007. IL-23-dependent IL-17 production is essential in neutrophil recruitment and activity in mouse lung defense against respiratory Mycoplasma pneumoniae infection. Microbes Infect.9:78-86.
39.
Ye, P., P. B. Garvey, P. Zhang, S. Nelson, G. Bagby, W. R. Summer, P. Schwarzenberger, J. E. Shellito, and J. K. Kolls. 2001. Interleukin-17 and lung host defense against Klebsiella pneumoniae infection. Am. J. Respir. Cell Mol. Biol.25:335-340.
40.
Ye, P., F. H. Rodriguez, S. Kanaly, K. L. Stocking, J. Schurr, P. Schwarzenberger, P. Oliver, W. Huang, P. Zhang, J. Zhang, J. E. Shellito, G. J. Bagby, S. Nelson, K. Charrier, J. J. Peschon, and J. K. Kolls. 2001. Requirement of interleukin 17 receptor signaling for lung CXC chemokine and granulocyte colony-stimulating factor expression, neutrophil recruitment, and host defense. J. Exp. Med.194:519-527.
41.
Zhang, S., R. A. Kingsley, R. L. Santos, H. Andrews-Polymenis, M. Raffatellu, J. Figueiredo, J. Nunes, R. M. Tsolis, L. G. Adams, and A. J. Bäumler. 2003. Molecular pathogenesis of Salmonella enterica serotype Typhimurium-induced diarrhea. Infect. Immun.71:1-12.
42.
Zheng, Y., P. A. Valdez, D. M. Danilenko, Y. Hu, S. M. Sa, Q. Gong, A. R. Abbas, Z. Modrusan, N. Ghilardi, F. J. de Sauvage, and W. Ouyang. 2008. Interleukin-22 mediates early host defense against attaching and effacing bacterial pathogens. Nat. Med.14:282-289.
Information & Contributors
Information
Published In
Copyright
© 2009 American Society for Microbiology.
History
Received: 26 July 2008
Revision received: 3 September 2008
Accepted: 9 October 2008
Published online: 1 January 2009
Contributors
Metrics & Citations
Metrics
Note:
- For recently published articles, the TOTAL download count will appear as zero until a new month starts.
- There is a 3- to 4-day delay in article usage, so article usage will not appear immediately after publication.
- Citation counts come from the Crossref Cited by service.
Citations
Citation
2009.
Interleukin-23 Orchestrates Mucosal Responses to Salmonella enterica Serotype Typhimurium in the Intestine . Infect Immun
77:.
If you have the appropriate software installed, you can download article citation data to the citation manager of your choice. For an editable text file, please select Medlars format which will download as a .txt file. Simply select your manager software from the list below and click Download.