Identification of a Conserved, Orphan G Protein-Coupled Receptor Required for Efficient Pathogen Clearance in Caenorhabditis elegans
ABSTRACT
G protein-coupled receptors contribute to host defense across the animal kingdom, transducing many signals involved in both vertebrate and invertebrate immune responses. While it has become well established that the nematode worm Caenorhabditis elegans triggers innate immune responses following infection with numerous bacterial, fungal, and viral pathogens, the mechanisms by which C. elegans recognizes these pathogens have remained somewhat more elusive. C. elegans G protein-coupled receptors have been implicated in recognizing pathogen-associated damage and activating downstream host immune responses. Here we identify and characterize a novel G protein-coupled receptor required to regulate the C. elegans response to infection with Microbacterium nematophilum. We show that this receptor, which we designate pathogen clearance-defective receptor 1 (PCDR-1), is required for efficient pathogen clearance following infection. PCDR-1 acts upstream of multiple G proteins, including the C. elegans Gαq ortholog, EGL-30, in rectal epithelial cells to promote pathogen clearance via a novel mechanism.
INTRODUCTION
G protein-coupled receptors (GPCRs) are the largest, most diverse group of membrane receptors. They regulate a wide variety of physiological responses, and consequently, they are common drug targets for the treatment of many diseases (1). Signaling via GPCRs plays a critical role in the regulation of immunity and inflammation. GPCRs are expressed on the surface of many immune cells (2) and can be activated by host and bacterially derived signals to regulate innate and adaptive immune responses (3). For example, the inflammatory mediator formyl-Met-Leu-Phe (fMLP) and the complement fragment C5a both bind to and activate GPCRs, stimulating chemotaxis and production of inflammatory cytokines (4, 5). Given the therapeutic success of drugs which target GPCRs, the identification and characterization of GPCRs that regulate immune responses are likely to provide future therapeutic targets for the treatment of infectious and inflammatory diseases.
The role of GPCRs in regulating innate immune responses is conserved in invertebrates (6). Consequently, genetically tractable invertebrate models can provide important insights into the role of GPCRs in host defense. Among these invertebrate models, the nematode worm Caenorhabditis elegans is extremely well suited to this task. The C. elegans genome is predicted to harbor at least 1,300 GPCR genes (7), accounting for approximately 7% of the protein-coding genes in the C. elegans genome (8). Furthermore, infection of C. elegans with a variety of naturally occurring and clinically relevant pathogens, provided as a food source, regulates conserved signaling pathways that activate behavioral and cellular immune responses to protect the host (9). These pathways are known to play central roles in the host defenses of other species and represent important evolutionarily conserved components of innate immunity, highlighting the utility of this model for understanding conserved innate immune responses.
Several GPCRs regulate C. elegans infection responses, demonstrating the conserved function of this receptor superfamily in host defense. These include dcar-1 (10), fshr-1 (11), dop-4 (12), ser-1, ser-7 (13), and octr-1 (14), which have all been implicated in the regulation of cellular immune responses, and npr-1, which is required for avoidance of pathogenic bacteria (15).
We have previously shown that G protein signaling is required for the C. elegans response to infection with the nematode-specific pathogen Microbacterium nematophilum (16). M. nematophilum establishes a nonlethal, persistent infection in the rectum of C. elegans, triggering behavioral and cellular immune responses, which include swelling around the rectal opening (the deformed anal region [Dar] phenotype) (17), upregulation of defense genes (18), and avoidance of contaminated bacterial lawns (19). Animals with mutations in the C. elegans Gαq ortholog, EGL-30, fail to avoid contaminated bacterial lawns and do not trigger the Dar phenotype following infection (16). As a consequence, these animals become constipated and grow more slowly on M. nematophilum-contaminated lawns (16). Furthermore, the C. elegans Gαo ortholog, GOA-1, acts antagonistically to EGL-30(Gαq) to suppress the Dar phenotype and limit pathogen clearance (13). The role of EGL-30(Gαq) and GOA-1(Gαo) in these responses suggests that GPCRs play an important role in recognizing and responding to the presence of M. nematophilum.
Here we identify a conserved, orphan GPCR, pathogen clearance-defective receptor 1 (PCDR-1), required to promote the clearance of M. nematophilum infections from C. elegans. This is the first description of a phenotype associated with deletions in pcdr-1. We find that PCDR-1 is expressed in neurons, epithelial cells, and vulval muscle and that it is required for rectal epithelial cells to regulate pathogen clearance. PCDR-1 acts upstream of, and in parallel with, EGL-30(Gαq) in this response. Our previous data indicate that the role of the Dar phenotype is to promote pathogen clearance (13); however, PCDR-1 appears to play a minor role in regulating the previously described cellular and behavioral immune responses to M. nematophilum infection, suggesting that it regulates pathogen clearance via at least one novel mechanism.
RESULTS
PCDR-1 is a G protein-coupled receptor required for efficient pathogen clearance.
Infection of C. elegans with the naturally occurring pathogen M. nematophilum triggers an immune response that includes swelling around the rectal opening, known as the Dar phenotype (17). This response is associated with increased rates of pathogen clearance from the rectal opening (13) and requires signaling via the G protein EGL-30(Gαq) (16). To identify GPCRs acting upstream of EGL-30(Gαq) in this response, we screened viable GPCR deletion mutants obtained from the Caenorhabditis Genetic Center (University of Minnesota) for the Dar phenotype and their ability to clear SYTO13-labeled M. nematophilum infections (see Materials and Methods for screen details). Wild-type animals were able to clear 50% of the SYTO13-labeled M. nematophilum bacteria within 90 min of transfer to plates without any bacteria (Fig. 1C). We identified two strains containing deletions in the sixth and seventh transmembrane domains of the orphan GPCR F59D12.1, f59d12.1(gk1000) and f59d12.1(gk1122) (Fig. 1A and B), that retained significantly more labeled pathogen than wild-type animals after 90 min (Fig. 1C). The ability of the pathogen to attach to the cuticle was not altered in these strains, since we observed similar steady-state levels of SYTO13-labeled M. nematophilum bacteria adhering to the rectum of wild-type, f59d12.1(gk1122), and f59d12.1(gk1000) animals (Fig. 1D). Given that this is the first phenotype to be associated with a deletion in f59d12.1, we designated the f59d12.1 gene pathogen clearance-defective receptor 1 (pcdr-1).
