Free access
Research Article
12 August 2015

Expression of the Oligopeptide Permease Operon of Moraxella catarrhalis Is Regulated by Temperature and Nutrient Availability

ABSTRACT

Moraxella catarrhalis causes otitis media in children and exacerbations of chronic obstructive pulmonary disease in adults. Together, these two conditions contribute to enormous morbidity and mortality worldwide. The oligopeptide permease (opp) ABC transport system is a nutritional virulence factor important for the utilization of peptides. The substrate binding protein OppA, which binds peptides for uptake, is a potential vaccine antigen, but little was known about the regulation of gene expression. The five opp genes oppB, oppC, oppD, oppF, and oppA are in the same open reading frame. Sequence analysis predicted two promoters, one located upstream of oppB and one within the intergenic region between oppF and oppA. We have characterized the gene cluster as an operon with two functional promoters and show that cold shock at 26°C for ≤0.5 h and the presence of a peptide substrate increase gene transcript levels. Additionally, the putative promoter upstream of oppA contributes to the transcription of oppA but is not influenced by the same environmental cues as the promoter upstream of oppB. We conclude that temperature and nutrient availability contribute to the regulation of the Opp system, which is an important nutritional virulence factor in M. catarrhalis.

INTRODUCTION

Moraxella catarrhalis is an increasingly important human-specific pathogen contributing to worldwide morbidity and mortality that has transitioned from an emerging to an established pathogen (13). Otitis media in children is the primary cause of new antibiotic prescriptions and pediatric office visits, with M. catarrhalis accounting for 10% to 20% of acute otitis media episodes (2, 46). Chronic obstructive pulmonary disease (COPD) is the third leading cause of death in the United States, with M. catarrhalis contributing to at least 10% of exacerbations (711). The socioeconomic burden of otitis media and COPD is significant, with an estimated $50 billion dollars annually in health care expenses globally (5, 9, 12). In view of the morbidity and health care cost associated with M. catarrhalis, it is important to understand the mechanisms of pathogenesis in order to guide development of novel approaches to treatment and prevention (2, 13, 14). In previous work, we identified OppA as a promising vaccine antigen and a nutritional virulence factor for M. catarrhalis (15, 16).
We previously characterized the oligopeptide permease (opp) gene cluster as an ABC transport system vital for the utilization of peptide substrates. The gene cluster encodes two permeases, OppB and OppC; two ATPases, OppD and OppF; and a substrate binding protein, OppA (16). We hypothesized that this gene cluster was transcribed as an operon and that environmental factors, temperature and essential nutrients available as peptides, would alter the rate of transcription.
The lower respiratory tract has a normal body temperature of 37°C, while the upper airways, specifically the nasopharynx, where M. catarrhalis first colonizes, ranges from 34°C at room temperature (25°C) down to 26°C after a short time of breathing air near 0°C, a temperature which many of the temperate climates throughout the world experience regularly throughout the winter months (2, 1722). Exposure to cold shock at 26°C has an important impact on virulence factors and transcriptional regulation in M. catarrhalis (2325).
Little is known about the transcriptional regulation of M. catarrhalis, particularly in the complex and changing environment of the human respiratory tract, the ecological niche of M. catarrhalis (13, 26). Based on analysis of the sequence in the opp gene cluster, we hypothesize that a promoter region upstream of oppB is responsible for transcription of the putative operon. There was also a predicted promoter region upstream of oppA. ABC transport systems often have altered transcription of the substrate binding protein compared to the rest of the genes in the system (27, 28). We hypothesize that this secondary promoter may alter the transcription of oppA independently of the other opp genes.
The goal of this study was to characterize the gene expression of the opp cluster and to determine the effect of temperature and nutrient availability on the expression of these genes. A second promoter within this putative operon that may contribute to gene expression and have secondary regulatory mechanisms would also be a novel observation for M. catarrhalis and contribute to the understanding of how this pathogen thrives under the hostile conditions of the human respiratory tract. We show that transcription of the opp operon is upregulated during cold shock at 26°C in as little as 30 min and that the secondary promoter upstream of oppA is influenced by the presence of a peptide substrate.

MATERIALS AND METHODS

Bacterial strains and growth.

Wild-type (WT) M catarrhalis strain O35E, a prototype otitis media strain previously isolated from the middle ear fluid of a child with otitis media in Dallas, TX, was provided by Eric Hansen. Bacteria were grown on brain heart infusion (BHI) agar plates at 35°C with 5% CO2 overnight or in BHI broth at 37°C with shaking at 225 rpm, unless otherwise indicated. Chemically defined medium (CDM) is a minimal nutrient medium containing the essential elements that M. catarrhalis requires to grow (29, 30). For cold shock growth, bacteria were resuspended in BHI broth to an optical density at 600 nm (OD600) of 0.07 from a plate and grown to an OD600 of 0.3 at 37°C with shaking at 225 rpm. Cultures were then shifted to 26°C with the same shaking for 0.5, 1, 2, and 3 h.
For reverse transcriptase PCR (RT-PCR), bacteria were resuspended at an OD600 of 0.07 and grown to an OD600 of 0.9. For quantitative real-time PCR (qRT-PCR) to assess the influence of temperature and nutrient availability on gene expression, bacteria from a culture grown overnight were washed with phosphate-buffered saline (PBS), resuspended to an OD600 of 0.07 in 10 ml of fresh medium (BHI broth, CDM containing free arginine, or CDM with no free arginine and with the peptide VANRP [0.25 mg/ml] as the only source of arginine) (16), and grown at 26°C, 30°C, 34°C, and 37°C to an OD600 of 0.8. For all RNA isolations, bacteria were treated with RNAprotect (Qiagen) and frozen at −80°C until needed.

Construction of mutants.

A mutant was constructed in which a 500-bp region including 200 bp upstream and 300 bp downstream of the oppB start site surrounding the promoter region was knocked out through the use of overlap extension PCR and homologous recombination, as previously described (15, 30). Briefly, the transforming DNA for the promoter mutant was composed of 3 overlapping fragments that included 800 bp upstream of the putative promoter region of oppB, a spectinomycin resistance cassette, and 800 bp downstream of the first 300 bp of oppB, using the oligonucleotide primers listed in Table 1 (15, 16). The mutant (called prm mutant) was verified by PCR and sequencing.
TABLE 1
TABLE 1 Oligonucleotide primer sequences
PrimerGene(s)aExperiment(s)DirectionSequence
oppBRealFoppBRT-PCR and qRT-PCRForwardTTGGGCGTTGGTTGGTTCTG
oppBRealRoppBRT-PCR and qRT-PCRReverseCCTTGTCCTTGTGTAATCACCTGC
oppCRealF3oppCRT-PCR and qRT-PCRForwardGTTGTTGTAGGTGCGCTGTG
oppCRealR3oppCRT-PCR and qRT-PCRReverseGAACCCGAATGGTAAAAGCA
oppDRealFoppDRT-PCR and qRT-PCRForwardGCCATCCTTGTACTCGCCTA
oppDRealRoppDRT-PCR and qRT-PCRReverseGCAAATCACAGATCGCTTCA
oppFRealFoppFRT-PCR and qRT-PCRForwardTTAGTTGGTGAATCAGGCAGTGG
oppFRealRoppFRT-PCR and qRT-PCRReverseGGCAGGGTCTTGGAAAATCATC
oppARealFoppART-PCR and qRT-PCRForwardCCAATAGCACAAAAACGACAGAGC
oppARealRoppART-PCR and qRT-PCRReverseCCATCGGCAGACACAAAAGTTG
gyrBRealFgyrBqRT-PCRForwardTTGCCAAGAAAAAGACCCCG
gyrBRealRgyrBqRT-PCRReverseTAATCAGTGTCCCCACCTCAGC
BCsmF1oppB-CRT-PCRForwardATTTACAAAAAGCACTT
BCsmR1oppB-CRT-PCRReverseCAAATATAGCGCTTAGAA
CDsmF1oppC-DRT-PCRForwardTTGCCAGTTTATATCTCCTA
CDsmR1oppC-DRT-PCRReverseGGTAAGTTTGGTTAAATCT
DFsmF1oppD-FRT-PCRForwardCCTTGTACTCGCCTATT
DFsmR1oppD-FRT-PCRReverseTGTTATTAAGTCCGATA
FAsmF1oppF-ART-PCRForwardAGACCCGATACTTGAGCGTA
FAsmRaoppF-ART-PCRReverseAAAGATTTTGGGTCACCTGA
BsmF1oppBRT-PCRForwardCAGCAGGTTGGGCG
BsmR1oppBRT-PCRReverseCTACCAGCAAAACGGA
AsmF1oppART-PCRForwardATACCGATGGCTCAGATCC
AsmR1oppART-PCRReverseTCACGCCTTGAGCTTCTAA
prmF1.5oppB promoterMutant constructionForwardCCAAATAACGACGAAACCAAAT
prmF1.3oppB promoterMutant constructionReverseTCTAGATTATCTGTCAACCTTAAATGGTCA
prmF2.5oppB promoterMutant constructionForwardAAGGTTGACAGATAATCTAGAATAAAAT
prmF2.3oppB promoterMutant constructionReverseATCATTTTATCTTATAATTTTTTTAATCTGT
prmF3.5oppB promoterMutant constructionForwardAAAATTATAAGATAAAATGATAAAATCTTGC
prmF3.3oppB promoterMutant constructionReverseCAATCTTAATGGGTTCTCGTCCT
a
A hyphenated designation refers to the region spanning the two genes.

Reverse transcriptase PCR.

Thawed bacterial pellets were resuspended in 100 μl of lysozyme (1 mg/ml) and incubated for 10 min at room temperature. RNA was isolated with the addition of RLT buffer (350 μl) (RNeasy Mini-Prep; Qiagen, Valencia, CA), vortexed until clear, applied onto a Qia Shredder column, and centrifuged for 2 min at 14,000 × g. The lysate was mixed with 70% ethanol and applied onto a miniprep column (Qiagen RNeasy Mini-Prep). RNA was further purified according to the RNeasy Mini-Prep instructions, beginning at the RPE buffer wash step. DNA contamination was removed according to instructions provided with the Promega DNase kit (Promega, Madison, WI). Clean RNA was frozen at −80°C until use. Reverse transcriptase PCR was performed with the Qiagen One-Step RT-PCR kit according to the manufacturer's instructions, with 50 ng of RNA per reaction mixture.

Quantitative real-time PCR.