FIG 1
Although both pcdr-1 deletions were defective in their ability to clear labeled pathogen, we observed significant differences in the rates of pathogen clearance when these two deletions were compared, with the pcdr-1(gk1000) strain clearing the pathogen significantly faster than the pcdr-1(gk1122) strain (Fig. 1C). To attempt to explain this difference, we sought to determine whether either of these deletions was a null allele of pcdr-1 using reverse transcription-PCR (RT-PCR). pcdr-1(gk1122) and pcdr-1(gk1000) are relatively small deletions in the 3′ end of pcdr-1 covering the fifth and sixth and the fourth and fifth exons, respectively (Fig. 1A and Fig. 2A). As expected, using primers covering these exons (Fig. 2A), we failed to detect a PCR product in pcdr-1(gk1122) or pcdr-1(gk1000) (Fig. 2B, top 2 panels). However, using primers covering exons 1 and 2 of pcdr-1 (Fig. 2A), we detected PCR products in both pcdr-1(gk1000) and pcdr-1(gk1122) (Fig. 2B, third panel), suggesting that neither of these alleles represents a null allele of pcdr-1. To determine whether pcdr-1(gk1122) and pcdr-1(gk1000) were loss-of-function alleles of the same gene, we performed complementation tests. Pathogen clearance rates in animals heterozygous for either pcdr-1(gk1122) or pcdr-1(gk1000) were indistinguishable from that of the wild type, indicating that both deletions are recessive (Fig. 1E). However, transheterozygote animals for the two pcdr-1 deletions failed to complement each other and retained significantly more pathogen than wild-type animals after 90 min (Fig. 1E), indicating that loss of pcdr-1 function is responsible for the pathogen clearance defect observed in these deletion strains.
FIG 2
To further confirm that the pathogen clearance defect observed in pcdr-1(gk1122) and pcdr-1(gk1000) strains was caused by pcdr-1, we performed rescue experiments. Several independent lines expressing a genomic fragment containing wild-type pcdr-1 (fosmid WRM0618bH06) fully restored the ability of pcdr-1(gk1122) and pcdr-1(gk1000) animals to clear labeled pathogens (Fig. 1F and G). Indeed, pcdr-1(gk1122) and pcdr-1(gk1000) animals expressing this genomic fragment cleared labeled pathogens significantly faster than the wild type (Fig. 1F and G).
PCDR-1 is expressed in neurons, vulval muscle, and rectal epithelial cells.
Where is PCDR-1 required to regulate pathogen clearance? The genomic rescuing fragment contained a 2.8-kb region upstream of the predicted pcdr-1 ATG codon (here pcdr-1p); therefore, we sought to determine whether this sequence was sufficient to drive PCDR-1 expression in cells where it was required for pathogen clearance by performing rescue experiments using the PCDR-1 cDNA under the control of pcdr-1p. Expression of this transgene was sufficient to fully rescue the pathogen clearance defect of pcdr-1(gk1122) and pcdr-1(gk1000) strains (Fig. 1F and G), suggesting that pcdr-1p drives the expression of PCDR-1 in cells where it is required for pathogen clearance. To identify these cells, we expressed green fluorescent protein (GFP) under the control of pcdr-1p. pcdr-1p::GFP expression was observed in ciliated neurons in the head (Fig. 3D to F) and neurons in the ventral nerve cord (VNC) (Fig. 3A to C). In the VNC, pcdr-1p::GFP expression colocalized with acr-2p::mCherry, which marks the cholinergic motor neurons; however, we also observed GFP-positive cell bodies that were not colocalized with this marker, suggesting that PCDR-1 is expressed in both cholinergic and noncholinergic neurons in the VNC (Fig. 3C).
FIG 3
Interestingly, we also observed expression of pcdr-1p::GFP in the vulval muscles (Fig. 3G to I) and in nonneuronal cells in the tail (Fig. 3K). To determine the identity of these nonneuronal cells, we coexpressed mCherry from a 1.3-kb fragment of the egl-5 promoter that drives expression in rectal epithelial cells (20). pcdr-1p::GFP expression colocalized with egl-5p::mCherry (Fig. 3L), indicating that PCDR-1 was expressed in the rectal epithelium.
The expression of several mammalian GPCRs is known to be regulated by infection (2). Since the expression pattern of PCDR-1 was determined in the absence of infection, we next sought to determine whether expression of PCDR-1 was regulated during infection with M. nematophilum. Using quantitative RT-PCR (qRT-PCR), we did not detect any significant differences in the expression of pcdr-1 between M. nematophilum-infected and uninfected wild-type animals (Fig. 3M). Furthermore, we did not observe any differences in the expression pattern of pcdr-1p::GFP following infection with M. nematophilum (R. McMullan, data not shown). These data suggest that expression of PCDR-1 in neurons, vulval muscle, and/or rectal epithelial cells is sufficient to mediate pathogen clearance.
PCDR-1 is required in rectal epithelial cells for efficient pathogen clearance.
To determine where PCDR-1 was required to mediate pathogen clearance, we performed cell-specific rescue experiments using the PCDR-1 cDNA expressed from either the panneuronal rab-3 promoter (rab-3p) (n::PCDR-1) (21) or a 1.3-kb fragment of the egl-5 promoter that drives GFP expression in B, U, F, and K rectal epithelial cells (egl-5p) (re::PCDR-1) (20). Expression of PCDR-1 cDNA throughout the nervous system, using rab-3p, failed to rescue the pcdr-1(gk1000) pathogen clearance defect (Fig. 4B). However, we observed some rescue of the pcdr-1(gk1122) pathogen clearance defect at 60 min, although this rescue was no longer observed at 90 min (Fig. 4A).
FIG 4
In contrast, expression of pcdr-1 cDNA in rectal epithelial cells, using egl-5p, was sufficient to fully rescue the pcdr-1(gk1122) (Fig. 4A) and pcdr-1(gk1000) (Fig. 4B) pathogen clearance defect at all time points. These results demonstrate that although neuronal PCDR-1 may play a minor role in pathogen clearance, the major site of action for PCDR-1 in this response to infection is the rectal epithelium.
PCDR-1 acts upstream of, and in parallel with, EGL-30(Gαq) to mediate efficient pathogen clearance.