Thawed bacterial pellets were resuspended in 500 ml RNA Wiz (RiboPure RNA purification kit for bacteria; Ambion-Life Technologies, Grand Island, NY). RNA was further isolated by chloroform extraction (0.2× volume; 100 μl) and centrifuged for 5 min at 4°C at 14,000 × g. The top aqueous layer (∼200 μl) was mixed with 0.5× 100% ethanol (100 μl), further purified with RiboPure spin columns according to the manufacturer's instructions, and eluted with 40 μl of elution solution (Ribopure kit) heated to 95°C. Residual DNA contamination was eliminated from 10 μg of RNA with the Promega DNase kit according to the manufacturer's instructions, further purified with a Qiagen RNA minikit according to the manufacturer's instructions, and eluted with 40 μl of H2O. RNA was quantitated with a NanoDrop instrument (Thermo Scientific, Wilmington, DE) and frozen at −80°C in 1-μg aliquots until use. Integrity was assessed by electrophoresis through a 2% agarose denaturing (N-morpholino)propanesulfonic acid (MOPS) gel.
RNA (1 μg) was converted to cDNA by using the iScript cDNA conversion kit (Bio-Rad, Berkeley, CA) according to the manufacturer's instructions (25°C for 5 min, 42°C for 30 min, 85°C for 5 min, and a 4-min hold). Immediately following the PCR, the cDNA template (1 μl; 50 ng) was added to 10 μl Sybr green master mix (Bio-Rad) with primers (1 μl of 2.5 μM stock) and H2O (7 μl) to a final volume of 20 μl according to the manufacturer's instructions for qRT-PCR in a CFX 384 or CFX Connect machine (Bio-Rad). Primers were designed to amplify a 150- to 190-bp product for oppB, oppC, oppD, oppF, oppA, and the gyrase B housekeeping gene (gyrB) (31). The resulting quantification cycle (Cq) values were converted to SQ values based on a standard curve. Transcript quantities were normalized to gyrB levels and displayed as fold changes in relation to gyrB expression. Statistical significance was determined by performing a t test, with a P value of <0.5 being considered significant.

Assessment of bacterial growth.

Growth curves were performed by using the BioscreenC automated growth curve analysis system (Oy Growth Curves AB Ltd., Helsinki, Finland), as previously described (16). Briefly, growth curves were performed with a 200-μl inoculum of WT and prm mutant cultures grown overnight, washed in PBS, and diluted 1:100 in CDM with free arginine or CDM with no free arginine supplemented with the peptide triornithine (VWR, Radnor, PA) at a final concentration of 0.25 mg/ml. The experiment was performed with 5 replicate wells, with OD600 measurements being taken at 1-h intervals at 37°C with constant shaking (machine settings, high speed and high amplitude).

RESULTS

The opp gene cluster is transcribed as an operon.

Five oligopeptide permease (opp) genes are present in the same open reading frame and have no other homologues in the M. catarrhalis genome (Fig. 1) (15, 32). Reverse transcriptase PCR was used to determine if these genes were being actively transcribed as an operon during growth in rich laboratory medium (BHI broth) at 37°C. The mRNA transcript regions between each gene were amplified from total RNA with primers designed to amplify an ∼150-bp product spanning the entire intergenic region (Fig. 2). These primers amplified a product from the transcript including both the region upstream of the stop codon of the first gene and the region downstream of the start codon of the second gene (Table 1). There is no intergenic space between the 3′ end of oppB and the start of oppC, 73 bp between oppC and oppD, 58 bp between oppD and oppF, and 204 bp between oppF and oppA (Fig. 1). Given the much larger intergenic region between oppF and oppA, we designed a second primer set with no overlap with the first set to confirm the result. Both sets of primers amplified a PCR product from total RNA, indicating that the five opp genes are transcribed as an operon.
FIG 1
FIG 1 Diagram of the opp operon in the wild-type (WT) strain and deleted segments in the prm mutant (not to scale). Numbers denote base pairs, and small arrows indicate promoter regions. Black arrows denote open reading frames, and gray arrows denote the drug resistance cassette.
FIG 2
FIG 2 Results of reverse transcriptase PCR showing that the opp genes are transcribed as an operon. RNA was isolated from wild-type O35E cultures grown to late log phase in brain heart infusion medium. Primers were designed to span the end of one gene through the beginning of another (intergenic region) or the middle of each gene, as indicated. Lanes 1, 4, 7, 10, 13, and 16 are RNA with reverse transcriptase and polymerase. Lanes 2, 5, 8, 11, 14, and 17 are RNA with no reverse transcriptase and only polymerase. Lanes 3, 6, 9, 12, 15, and 18 are DNA with polymerase. Lane 19 has no template with reverse transcriptase and polymerase.

Regulation of oppA is influenced by a second promoter.

Previous studies of ABC transport systems in bacteria have observed that the substrate binding protein genes are sometimes expressed at a higher level than the other genes in the operon (27). We identified a putative promoter region, using SoftBerry BPROM bacterial promoter prediction software (http://linux1.softberry.com/berry.phtml?topic=bprom&group=programs&subgroup=gfindb), in the 204-bp intergenic region between oppF and oppA. We hypothesized that this secondary promoter influences the transcription of oppA in comparison to the rest of the opp genes in the operon. To address this, we created a promoter mutant (prm) in which ∼500 bp of sequence surrounding the promoter region upstream of oppB, including ∼300 bp of the oppB gene, were replaced with a spectinomycin drug resistance gene with transcription oriented in the opposite direction of the operon (Fig. 1). This mutant was confirmed by PCR and sequencing.
Transcript levels of the opp genes in the WT and prm mutant grown in BHI broth to late log phase at 37°C were assessed by qRT-PCR and normalized to the level of the housekeeping gene gyrB, which had the same amount of transcript present under all conditions tested, including different temperatures (not shown). There was ∼1.5- to 2-fold more expression of the first four opp genes, oppB, -C, -D, and -F, with no significant difference between any of them, but there was significantly more oppA transcript than oppD and oppF transcripts in the WT. The prm mutant had no oppB, -C, and -D transcripts, while there were low but detectable levels of oppF transcript (Fig. 3). Levels of oppA transcript were significantly higher (P < 0.0014) than those of all the other opp genes in the prm mutant. The experiment was also conducted at 26°C, with the same results (not shown). An immunoblot assay was performed to assess the presence of the OppF and OppA proteins in the WT compared to the prm mutant by using polyclonal rabbit antisera previously produced against recombinantly expressed proteins (15, 16). OppA is present in the prm mutant but at a visibly lower level than that in the WT, while OppF was undetectable (Fig. 4). Collectively, these data indicate that all opp genes are transcribed as an operon and that oppA has a separate promoter that influences transcription.
FIG 3
FIG 3 Results of quantitative real-time PCR to determine the levels of the oppB, oppC, oppD, oppF, and oppA transcripts in the prm mutant compared to wild-type levels. RNA was isolated from bacterial cultures grown from an OD600 0.07 to an OD600 of 0.8 at 37°C. Transcript quantity was normalized to the level of the housekeeping gene gyrB. All results are the averages of results from 3 separate experiments performed in triplicate. Error bars represent standard errors of the means from 3 biological replicates. See the text for statistical analysis.
FIG 4
FIG 4 Characterization of mutants. (A) Immunoblot assay of wild-type and prm whole bacterial lysates probed with OppF antiserum (1:10,000). OppF is ∼36 kDa, as indicated by the arrow. (B) Immunoblot assay of wild-type and prm whole bacterial lysates probed with OppA antiserum (1:1,000,000). OppA is ∼75 kDa, as indicated by the arrow. A secondary anti-rabbit horseradish peroxidase conjugate was used at a 1:2,000 dilution for detection for both immunoblots. (C) Coomassie blue-stained SDS-PAGE gel of the 2 whole bacterial lysates showing equal protein loading. Molecular mass markers (in kilodaltons) are indicated on the left.
We hypothesized that without active transcription and, therefore, translation, the prm mutant would be unable to incorporate the peptide substrate triornithine (16). Arginine is essential for M. catarrhalis growth but can be replaced with ornithine, which is a downstream by-product of arginine metabolism (29, 33). Triornithine is toxic to Escherichia coli and has been used to screen for peptide uptake mutants (34). This molecule is taken up by the Opp system but is not toxic to M. catarrhalis and can be metabolized in place of arginine. A growth curve was performed to compare WT growth to the growth of the prm mutant in minimal medium where the only source of arginine was the triornithine peptide. The prm mutant did not grow, while the WT grew normally (Fig. 5). Both strains grew similarly when free arginine was present in the minimal medium, as expected. We conclude that the proteins encoded by the oppB, -C, -D, and -F genes are required for the utilization of a peptide substrate by M. catarrhalis and that the promoter upstream of oppB is responsible for their transcription.
FIG 5
FIG 5 Growth curves of wild-type strain O35E and the prm knockout mutant in chemically defined medium broth supplemented with arginine (top) or triornithine (bottom). The x axis is time in hours, and the y axis is the optical density at 600 nm. Each point is the average of data from 5 wells.

Temperature alters opp gene transcript levels.

The temperature of the human nasopharynx is variable, with measurements ranging from 37°C to 26°C (2, 1722). Temperature has an important impact on virulence factors and transcriptional regulation in M. catarrhalis (2325). When cultures were grown at 26°C, the transcript levels of all of the opp genes were significantly elevated compared to transcript levels at 37°C (Fig. 6). The levels of oppB, -C, -D, and -F were all increased ∼2-fold, while the transcript levels of oppA were increased ∼3-fold at 26°C compared to the transcript levels at 37°C. This observation supports our conclusion that the opp genes are transcribed as an operon and that oppA is influenced by a second promoter.
FIG 6
FIG 6 Temperature alters opp gene transcription during growth. Quantitative real-time PCR was performed on 50 ng of RNA per sample isolated from WT bacterial cultures grown to an OD600 of 0.8 at 37°C in BHI medium. Normalized transcript levels were statistically higher (*), as determined by a t test (P < 0.05), at 26°C than at 37°C for all the opp genes. Results are the averages of data from 3 experiments performed in triplicate, with standard deviations denoted with error bars.

Time course of cold shock impact on opp gene transcript levels.

Our previous experiments showed that growth at 26°C caused a significant increase in the transcript levels of all the opp genes. We were interested in determining the time course of cold shock causing an increase in transcription. Bacteria were grown to an OD600 of 0.3 and then subjected to cold shock at 26°C for 0.5, 1, 2, and 3 h, followed by RNA isolation and qRT-PCR. We examined the transcript levels of oppA and chose oppB to represent oppC, -D, and -F, since we have seen that these genes are expressed from the same promoter and at similar levels (Fig. 3 and 6). Transcript levels of oppB were significantly increased after cold shock at 26°C for 30 min compared to the transcript levels at 37°C. In contrast, oppA transcript levels did not increase until 1 h of cold shock (Fig. 7). These data suggest that cold shock for 30 min will increase transcription through the promoter upstream of oppB.
FIG 7
FIG 7 Impact of timed cold shock exposure on oppB and oppA gene transcription. Quantitative real-time PCR was performed on 50 ng of RNA per sample isolated from WT bacterial cultures grown to an OD600 of 0.3 at 37°C and subjected to growth at 26°C for set time intervals of 0.5, 1, 2, and 3 h. Transcript levels were normalized to the level of the housekeeping gene gyrB. Transcript levels of oppB and oppA at 37°C were compared with those at 26°C. Results are the averages of data from 3 experiments performed in triplicate, with standard deviations denoted with error bars, and statistical significance (*) was determined with a t test (P < 0.05).
We next questioned if the promoter upstream of oppA was influenced by temperature in a manner similar to that of the promoter upstream of oppB. Based on previous experiments, we chose to examine the transcript level of oppA in the prm mutant after cold shock for 0.5 and 1 h. We also assayed transcript levels at 3 h to assess delayed responses. In contrast to the WT, the amount of oppA transcript did not increase with cold shock at 26°C compared to 37°C in the prm mutant, indicating that the promoter upstream of oppA is not influenced by temperature (Fig. 8).
FIG 8
FIG 8 Quantitative real-time PCR results showing the normalized oppA transcript levels in the prm mutant during timed cold shock intervals. RNA was isolated from bacterial cultures grown to an OD600 of 0.3 at 37°C, followed by growth for timed intervals of 0.5, 1, and 3 h at 37°C or cold shock at 26°C. Normalized results are the averages of results from 2 separate experiments performed in triplicate, with standard deviations denoted with error bars, and statistical significance (*) was determined with a t test (P < 0.05).