Previous studies have identified that EGL-30(Gαq) and LET-60(Ras) signaling pathways acting in the rectal epithelium trigger the Dar phenotype in response to infection (16). Activation of these pathways using gain-of-function egl-30(js126gf) or let-60(n1046gf) alleles also results in increased pathogen clearance rates (R. McMullan, unpublished data). To determine whether PCDR-1 acts via either of these pathways to regulate pathogen clearance, we performed epistasis analysis using pcdr-1(gk1122) and gain-of-function egl-30(js126gf) and let-60(n1046gf) alleles. Consistent with our previous observations, we observed a small decrease in the percentage of egl-30(js126gf) animals retaining labeled pathogen at 90 min compared to wild-type controls; however, we were unable to observe an increase in pathogen clearance rates in let-60(n1046gf) animals (Fig. 5). Furthermore, the percentage of pcdr-1(gk1122);let-60(n1046gf) animals retaining labeled pathogen was not significantly different from that of pcdr-1(gk1122) animals alone (Fig. 5), suggesting that PCDR-1 does not signal via LET-60(Ras) to regulate pathogen clearance. Conversely, pcdr-1(gk1122);egl-30(js126gf) animals retained significantly more labeled pathogen than pcdr-1(gk1122) animals alone. However, these animals still retained more labeled pathogen than either egl-30(js126gf) animals alone or wild-type controls (Fig. 5). Taken together, these results suggest that PCDR-1 regulates pathogen clearance via at least two downstream pathways, one of which requires EGL-30(Gαq).
FIG 5
PCDR-1 has a minor effect on the known cellular immune responses to M. nematophilum infection.
How does PCDR-1 mediate efficient pathogen clearance? When C. elegans is exposed to M. nematophilum-contaminated bacterial lawns, it triggers protective cellular immune responses, including induction of defense genes (18) and the Dar phenotype (17). In addition, changes in C. elegans behavior following infection result in avoidance of contaminated lawns (19). Although the relationship between these responses and pathogen clearance has not been fully established, our previous data indicate that one role of the Dar phenotype is to promote pathogen clearance (13). Therefore, we sought to determine whether changes in cellular immune responses or behavioral avoidance of the pathogen could account for the failure of pcdr-1(gk1122) and pcdr-1(gk1000) animals to efficiently clear pathogen infections.
The Dar phenotype is associated with increased rates of pathogen clearance from the rectal opening (13). Mutations in genes that are required for the Dar phenotype, including unc-73(ce362) and mpk-1(ku1), result in an almost complete failure to trigger the Dar phenotype following infection (16) and decreased rates of pathogen clearance (McMullan, unpublished). Therefore, we scored the Dar phenotype of pcdr-1(gk1122) and pcdr-1(gk1000) animals following infection. In contrast to unc-73(ce362) and mpk-1(ku1) animals, where the Dar phenotype is almost completely absent following infection, we observed only small differences in the Dar phenotype of pcdr-1(gk1122) or pcdr-1(gk1000) animals relative to wild-type controls (Fig. 6A). This suggests that failure to trigger the Dar phenotype in pcdr-1(gk1122) or pcdr-1(gk1000) animals does not fully account for the defective pathogen clearance observed in these animals.
FIG 6
The induction of host defense genes is also part of the cellular response to infection with M. nematophilum (18). Since pcdr-1(gk1122) and pcdr-1(gk1000) did not have a large effect on the Dar phenotype, we sought to determine whether PCDR-1 could regulate this cellular response to infection by examining the expression of two host defense genes, clec-60 and f53a9.8, that are upregulated by infection with M. nematophilum (18). Using qRT-PCR, we measured the induction of clec-60 and f53a9.8 following infection of wild-type, pcdr-1(gk1122), and pcdr-1(gk1000) animals. Unlike in previous studies, we were unable to detect a significant increase in clec-60 expression following infection of wild-type animals (data not shown). This mostly likely reflects differences in infection protocols, as in contrast to previous studies that collected RNA 6 h after infection, we grew animals on infection plates for one generation. We observed a significant increase in f53a9.8 expression following infection of wild-type animals (Fig. 6B and C). A similar increase was also observed in pcdr-1(gk1122) (Fig. 6B) or pcdr-1(gk1000) (Fig. 6C) animals.
Changes in defecation are not responsible for PCDR-1 pathogen clearance defects.
Since pcdr-1(gk1122) and pcdr-1(gk1000) appear to have only a minor effect on the previously identified cellular responses to infection with M. nematophilum, we sought other explanations for the role of PCDR-1 in pathogen clearance. Although the role of defecation in mediating M. nematophilum clearance has not been fully investigated, it seemed logical that it may be involved in removing the pathogen from the rectal opening. Therefore, we sought to determine whether the pcdr-1 pathogen clearance defect was caused by defects in the defecation cycle. C. elegans defecation occurs via a series of highly stereotyped muscle contractions that are initiated approximately every 50 s (22). To determine the length of each defecation cycle following infection, we measured the intervals between one of these muscle contractions, the posterior body muscle contraction (pBoc). Wild-type uninfected animals had a mean cycle length of 60 s, and following infection, this cycle interval was decreased to 47 s, indicating that infection increased the defecation rate (Fig. 7A). Uninfected pcdr-1(gk1122) and pcdr-1(gk1000) animals had a mean cycle interval similar to that of wild-type animals, and this was also decreased following infection (Fig. 7A).
FIG 7
In wild-type animals, the pBoc step of the defecation cycle is almost always followed by anterior body muscle contraction (aBoc) and then expulsion (Exp) (22). While measuring the mean cycle length of infected animals, we noticed that the Exp step was frequently absent. The percentage of complete cycles (those in which Exp followed pBoc) was decreased from 98% in uninfected wild-type animals to 38% following infection (Fig. 7B). A similar decrease was also observed in pcdr-1(gk1122) and pcdr-1(gk1000) animals (Fig. 7B), suggesting that although infection is able to alter the C. elegans defecation cycle, this is not regulated by PCDR-1.
Defective pathogen avoidance in PCDR-1 does not fully account for pathogen clearance defects.
Infection with M. nematophilum triggers changes in locomotion that lead to behavioral avoidance of the pathogen (16, 19, 23). Like the Dar phenotype, this behavioral response requires EGL-30(Gαq) (16). Therefore, we sought to determine whether the pathogen clearance defects that we observed in strains carrying pcdr-1(gk1122) and pcdr-1(gk1000) deletions reflected decreased behavioral avoidance of the pathogen.
To do this, we first performed pathogen avoidance assays in which we scored the percentages of animals on and off lawns contaminated with M. nematophilum. Sixty percent of wild-type animals avoided M. nematophilum-contaminated lawns (Fig. 8A). We observed a significant avoidance defect in pcdr-1(gk1000) and pcdr-1(gk1122) animals, with only 42% of pcdr-1(gk1000) and 4% of pcdr-1(gk1122) animals avoiding contaminated bacterial lawns (Fig. 8A).