Nutrient availability alters gene transcription.

Previous work characterized this operon as being vital for the utilization of peptide substrates between 5 and 10 amino acids long (16).We hypothesized that the presence of peptide substrates would increase the transcription of this operon under nutrient-limiting conditions with only peptide substrates as the source of arginine, which is an essential amino acid for M. catarrhalis and a limiting nutrient in the respiratory tract (16, 3538). Total RNA was isolated from WT bacteria grown from an OD600 of 0.07 to an OD600 of 0.8 at 37°C and 26°C in chemically defined medium containing free arginine (R) and defined medium with no free arginine supplemented with the peptide VANRP. The opp gene transcript quantities were evaluated by qRT-PCR. The presence of the peptide substrate as the sole source of arginine significantly increased the transcription levels of oppB, -C, -D, and -F by ∼2.5-fold compared to the transcript levels in medium containing free arginine at 26°C (Fig. 9). The level of oppA transcript increased ∼15-fold more with the peptide substrate as the sole source of arginine at 26°C than at 37°C. These data indicate that when peptides are the only source of arginine, transcription of the opp operon at 26°C is increased compared to when free arginine is available. Also, peptide substrate availability plays an important role in the regulation of the promoter upstream of oppA.
FIG 9
FIG 9 Nutrient availability impacts opp gene transcription. Quantitative real-time PCR was performed on 50 ng of RNA per sample isolated from bacterial cultures grown to an OD600 of 0.8 at 37°C and 26°C in chemically defined medium supplemented with free arginine (R) or chemically defined medium supplemented with a peptide as the only source of arginine (VANRP). Normalized transcript levels were statistically higher (*), as determined by a t test (P < 0.05), in medium supplemented with the peptide at 26°C but not at 37°C for all the opp genes. Results are the averages of data from 3 experiments performed in triplicate, with standard deviations denoted with error bars.

DISCUSSION

The M. catarrhalis Opp ABC transport system is a nutritional virulence factor, and OppA is a promising vaccine antigen candidate (15, 16). The regulation of this system in response to changing conditions such as cold shock and limiting essential nutrients has not been investigated. An understanding of such systems is necessary for the development of new antimicrobial agents for which ABC transporters are increasingly important targets (15, 27, 3943). Furthermore, as OppA was developed as a vaccine antigen, it is important to characterize the regulation of its expression. This work advances our understanding of how M. catarrhalis increases the transcription of an important virulence factor, the Opp ABC transport system, based on environmental cues of both temperature and nutrient availability.
While a number of operons have been identified in M. catarrhalis, little is known about how environmental factors influence transcriptional regulation (13, 27, 4450). In the present study, we show that the entire opp gene cluster is transcribed as a single transcript and is thus an operon (Fig. 2). We were somewhat surprised by this result because the region between oppF and oppA is 204 bp, compared to gaps of ∼60 bp between the other opp genes, and because of the presence of a second predicted promoter immediately upstream of oppA.
The prm mutant lacking the operon promoter upstream of oppB was unable to utilize a peptide substrate, indicating the lack of a functional Opp system (Fig. 5) (16). The prm mutant had essentially absent transcription of oppB, -C, and -D but a very low level of oppF, which did not translate to any detectable protein (Fig. 3 and 4). We speculate that the recruitment of transcription machinery to the oppA promoter and to the spectinomycin drug cassette promoter further upstream predisposes this region of sequence to a low level of background transcription, allowing a detectable amount of oppF transcript. On the other hand, oppA was transcribed at levels 5-fold higher than those of the upstream opp genes in spite of the absence of the operon promoter upstream of oppB, indicating that the predicted promoter upstream of oppA is active. The reduced level of oppA transcript compared to that of the WT correlated with the visibly reduced OppA protein levels as well.
The results indicating that the promoter upstream of oppA actively contributes to transcription are consistent with the observation that the substrate binding proteins of ABC transporters of other bacterial species have both secondary transcriptional regulation and increased protein stoichiometry compared to the other genes and proteins in the system (27, 28). We conclude that the promoter upstream of oppB is responsible for transcription of the opp operon and that the promoter upstream of oppA contributes to the additional regulation of oppA expression.
The temperature throughout the respiratory tract ranges from 37°C to 26°C, and changes in temperature and environmental factors alter the expression of homologous Opp systems in other pathogenic bacterial species (2, 1722, 40, 43, 47, 51, 52). Exacerbations of COPD related to the acquisition of M. catarrhalis and otitis media increase during the cooler winter months of the year (8, 5355). The temperature of the nasopharynx, where M. catarrhalis first colonizes, is 34°C and decreases to 26°C upon exposure to colder temperatures in winter months in temperate climates (1723, 56). Cold shock increases the expression of the outer membrane protein UspA1, a known virulence factor, which is important for M. catarrhalis binding to host cells as well as immune evasion (23, 25). Thus, time spent outdoors breathing cooler air alters the temperature of the respiratory tract and could have important effects on bacterial homeostasis and regulation of the Opp system.
Similar to these other virulence factors, transcription levels of all opp genes were significantly higher at 26°C, and transcription of the operon in M. catarrhalis was increased after only 30 min of cold shock exposure (Fig. 6 and 7). We speculate that given the relatively small amount of time required to increase transcription of this operon, the Opp system plays an important role in fitness in vivo in the cooler temperatures of the nasopharynx, the natural ecological niche of M. catarrhalis. Interestingly, oppA transcript levels did not increase upon cold shock in the prm mutant. We conclude that exposure to cooler temperature results in increased transcription of the genes in the opp operon by increasing transcription of the promoter upstream of oppB, while the promoter upstream of oppA is not influenced by temperature.
The middle ear space and the lower airways where M. catarrhalis causes disease are characterized by limited nutrient availability. For example, much of the free arginine in the human respiratory tract is methylated or sequestered inside cells, particularly under conditions that promote lung inflammation, such as that of a COPD exacerbation (36, 38, 5760). Thus, the ability of M. catarrhalis to utilize peptide substrates is essential for survival in vivo (16). Transcript levels of all the opp genes were increased in medium containing a peptide as the only source of essential arginine compared to those in medium with free arginine present at 26°C (Fig. 9). Thus, the opp operon is expressed at higher levels in media that require the uptake of oligopeptides by M. catarrhalis. The increase in the oppA transcript level is dramatically higher than the increase seen for the other opp genes, indicating that the promoter upstream of oppA is sensitive to the amount of available peptide substrate in the surrounding medium. Similar increases in the levels of homologous OppA proteins with the increased availability of substrates in the surrounding environment support these conclusions (40, 60).
M. catarrhalis colonizes a unique niche in the nasopharynx and has adapted to thrive in this environment of changing temperature and nutrient availability. In this study, we have characterized the opp gene cluster as an operon and shown that cold shock influences the regulation of this system, which is important for nutrient acquisition. We have made the novel observation of a second promoter within the opp operon and shown that it is not regulated by temperature. Additionally, the increased transcription of oppA under physiologically relevant conditions further supports the case for OppA as a vaccine antigen target for M. catarrhalis. This work advances the field in characterizing the mechanisms of transcriptional control in M. catarrhalis. A further understanding of how M. catarrhalis regulates gene transcription could provide a greater understanding of virulence mechanisms and provide new targets for antimicrobial development for this increasingly relevant yet understudied human pathogen.