FIG 8
To determine whether deletions in pcdr-1 were responsible for the pathogen avoidance defects that we observed, we made use of the genomic fragment that rescued the pcdr-1(gk1122) and pcdr-1(gk1000) pathogen clearance defects (Fig. 1F and G). Using these transgenes, we were unable to observe any rescue of the pcdr-1(gk1122) pathogen avoidance phenotypes (Fig. 8A). Therefore, we suggest that this strain contains an additional mutation that is responsible for this pathogen avoidance phenotype or that additional regulatory elements not present in our rescuing transgene are required for PCDR-1 to regulate pathogen avoidance. Regardless, the decreased pathogen clearance observed in pcdr-1(gk1122) animals is not a consequence of their inability to avoid pathogenic lawns since this transgene was able to fully rescue the pcdr-1(gk1122) pathogen clearance defect (Fig. 1F and G). Conversely, the pcdr-1(gk1000) pathogen avoidance defect could be fully rescued by expression of these transgenes (Fig. 8A), suggesting that pathogen avoidance could contribute to the pathogen clearance defect in these animals.
To further investigate how pathogen avoidance contributes to differences in pathogen clearance rates, we modified our infection assay by spreading M. nematophilum bacteria to the edges of the plate. In this “full-plate” assay, animals were unable to avoid the pathogen. Wild-type animals raised on full plates were still able to clear labeled pathogen, although this occurred more slowly than for animals raised on our standard assay plates (Fig. 8B and C), suggesting that the ability to avoid pathogen lawns is important for efficient pathogen clearance. We observed a similar decrease in the rate of pathogen clearance in pcdr-1(gk1000) animals grown on full plates compared to pcdr-1(gk1000) animals raised on standard lawns (Fig. 8C), suggesting that although pcdr-1(gk1000) animals are partially defective in pathogen avoidance, under standard conditions, this defect does not fully account for the observed pathogen clearance defect. In contrast, we did not observe any decrease in the pathogen clearance rates of pcdr-1(gk1122) mutants on standard versus full plates (Fig. 8B). This could be a consequence of limitations in this assay, since very few pcdr-1(gk1122) animals clear labeled pathogen under standard conditions, making it difficult to observe any further decreases in the pathogen clearance rate.
Taken together, our results suggest that defective pathogen avoidance and a decrease in the Dar phenotype may contribute to the defective pathogen clearance that we observed in pcdr-1(gk1000) animals. However, the failure to observe any large changes in the Dar phenotype and our inability to rescue the pathogen avoidance defect of pcdr-1(gk1122) animals suggest that PCDR-1 regulates pathogen clearance via multiple mechanisms, at least one of which is novel.
DISCUSSION
Despite significant advances in understanding the immune responses that are activated by C. elegans during infection, a relatively small number of cell surface receptors that detect the presence of pathogens have been identified. These include the GPCRs DCAR-1 (10), FSHR-1 (11), DOP-4 (12), SER-1 and SER-7 (13), and OCTR-1 (14). Here we identify a previously uncharacterized GPCR required to regulate the host response to infection with M. nematophilum, adding PCDR-1 to the list of GPCRs required for host defense in C. elegans.
PCDR-1 is expressed in neurons, vulval muscle, and rectal epithelial cells, and our ability to rescue pcdr-1(gk1122) and pcdr-1(gk1000) by expressing the PCDR-1 cDNA from a rectal epithelial cell-specific promoter demonstrates that PCDR-1 is required in rectal epithelial cells for efficient pathogen clearance. The requirement for PCDR-1 in cells that mediate the cellular immune response to infection is consistent with previous observations using Drechmeria coniospora (10) and Pseudomonas aeruginosa (11), where the GPCRs DCAR-1 and FSHR-1 act cell autonomously to regulate cellular immune responses. However, while expression of PCDR-1 in rectal epithelial cells was sufficient to regulate pathogen clearance, it should be noted that expression of PCDR-1 may be modified by additional regulatory elements upstream of the 2.8-kb region used for our rescue experiments, and this expression may be required for additional functions of PCDR-1.
Signaling by EGL-30(Gαq) in rectal epithelial cells is both necessary and sufficient to trigger changes in cell morphology that cause the Dar phenotype (16), and the requirement for PCDR-1 in rectal epithelial cells raises the possibility that PCDR-1 exerts its effects on pathogen clearance via EGL-30(Gαq). Consistent with this, we find that PCDR-1 acts via EGL-30(Gαq); however, two lines of evidence suggest that multiple G proteins act downstream of PCDR-1.
First, epistasis analysis using animals carrying a gain-of-function egl-30(js126gf) allele demonstrates that although egl-30(js126gf);pcdr-1(gk1122) animals clear infections more quickly than pcdr-1(gk1122) animals alone, pcdr-1(gk1122) is still able to decrease the pathogen clearance rates of egl-30(js126gf) animals. Second, while loss-of-function mutations in egl-30(ad805) result in a complete failure to trigger the Dar phenotype following infection with M. nematophilum (16), we observed only a small decrease in the Dar phenotype in pcdr-1(gk1000) and pcdr-1(gk1122) animals. Taken together, our data suggest that PCDR-1 exerts its effects via EGL-30(Gαq) and an additional G protein. The C. elegans genome encodes 21 Gα subunits, including orthologs of each mammalian Gα: Gαq (EGL-30), Gαo (GOA-1), Gαs (GSA-1), and Gα12 (GPA-12) (24). We previously demonstrated that GOA-1(Gαo) suppresses the Dar phenotype and limits pathogen clearance (13), suggesting that GOA-1(Gαo) does not act downstream of PCDR-1 to promote pathogen clearance; however, the roles of the other G proteins in regulating pathogen clearance and their relationship to PCDR-1 remain to be established.
Although our data clearly demonstrate the PCDR-1 is required in rectal epithelial cells for efficient pathogen clearance, we also observed some rescue of pcdr-1(gk1122) when PCDR-1 was expressed in neurons, indicating a possible role for neuronal PCDR-1 in regulating pathogen clearance. Further work is required to establish the role of neuronal PCDR-1 in pathogen clearance; however, several other C. elegans GPCRs act in neurons to regulate host defenses (11, 14, 15).
How does PCDR-1 signaling in rectal epithelial cells regulate pathogen clearance? Given our previous observation that animals with a decreased ability to trigger the Dar phenotype clear infections more slowly (13) and the role of EGL-30(Gαq) in regulating the Dar phenotype (16), one possible mechanism by which PCDR-1 could regulate pathogen clearance is via the regulation of the Dar phenotype. However, we observed only a modest decrease in the Dar phenotype of pcdr-1(gk1000) and pcdr-1(gk1122), suggesting that PCDR-1 is not the main GPCR required to promote the Dar phenotype upstream of EGL-30(Gαq) and that PCDR-1 most likely regulates pathogen clearance via another mechanism. We also failed to observe any differences in defecation or induction of antimicrobial peptides in pcdr-1 mutants, suggesting that PCDR-1 does not regulate pathogen clearance by either of these mechanisms.
One possible explanation for the decrease in pathogen clearance rates could be an increase in pathogen load caused by an inability to avoid pathogenic lawns. Although we observed a pathogen avoidance defect in both pcdr-1(gk1122) and pcdr-1(gk1000) animals, we propose that this avoidance defect cannot fully explain the defective pathogen clearance in these animals for several reasons. First, we have previously shown that an inability to avoid pathogen-contaminated bacterial lawns increases pathogen load (23); however, we did not observe any increase in pathogen load in pcdr-1 mutants compared to wild-type controls. Second, pathogen clearance rates were further decreased when pcdr-1(gk1000) animals were infected under conditions where they were unable to avoid pathogen-contaminated bacterial lawns in a manner similar to that of the wild type. Finally, we were unable to rescue the pathogen avoidance defect of pcdr-1(gk1122) animals using transgenes that were able to rescue the pathogen clearance defect in these animals. It should be noted that while this result demonstrates that pathogen avoidance cannot account for the pathogen clearance defect in pcdr-1(gk1122) animals, it does not fully exclude a role for PCDR-1 in the pathogen avoidance defect observed in pcdr-1(gk1122) animals. We did not test transgenes containing regulatory regions upstream of the 2.8-kb region used to rescue the pathogen clearance defect of pcdr-1, and it therefore remains possible that regulation of PCDR-1 expression by additional upstream regulatory elements could be required for the ability of PCDR-1 to mediate pathogen avoidance. Taken together, our results suggest that although regulation of lawn avoidance and the Dar phenotype by PCDR-1 may play a role in promoting pathogen clearance, PCDR-1 also acts via another mechanism. Genetic screens to identify further suppressors of pathogen clearance are likely to provide insight into this novel mechanism.
We have shown that PCDR-1 is required for efficient pathogen clearance; however, PCDR-1 is an orphan GPCR, and the ligand that activates PCDR-1 to promote pathogen clearance remains to be identified. One possibility is that PCDR-1 acts as a pattern recognition receptor (PRR) that recognizes a specific microbial product or pathogen-associated molecular pattern (PAMP). Alternatively, PCDR-1 could act as a damage-associated molecular pattern (DAMP) receptor recognizing an endogenous signal released by C. elegans in response to infection. To date, no PRRs have been identified in C. elegans; however, DCAR-1 has been shown to act as a DAMP receptor and is activated by endogenous hydroxyphenyllactic acid (HPLA), which accumulates when worms are infected with the fungal pathogen Drechmeria coniospora (10). The identification of the ligand for PCDR-1 will be key to further understanding its role in host defense.
Receptors for biogenic amines, including serotonin (13), octopamine (14), and dopamine (12), have been shown to regulate immune function in C. elegans, and PCDR-1 is a predicted ortholog of the Drosophila melanogaster dopamine/ecdysone receptor DopEcR. This raises the possibility that either PCDR-1 detects dopamine secreted by M. nematophilum or infection induces the expression of endogenous C. elegans dopamine, which acts as a DAMP to activate PCDR-1. However, cat-2 mutant animals that lack the ability to synthesize dopamine have wild-type rates of pathogen clearance (McMullan, unpublished), suggesting that endogenously synthesized dopamine is unlikely to act as a DAMP following M. nematophilum infection.
By homology, PCDR-1 is also predicted to have melatonin receptor activity (25, 26), suggesting that melatonin may act as a PAMP or DAMP to activate PCDR-1 during M. nematophilum infection. In support of this, expression of the C. elegans ortholog of arylalkylamine N-acetyltransferase (AA-NAT) (anat-1), which is required for the synthesis of melatonin from serotonin, is upregulated following M. nematophilum infection (McMullan, unpublished). However, we were unable to demonstrate activation of PCDR-1 by melatonin biochemically in vitro (Isabel Beets, personal communication), and further experiments are required to determine whether PCDR-1 has melatonin receptor activity.
Human free fatty acid receptor 4 (FFAR4) and the hypocretin neuropeptide receptors HCRTR1 and HCRTR2 are all predicted orthologs of PCDR-1, suggesting that either neuropeptides or omega-3 fatty acids (ω3-FAs) could act as PCDR-1 ligands. A number of C. elegans neuropeptides are regulated in response to infection (27), and it remains to be determined whether any of these act as a DAMP during M. nematophilum infection. Similarly, one of the C. elegans genes required for the synthesis of ω3-FAs (fat-3) is upregulated by infection with Pseudomonas aeruginosa and is required for basal immunity (28), although the role of ω3-FA in the response to M. nematophilum remains unknown. Interestingly, DCAR-1 has recently been identified as a paralog of PCDR-1 and an ortholog of FFAR4, HCRTR1, and HCRTR2, raising the possibility that PCDR-1 and DCAR-1 may represent a family of related GPCRs required to recognize infection in C. elegans.
Although further experiments are required to identify a biological ligand for PCDR-1, immunomodulatory functions for FFAR4, hypocretin, dopamine, and melatonin receptors have been reported in mammals. FFAR4 has an anti-inflammatory role (29), while hypocretin, dopamine, and melatonin receptors are expressed on cells associated with immune function (30–32) and have been reported to regulate phagocytosis in macrophages (33, 34). Therefore, it is possible that the function of PCDR-1 in host defense is conserved, and further studies into its function in C. elegans may provide basic insights into evolutionarily conserved roles of GPCRs in protecting animals from infection.
MATERIALS AND METHODS
Strains.
The following C. elegans strains were used in this study: N2, VC2258 [pcdr-1(gk1122)], and VC2156 [pcdr-1(gk1000)]. VC2258 and VC2156 were outcrossed twice to give RJM142 [pcdr-1(gk1122)*2] and RJM149 [pcdr-1(gk1000)*2]. All strains were cultivated at 20°C on nematode growth medium (NGM) plates seeded with Escherichia coli OP50, unless otherwise stated, and maintained as described previously (35).
The procedures carried out in the research using Caenorhabditis elegans as a model for behavioral and cellular responses to infection are approved under the Animals (Scientific Procedures) Act 1986 and were approved by The Open University’s Animal Welfare and Ethical Review Body (AWERB).
Transgenes and germ line transformation.
Plasmids (listed as pRJM) were constructed using standard techniques and verified by sequencing. Transgenic strains (listed as impEx) were isolated by microinjection of the plasmid together with cc::GFP, egl-5p::mCherry (pRJM88), or acr-2p::mCherry (pSJN445) (a gift of S. Nurrish, Massachusetts General Hospital) at 50 ng/μl as a marker. In all experiments, matched animals not expressing the injection marker were assayed in parallel. Data were included only if the phenotype of nontransgenic animals was comparable to that of the parental strain.
Fosmid transgenes.