ACKNOWLEDGMENTS

This work was supported by NIH grants R01DC01220 (T.F.M.) and 5T32AI007614-12.
Visualization was aided by Daniel's XL Toolbox add-in for Excel, version XYZ, by Daniel Kraus, Würzburg, Germany.

REFERENCES

1.
Verduin CM, Hol C, Fleer A, van Dijk H, van Belkum A. 2002. Moraxella catarrhalis: from emerging to established pathogen. Clin Microbiol Rev 15:125–144.
2.
Murphy TF, Parameswaran GI. 2009. Moraxella catarrhalis, a human respiratory tract pathogen. Clin Infect Dis 49:124–131.
3.
Aebi C. 2011. Moraxella catarrhalis—pathogen or commensal? Adv Exp Med Biol 697:107–116.
4.
Bernhard S, Spaniol V, Aebi C. 2012. Molecular pathogenesis of infections caused by Moraxella catarrhalis in children. Swiss Med Wkly 142:w13694.
5.
Vergison A, Dagan R, Arguedas A, Bonhoeffer J, Cohen R, Dhooge I, Hoberman A, Liese J, Marchisio P, Palmu AA, Ray GT, Sanders EA, Simoes EA, Uhari M, van Eldere J, Pelton SI. 2010. Otitis media and its consequences: beyond the earache. Lancet Infect Dis 10:195–203.
6.
Plasschaert AI, Rovers MM, Schilder AG, Verheij TJ, Hak E. 2006. Trends in doctor consultations, antibiotic prescription, and specialist referrals for otitis media in children: 1995-2003. Pediatrics 117:1879–1886.
7.
Sethi S, Murphy TF. 2008. Infection in the pathogenesis and course of chronic obstructive pulmonary disease. N Engl J Med 359:2355–2365.
8.
Murphy TF, Brauer AL, Grant BJ, Sethi S. 2005. Moraxella catarrhalis in chronic obstructive pulmonary disease: burden of disease and immune response. Am J Respir Crit Care Med 172:195–199.
9.
Mannino DM, Buist AS. 2007. Global burden of COPD: risk factors, prevalence, and future trends. Lancet 370:765–773.
10.
Kochanek KD, Xu J, Murphy SL, Minino AM, Kung HC. 2011. Deaths: final data for 2009. Natl Vital Stat Rep 60:1–116.
11.
Murphy SL, Xu J, Kochanek KD. 2013. Deaths: final data for 2010. Natl Vital Stat Rep 61:1–118.
12.
Klein JO. 2000. The burden of otitis media. Vaccine 19:S2–S8.
13.
Wang W, Reitzer L, Rasko DA, Pearson MM, Blick RJ, Laurence C, Hansen EJ. 2007. Metabolic analysis of Moraxella catarrhalis and the effect of selected in vitro growth conditions on global gene expression. Infect Immun 75:4959–4971.
14.
de Vries SP, Bootsma HJ, Hays JP, Hermans PW. 2009. Molecular aspects of Moraxella catarrhalis pathogenesis. Microbiol Mol Biol Rev 73:389–406.
15.
Yang M, Johnson A, Murphy TF. 2011. Characterization and evaluation of the Moraxella catarrhalis oligopeptide permease A as a mucosal vaccine antigen. Infect Immun 79:846–857.
16.
Jones MM, Johnson A, Koszelak-Rosenblum M, Kirkham C, Brauer AL, Malkowski MG, Murphy TF. 2014. Role of the oligopeptide permease ABC transporter of Moraxella catarrhalis in nutrient acquisition and persistence in the respiratory tract. Infect Immun 82:4758–4766.
17.
Rouadi P, Baroody FM, Abbott D, Naureckas E, Solway J, Naclerio RM. 1999. A technique to measure the ability of the human nose to warm and humidify air. J Appl Physiol 87:400–406.
18.
Van Hare GF, Shurin PA. 1987. The increasing importance of Branhamella catarrhalis in respiratory infections. Pediatr Infect Dis J 6:92–94.
19.
Mbaki N, Rikitomi N, Nagatake T, Matsumoto K. 1987. Correlation between Branhamella catarrhalis adherence to oropharyngeal cells and seasonal incidence of lower respiratory tract infections. Tohoku J Exp Med 153:111–121.
20.
Mourtzoukou EG, Falagas ME. 2007. Exposure to cold and respiratory tract infections. Int J Tuberc Lung Dis 11:938–943.
21.
Keck T, Leiacker R, Riechelmann H, Rettinger G. 2000. Temperature profile in the nasal cavity. Laryngoscope 110:651–654.
22.
Sarubbi FA, Myers JW, Williams JJ, Shell CG. 1990. Respiratory infections caused by Branhamella catarrhalis. Selected epidemiologic features. Am J Med 88:9S–14S.
23.
Spaniol V, Troller R, Schaller A, Aebi C. 2011. Physiologic cold shock of Moraxella catarrhalis affects the expression of genes involved in the iron acquisition, serum resistance and immune evasion. BMC Microbiol 11:182.
24.
Jetter M, Spaniol V, Troller R, Aebi C. 2010. Down-regulation of porin M35 in Moraxella catarrhalis by aminopenicillins and environmental factors and its potential contribution to the mechanism of resistance to aminopenicillins. J Antimicrob Chemother 65:2089–2096.
25.
Heiniger N, Troller R, Meier PS, Aebi C. 2005. Cold shock response of the UspA1 outer membrane adhesin of Moraxella catarrhalis. Infect Immun 73:8247–8255.
26.
Mendoza-Vargas A, Olvera L, Olvera M, Grande R, Vega-Alvarado L, Taboada B, Jimenez-Jacinto V, Salgado H, Juárez K, Contreras-Moreira B, Huerta AM, Collado-Vides J, Morett E. 2009. Genome-wide identification of transcription start sites, promoters and transcription factor binding sites in E. coli. PLoS One 4:e7526.
27.
Monnet V. 2003. Bacterial oligopeptide-binding proteins. Cell Mol Life Sci 60:2100–2114.
28.
Henrich B, Hopfe M, Kitzerow A, Hadding U. 1999. The adherence-associated lipoprotein P100, encoded by an opp operon structure, functions as the oligopeptide-binding domain OppA of a putative oligopeptide transport system in Mycoplasma hominis. J Bacteriol 181:4873–4878.
29.
Juni E, Heym GA, Avery M. 1986. Defined medium for Moraxella (Branhamella) catarrhalis. Appl Environ Microbiol 52:546–551.
30.
Murphy TF, Brauer AL, Kirkham C, Johnson A, Koszelak-Rosenblum M, Malkowski MG. 2013. Role of the zinc uptake ABC transporter of Moraxella catarrhalis in persistence in the respiratory tract. Infect Immun 81:3406–3413.