The fosmid WRM0618bH06 containing a 2.8-kb region upstream of the predicted pcdr-1 ATG, the pcdr-1 coding sequence, and 4 other genes (gpn-1, f59d12.2, C03H12.1, and ZK662.2) was injected at 20 ng/μl into pcdr-1(gk1122) animals. impEx57, -58, -59, -60, and -61 strains contain extrachromosomal versions of this fosmid. Rescue of the pathogen clearance defect was observed in all 5 lines. The impEx57 strain was crossed into the pcdr-1(gk1000) strain.
PCDR-1 transgenes.
A 2.8-kb region upstream of the predicted pcdr-1 ATG was taken from the fosmid WRM0618bH06 and subcloned upstream of GFP to give pRJM185. This plasmid was injected at 20 ng/μl. The impEx52 strain contains an extrachromosomal version of pRJM185 with pSJN445. The impEx53 and impEx54 strains contain extrachromosomal versions of pRJM185 with pRJM88. Similar expression levels of pRJM185 were observed in all 3 lines. Wild-type pcdr-1 cDNA was obtained from yk616h8 (a gift of Yuji Kohara) and verified by sequencing. This cDNA was subcloned into pRJM185, to drive expression from the endogenous promoter (pRJM193); pSJN569, a vector driving expression from the rab-3 promoter that drives expression throughout the nervous system (21) (pRJM192); and pLG7, a vector driving expression from a 1.3-kb egl-5 promoter fragment that drives GFP expression in B, K, F, U, P12.pa, and three body wall muscles in the posterior (20) (pRJM200). These plasmids were injected at 20 ng/μl into pcdr-1(gk1122) animals. The impEx62 and impEx63 strains contain extrachromosomal versions of pRJM193. The impEx59 strain contains an extrachromosomal version of pRJM192. The impEx60 and impEx61 strains contain extrachromosomal versions of pRJM200. The impEx59, impEx60, and impEx62 strains were crossed into the pcdr-1(gk1000) strain.
M. nematophilum infection.
Infection with M. nematophilum and scoring of the Dar phenotype were performed as described previously (13). Unless otherwise stated, adult animals were transferred from OP50 plates to infection plates, and F1 progeny were used for assays when they reached the L4/adult stage. SYTO13 staining was performed as described previously (36). Following incubation with SYTO13, animals were either transferred to unseeded plates, for clearance assays as described below, or mounted for imaging. Experiments were performed in triplicate and repeated at least three times.
Lawn avoidance.
Steady-state lawn avoidance was determined by transferring 3 adult animals to standard NGM plates seeded with 200 μl OP50 bacteria, 10% avirulent M. nematophilum bacteria (UV336), or 10% M. nematophilum bacteria (CBX102) diluted in OP50 bacteria. After 6 h, adult animals were removed, and F1 progeny were allowed to develop at 20°C until they reached the L4/adult stage. Animals were scored as being on or off the bacterial lawn. Experiments were performed in triplicate and repeated at least three times.
Clearance of SYTO13-labeled M. nematophilum.
GPCR mutant screening.
A small-scale pilot screen of 54 GPCR deletion mutants available from the Caenorhabditis Genetics Center (University of Minnesota) was performed. The following strains were used: JT3 aex-2(sa3), RB1423 C49A9.7(ok1620), RB1837 C54A12.2(ok2376), RB1321 C56G3.1(ok1439), RB1329 C56G3.1(ok1446), RB1923 ckr-1(ok2502), RB665 dop-1(ok398), LX702 dop-2(vs105), BZ873 dop-3(ok295), RB1254 dop-4(ok1321), RB785 dop-5(ok568), RB1680 dop-6(ok2090), RB761 F35G8.1(ok527), RB509 F54D7.3(ok238), RB1349 F57H12.4(ok1504), VC2156 F59D12.1(gk1000), VC2285 F59D12.1(gk1122), RB911 fshr-1(ok778), RB896 gar-1(ok755), RB756 gar-2(ok520), VC657 gar-3(gk305), VC670 gar-3(gk337), JD217 gar-3(vu78), RB2502 gnrr-6(ok3465), RB2526 K10B4.4(ok3502), VC158 lat-2(ok301), RB1288 nmur-1(ok1387), VC1974 nmur-3(ok2295), RB1284 nmur-4(ok1381), DA609 npr-1(ad609), CX4148 npr-1(ky13), RB1325 npr-10(ok1442), RB799 npr-11(ok594), RB1836 npr-14(ok2375), RB1365 npr-16(ok1541), RB1289 npr-18(ok1388), RB1958 npr-20(ok2575), VC224 octr-1(ok371), VC2609 pdrf(ok3425), RB1141 R13H7.2(ok1167), RB1690 ser-2(ok2103), RB1622 ser-3(ok1995), RB1631 ser-3(ok2007), RB2277 ser-5(ok3087), RB2626 sprr-1(ok3685), RB1632 T02E9.1(ok2008), RB2105 T07D10.2(ok2780), RB2040 T19F4.1(ok2698), VC270 tag-49(ok381), VC273 tag-89(ok514), VC2171 tkr-1(ok2886), VC125 tyra-3(ok325), RB1688 W05G11.6(ok2098), RB2090 Y105C5A.23(ok2765), RB1938 Y116A8B.5(ok2541), RB1393 Y58G8A.4(ok1583), RB1405 Y59H11AL.1(ok1598), AQ866 ser-4(ok512), DA1814 ser-1(ok345), RB1585 ser-7(ok1944), and DA2100 ser-7(tm1325). These strains were infected with M. nematophilum, and the Dar phenotype was scored as described above. Pathogen clearance rates were determined for a subset of the strains as described above. Experiments were performed in triplicate, and strains with a significant change in either the Dar phenotype or the rate of pathogen clearance were identified for further study.
Microscopy.
Quantification of SYTO13 staining was performed as described previously (13). Controls were imaged in parallel, and experiments were performed on at least three separate occasions. At least 30 animals were imaged under each condition.
For determination of the pcdr-1 expression pattern, animals were washed from NGM plates in M9 buffer (22 mM KH2PO4, 42 mM Na2HPO4, 85 mM NaCl, 1 mM MgSO4) and fixed in 4% paraformaldehyde. After washing with M9 buffer, animals were allowed to settle, and a small volume was transferred to a glass-bottom petri dish. Images were obtained using a Leica SP5 inverted microscope with a 40× objective. Digital images were captured using Leica confocal software and processed to give maximum-intensity projections of a z-series using FIJI (NIH).
RT-PCR analysis.
Animals were grown on standard NGM plates seeded with E. coli strain OP50 and harvested in M9 buffer (22 mM KH2PO4, 42 mM Na2HPO4, 85 mM NaCl, 1 mM MgSO4). Samples were flash-frozen in liquid nitrogen and stored at −80°C until use. Samples were homogenized using lysing matrix Y (MP Biomedicals) in a PowerLyser-24 homogenizer (Mo Bio Laboratories). RNA was extracted using the RNeasy minikit (Qiagen) according to the manufacturer’s instructions. cDNA synthesis and RT-PCR were performed using the One-Taq one-step RT-PCR kit (New England Biolabs). Amplification of act-1 cDNA was performed as a positive control. Primer sequences are listed in Table 1. The resulting amplicons were separated on a 2% agarose gel according to standard procedures.
TABLE 1
| Primer | Sequence (5′–3′) | Use |
|---|---|---|
| pcdr-1_ex4/5_for | CTGCAGCGCTTGATGATAG | RT-PCR |
| pcdr-1_ex5_rev | CCATATTAATTCGCACACCTTC | RT-PCR |
| pcdr-1_ex6_rev | CCTTCGGAACTGATGATTTGTG | RT-PCR |
| pcdr-1_ex1/2_for | GATGTTATTTGATATCCCTATCAGTG | RT-PCR |
| pcdr-1_ex2_rev | CTATCGATACATATCCATGCG | RT-PCR |
| act1_ex1/2_for | CAAGAGAGGTATCCTTACC | RT-PCR |
| act1_ex2_rev | GCATATCCTTCGTAGATTG | RT-PCR |
| F53A9.8 F | ATGTTCACCATGCAGGAGATC | qRT-PCR |
| F53A9.8 R | CATCTTGGTGTTGAGTTTTAGCG | qRT-PCR |
| CLEC-60 F | GGCGATTCAAGCCGATCTTA | qRT-PCR |
| CLEC-60 R | TTGTTTGCCGGCTTCAAGTA | qRT-PCR |
| PCDR-1 F | GCTCGTGGAAACAGACCCAAA | qRT-PCR |
| PCDR-1 R | CACACGAAGAAGAATGTGAGCATTG | qRT-PCR |
Quantitative RT-PCR analysis.
Animals were infected with M. nematophilum as described above, and total RNA was extracted using an RNeasy minikit (Qiagen). qRT-PCR analysis was performed by QStandard as follows. A total of 500 ng RNA was reverse transcribed using Qiagen QuantiTect reverse transcription according to the manufacturer’s instructions. cDNA was amplified using Quantifast SYBR green mix (Qiagen) with each primer at a final concentration of 500 nmol/liter. Primer sequences are listed in Table 1. Copy numbers/reaction were derived from standard curves using Rotor-Gene software. Three reference genes, cdc-42, pmp-3, and Y54F10D.4, were used for normalization. Experiments were performed in biological triplicate.
Defecation assays.
Animals were infected as described above. F1 progeny were scored when they reached the adult stage. Defecation assays were performed as described previously (37). At least 3 animals were scored under each condition. Experiments were performed at least three times.
Statistical analysis.
In all cases, statistical analysis was performed using Prism 6 (GraphPad Software). Normality was determined using a D’Agostino-Pearson omnibus normality test. Data were compared using one-way analysis of variance (ANOVA) followed by a Tukey HSP post hoc multiple-comparison test (for data with a Gaussian distribution) or a Kruskal-Wallis test followed by Dunn’s multiple-comparison test (for non-Gaussian data). Clearance assay data were compared using two-way ANOVA followed by a Tukey post hoc multiple-comparison test. Statistical significance is presented in the text and figures.
ACKNOWLEDGMENTS
This work was supported by Wellcome Trust career development fellowship grant no. WT088409AIA to R.M. and Medical Research Council grant no. MC-A023-5PB91 to W.S. Y.L.C. was funded by an EMBO long-term fellowship (ALTF 403-2016). Some strains were provided by the Caenorhabditis Genetics Center (University of Minnesota), which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440).
We thank Yuji Kohara (National Institute of Genetics, Japan), Isabel Beets (KU Leuven/MRC Laboratory for Molecular Biology, Cambridge), and Robin May (University of Birmingham) for reagents, advice, and sharing unpublished results.
REFERENCES
1.
Lundstrom K. 2017. G-protein-coupled receptor-based drugs rediscovered. Future Med Chem 9:633–636.
2.
Lattin JE, Schroder K, Su AI, Walker JR, Zhang J, Wiltshire T, Saijo K, Glass CK, Hume DA, Kellie S, Sweet MJ. 2008. Expression analysis of G protein-coupled receptors in mouse macrophages. Immunome Res 4:5–13.
3.
Lattin J, Zidar DA, Schroder K, Kellie S, Hume DA, Sweet MJ. 2007. G-protein-coupled receptor expression, function, and signaling in macrophages. J Leukoc Biol 82:16–32.
4.
Lee H, Whitfeld PL, Mackay CR. 2008. Receptors for complement C5a. The importance of C5aR and the enigmatic role of C5L2. Immunol Cell Biol 86:153–160.
5.
Boulay F, Tardif M, Brouchon L, Vignais P. 1990. The human N-formylpeptide receptor. Characterization of two cDNA isolates and evidence for a new subfamily of G-protein-coupled receptors. Biochemistry 29:11123–11133.
6.
Reboul J, Ewbank JJ. 2016. GPCRs in invertebrate innate immunity. Biochem Pharmacol 114:82–87.
7.
Thomas JH, Robertson HM. 2008. The Caenorhabditis chemoreceptor gene families. BMC Biol 6:42.
8.
Hobert O. 13 August 2013. The neuronal genome of Caenorhabditis elegans. In The C. elegans Research Community, WormBook (ed), WormBook.
9.
Ewbank J. 23 January 2006. Signaling in the immune response. In The C. elegans Research Community, WormBook (ed), WormBook.
10.
Zugasti O, Bose N, Squiban B, Belougne J, Kurz CL, Schroeder FC, Pujol N, Ewbank JJ. 2014. Activation of a G protein-coupled receptor by its endogenous ligand triggers the innate immune response of Caenorhabditis elegans. Nat Immunol 15:833–838.
11.
Powell JR, Kim DH, Ausubel FM. 2009. The G protein-coupled receptor FSHR-1 is required for the Caenorhabditis elegans innate immune response. Proc Natl Acad Sci U S A 106:2782–2787.
12.
Cao X, Aballay AA. 2016. Neural inhibition of dopaminergic signaling enhances immunity in a cell-non-autonomous manner. Curr Biol 26:2329–2334.
13.
Anderson A, Laurenson-Schafer H, Partridge FA, Hodgkin J, McMullan R. 2013. Serotonergic chemosensory neurons modify the C. elegans immune response by regulating G-protein signaling in epithelial cells. PLoS Pathog 9:e1003787.