31.
Hoopman TC, Liu W, Joslin SN, Pybus C, Brautigam CA, Hansen EJ. 2011. Identification of gene products involved in the oxidative stress response of Moraxella catarrhalis. Infect Immun 79:745–755.
32.
de Vries SP, van Hijum SA, Schueler W, Riesbeck K, Hays JP, Hermans PW, Bootsma HJ. 2010. Genome analysis of Moraxella catarrhalis strain RH4, a human respiratory tract pathogen. J Bacteriol 192:3574–3583.
33.
Morris SM. 2007. Arginine metabolism: boundaries of our knowledge. J Nutr 137:1602S–1609S.
34.
Barak Z, Gilvarg C. 1974. Triornithine-resistant strains of Escherichia coli. Isolation, definition, and genetic studies. J Biol Chem 249:143–148.
35.
Zakrzewicz D, Eickelberg O. 2009. From arginine methylation to ADMA: a novel mechanism with therapeutic potential in chronic lung diseases. BMC Pulm Med 9:5.
36.
North ML, Scott JA. 2011. L-Arginine metabolism in the lung: reciprocal regulation of the NOS and arginase pathways. Open Nitric Oxide J 3:48–54.
37.
King NE, Rothenberg ME, Zimmermann N. 2004. Arginine in asthma and lung inflammation. J Nutr 134:2830S–2836S.
38.
Dweik RA. 2007. The lung in the balance: arginine, methylated arginines, and nitric oxide. Am J Physiol Lung Cell Mol Physiol 292:L15–L17.
39.
Garmory HS, Titball RW. 2004. ATP-binding cassette transporters are targets for the development of antibacterial vaccines and therapies. Infect Immun 72:6757–6763.
40.
Acosta MB, Ferreira RC, Padilla G, Ferreira LC, Costa SO. 2000. Altered expression of oligopeptide-binding protein (OppA) and aminoglycoside resistance in laboratory and clinical Escherichia coli strains. J Med Microbiol 49:409–413.
41.
Tanabe M, Atkins HS, Harland DN, Elvin SJ, Stagg AJ, Mirza O, Titball RW, Byrne B, Brown KA. 2006. The ABC transporter protein OppA provides protection against experimental Yersinia pestis infection. Infect Immun 74:3687–3691.
42.
Higgins CF. 1992. ABC transporters: from microorganisms to man. Annu Rev Cell Biol 8:67–113.
43.
Borezee E, Pellegrini E, Berche P. 2000. OppA of Listeria monocytogenes, an oligopeptide-binding protein required for bacterial growth at low temperature and involved in intracellular survival. Infect Immun 68:7069–7077.
44.
Moutran A, Quaggio RB, Balan A, Ferreira LCS, Ferreira RCC. 2004. The oligopeptide permease (Opp) of the plant pathogen Xanthomonas axonopodis. Curr Microbiol 48:354–359.
45.
Nepomuceno RS, Tavares MB, Lemos JA, Griswold AR, Ribeiro JL, Balan A, Guimaraes KS, Cai S, Burne RA, Ferreira LC, Ferreira RC. 2007. The oligopeptide (opp) gene cluster of Streptococcus mutans: identification, prevalence, and characterization. Oral Microbiol Immunol 22:277–284.
46.
Podbielski A, Pohl B, Woischnik M, Körner C, Schmidt K-H, Rozdzinski E, Leonard BAB. 1996. Molecular characterization of group A streptococcal (GAS) oligopeptide permease (Opp) and its effect on cysteine protease production. Mol Microbiol 21:1087–1099.
47.
Wang XG, Lin B, Kidder JM, Telford S, Hu LT. 2002. Effects of environmental changes on expression of the oligopeptide permease (opp) genes of Borrelia burgdorferi. J Bacteriol 184:6198–6206.
48.
Bonnah RA, Wong H, Loosmore SM, Schryvers AB. 1999. Characterization of Moraxella (Branhamella) catarrhalis lbpB, lbpA, and lactoferrin receptor orf3 isogenic mutants. Infect Immun 67:1517–1520.
49.
Luke NR, Howlett AJ, Shao J, Campagnari AA. 2004. Expression of type IV pili by Moraxella catarrhalis is essential for natural competence and is affected by iron limitation. Infect Immun 72:6262–6270.
50.
Luke NR, Allen S, Gibson BW, Campagnari AA. 2003. Identification of a 3-deoxy-d-manno-octulosonic acid biosynthetic operon in Moraxella catarrhalis and analysis of a KdsA-deficient isogenic mutant. Infect Immun 71:6426–6434.
51.
Bono JL, Tilly K, Stevenson B, Hogan D, Rosa P. 1998. Oligopeptide permease in Borrelia burgdorferi: putative peptide-binding components encoded by both chromosomal and plasmid loci. Microbiology 144:1033–1044.
52.
Wang CH, Lin CY, Luo YH, Tsai PJ, Lin YS, Lin MT, Chuang WJ, Liu CC, Wu JJ. 2005. Effects of oligopeptide permease in group A streptococcal infection. Infect Immun 73:2881–2890.
53.
Donaldson GC, Goldring JJ, Wedzicha JA. 2012. Influence of season on exacerbation characteristics in patients with COPD. Chest 141:94–100.
54.
Castagno LA, Lavinsky L. 2002. Otitis media in children: seasonal changes and socioeconomic level. Int J Pediatr Otorhinolaryngol 62:129–134.
55.
Rovers MM, Straatman H, Zielhuis GA, Ingels K, Van Der Wilt GJ. 2000. Seasonal variation in the prevalence of persistent otitis media with effusion in one-year-old infants. Paediatr Perinat Epidemiol 14:268–274.
56.
Eccles R. 2002. An explanation for the seasonality of acute upper respiratory tract viral infections. Acta Otolaryngol 122:183–191.
57.
Taylor JD. 2010. COPD and the response of the lung to tobacco smoke exposure. Pulm Pharmacol Ther 23:376–383.
58.
Taylor JD, Wreggett KA, Olsson H, Sjöbring U. 2008. Latest therapies targeting exacerbations in COPD. Drug Discov Today 5:101–110.
59.
Vallance P, Leiper J. 2002. Blocking NO synthesis: how, where and why? Nat Rev Drug Discov 1:939–950.
60.
Ricciardolo FL, Sterk PJ, Gaston B, Folkerts G. 2004. Nitric oxide in health and disease of the respiratory system. Physiol Rev 84:731–765.