14.
Sun J, Singh V, Kajino-Sakamoto R, Aballay A. 2011. Neuronal GPCR controls innate immunity by regulating noncanonical unfolded protein response genes. Science 332:729–732.
15.
Reddy KC, Andersen EC, Kruglyak L, Kim DH. 2009. A polymorphism in npr-1 is a behavioral determinant of pathogen susceptibility in C. elegans. Science 323:382–384.
16.
McMullan R, Anderson A, Nurrish S. 2012. Behavioral and immune responses to infection require Gαq-RhoA signaling in C. elegans. PLoS Pathog 8:e1002530.
17.
Hodgkin J, Kuwabara PE, Corneliussen B. 2000. A novel bacterial pathogen, Microbacterium nematophilum, induces morphological change in the nematode C. elegans. Curr Biol 10:1615–1618.
18.
O’Rourke D. 2006. Genomic clusters, putative pathogen recognition molecules, and antimicrobial genes are induced by infection of C. elegans with M. nematophilum. Genome Res 16:1005–1016.
19.
Yook K, Hodgkin J. 2007. Mos1 mutagenesis reveals a diversity of mechanisms affecting response of Caenorhabditis elegans to the bacterial pathogen Microbacterium nematophilum. Genetics 175:681–697.
20.
Teng Y, Girard L, Ferreira HB, Sternberg PW, Emmons SW. 2004. Dissection of cis-regulatory elements in the C. elegans Hox gene egl-5 promoter. Dev Biol 276:476–492.
21.
Nonet ML, Staunton JE, Kilgard MP, Fergestad T, Hartwieg E, Horvitz HR, Jorgensen EM, Meyer BJ. 1997. Caenorhabditis elegans rab-3 mutant synapses exhibit impaired function and are partially depleted of vesicles. J Neurosci 17:8061–8073.
22.
Liu DW, Thomas JH. 1994. Regulation of a periodic motor program in C. elegans. J Neurosci 14:1953–1962.
23.
Anderson A, McMullan R. 2018. Neuronal and non-neuronal signals regulate Caernorhabditis [sic] elegans avoidance of contaminated food. Philos Trans R Soc Lond B Biol Sci 373:20170255.
24.
Bastiani C, Mendel J. 13 October 2006. Heterotrimeric G proteins in C. elegans. In The C. elegans Research Community, WormBook (ed), WormBook.
25.
Fox RM, Von Stetina SE, Barlow SJ, Shaffer C, Olszewski KL, Moore JH, Dupuy D, Vidal M, Miller DM. 2005. A gene expression fingerprint of C. elegans embryonic motor neurons. BMC Genomics 6:42.
26.
Keating CD, Kriek N, Daniels M, Ashcroft N, Hopper N, Siney E, Holden-Dye L, Burke J. 2003. Whole-genome analysis of 60 G protein-coupled receptors in Caenorhabditis elegans by gene knockout with RNAi. Curr Biol 30:1715–1720.
27.
Kawli T, He F, Tan MW. 2010. It takes nerves to fight infections: insights on neuro-immune interactions from C. elegans. Dis Model Mech 3:721–731.
28.
Nandakumar M, Tan M-W. 2008. Gamma-linolenic and stearidonic acids are required for basal immunity in Caenorhabditis elegans through their effects on p38 MAP kinase activity. PLoS Genet 4:e1000273.
29.
Anbazhagan AN, Priyamvada S, Gujral T, Bhattacharyya S, Alrefai WA, Dudeja PK, Borthakur A. 2016. A novel anti-inflammatory role of GPR120 in intestinal epithelial cells. Am J Physiol Cell Physiol 310:C612–C621.
30.
Drazen DL, Nelson RJ. 2001. Melatonin receptor subtype MT2 (Mel 1b) and not mt1 (Mel 1a) is associated with melatonin-induced enhancement of cell-mediated and humoral immunity. Neuroendocrinology 74:178–184.
31.
Steidl U, Bork S, Schaub S, Selbach O, Seres J, Aivado M, Schroeder T, Rohr U-P, Fenk R, Kliszewski S, Maercker C, Neubert P, Bornstein SR, Haas HL, Kobbe G, Tenen DG, Haas R, Kronenwett R. 2004. Primary human CD34+ hematopoietic stem and progenitor cells express functionally active receptors of neuromediators. Blood 104:81–88.
32.
Sarkar C, Basu B, Chakroborty D, Dasgupta PS, Basu S. 2010. The immunoregulatory role of dopamine: an update. Brain Behav Immun 24:525–528.
33.
Muxel SM, Pires-Lapa MA, Monteiro AWA, Cecon E, Tamura EK, Floeter-Winter LM, Markus RP. 2012. NF-κB drives the synthesis of melatonin in RAW 264.7 macrophages by inducing the transcription of the arylalkylamine-N-acetyltransferase (AA-NAT) gene. PLoS One 7:e52010.
34.
Ichinose M, Watanabe Y. 2004. Stimulation of phagocytosis in mouse peritoneal macrophages by orexin-B and orexin-A. Biomed Res 25:249–254.
35.
Brenner S. 1974. The genetics of Caenorhabditis elegans. Genetics 77:71–94.
36.
Nicholas HR, Hodgkin J. 2004. The ERK MAP kinase cascade mediates tail swelling and a protective response to rectal infection in C. elegans. Curr Biol 14:1256–1261.
37.
Thomas JH. 1990. Genetic analysis of defecation in Caenorhabditis elegans. Genetics 124:855–872.
Information & Contributors
Information
Published In
Infection and Immunity
Volume 87 • Number 4 • April 2019
eLocator: 10.1128/iai.00034-19
Editor: De’Broski R. Herbert, University of Pennsylvania
Copyright
© 2019 American Society for Microbiology. All Rights Reserved.
History
Received: 14 January 2019
Accepted: 15 January 2019
Published online: 25 March 2019
Keywords
Contributors
Editor
De’Broski R. Herbert
Editor
University of Pennsylvania
Metrics & Citations
Metrics
Note:
- For recently published articles, the TOTAL download count will appear as zero until a new month starts.
- There is a 3- to 4-day delay in article usage, so article usage will not appear immediately after publication.
- Citation counts come from the Crossref Cited by service.
Citations
Citation
2019.
Identification of a Conserved, Orphan G Protein-Coupled Receptor Required for Efficient Pathogen Clearance in Caenorhabditis elegans. Infect Immun
87:10.1128/iai.00034-19.
If you have the appropriate software installed, you can download article citation data to the citation manager of your choice. For an editable text file, please select Medlars format which will download as a .txt file. Simply select your manager software from the list below and click Download.