Information & Contributors

Information

Published In

cover image Infection and Immunity
Infection and Immunity
Volume 83Number 9September 2015
Pages: 3497 - 3505
Editor: B. A. McCormick
PubMed: 26099587

History

Received: 7 May 2015
Returned for modification: 5 June 2015
Accepted: 15 June 2015
Published online: 12 August 2015

Permissions

Request permissions for this article.

Contributors

Authors

Megan M. Jones
Department of Microbiology and Immunology, University at Buffalo, The State University of New York, Buffalo, New York, USA
Clinical and Translational Research Center, University at Buffalo, The State University of New York, Buffalo, New York, USA
Timothy F. Murphy
Department of Microbiology and Immunology, University at Buffalo, The State University of New York, Buffalo, New York, USA
Clinical and Translational Research Center, University at Buffalo, The State University of New York, Buffalo, New York, USA
Division of Infectious Diseases, Department of Medicine, University at Buffalo, The State University of New York, Buffalo, New York, USA

Editor

B. A. McCormick
Editor

Notes

Address correspondence to Timothy F. Murphy, [email protected].

Metrics & Citations

Metrics

Note: There is a 3- to 4-day delay in article usage, so article usage will not appear immediately after publication.

Citation counts come from the Crossref Cited by service.

Citations

If you have the appropriate software installed, you can download article citation data to the citation manager of your choice. For an editable text file, please select Medlars format which will download as a .txt file. Simply select your manager software from the list below and click Download.

View Options

Figures and Media

Figures

Media

Tables

Share

Share

Share the article link

Share with email

Email a colleague

Share on social media

American Society for Microbiology ("ASM") is committed to maintaining your confidence and trust with respect to the information we collect from you on websites owned and operated by ASM ("ASM Web Sites") and other sources. This Privacy Policy sets forth the information we collect about you, how we use this information and the choices you have about how we use such information.
FIND OUT MORE about the privacy policy