Invasive and Noninvasive Streptococcus pneumoniae Capsule and Surface Protein Diversity following the Use of a Conjugate Vaccine
ABSTRACT
The 13-valent pneumococcal conjugate vaccine (PCV13) was introduced in the United States in 2010 for the prevention of invasive pneumococcal disease (IPD) and otitis media. While many studies have reported its potential efficacy for IPD, not much is known about the epidemiology of noninvasive disease following its introduction. We characterized the capsular types and surface protein genes of noninvasive pediatric pneumococcal isolates collected between 2002 and 2010 (n = 1,058) at Children's of Alabama following the introduction of PCV7 and tested a subset of noninvasive and previously characterized IPD isolates for the presence of the pspA, pspC, and rrgC genes, which encode protection-eliciting proteins. PCV7 serotypes had dramatically decreased by 2010 (P < 0.0001), and only 50% of all noninvasive infections were caused by the PCV13 capsular serotypes. Serotype 19A accounted for 32% of the noninvasive isolates, followed by serotypes 35B (9%), 19F (7%), and 6C (6%). After 7 years of PCV7 usage, there were no changes in the frequencies of the pspA or pspC genes; 96% of the strains were positive for family 1 or 2 pspA genes, and 81% were also positive for pspC. Unexpectedly, more noninvasive than invasive strains were positive for rrgC (P < 0.0001), and the proportion of rrgC-positive strains in 2008 to 2010 was greater than that in 2002 to 2008 (IPD, P < 0.02; noninvasive, P < 0.001). Serotypes 19F, 19A, and 35B were more frequently rrgC positive (P < 0.005) than other serotypes. A vaccine containing antigens, such as PspA, PspC, and/or RrgC, can provide coverage against most non-PCV13-type pneumococci. Continued surveillance is critical for optimal future vaccine development.
INTRODUCTION
Streptococcus pneumoniae is a major cause of morbidity and mortality worldwide due to pneumonia, bacteremia, and meningitis. Pneumococcal infections are estimated to cause 826,000 deaths globally in children <5 years of age (1) and result in billions of dollars in health care costs in the United States (2). Furthermore, it is estimated that 70 to 80% of severe pneumonia cases in Africa are caused by S. pneumoniae (3, 4) strains that are predominantly of capsular serotypes 1 and 5 (5). The introduction of the heptavalent pneumococcal conjugate vaccine (PCV7) has led to sufficient protection against colonization to almost completely eliminate invasive disease caused by the seven PCV capsular types (4, 6B, 9V, 14, 18C, 19F, and 23F), which caused the majority of invasive pneumococcal diseases (IPDs) prior to 2000. However, only a few years after the introduction of PCV7, serotype replacement (an increase in the incidence of IPD caused by non-PCV7 capsular types) was observed (6–10). In 2010, a new 13-valent vaccine was introduced in the United States to provide protection against the original PCV7 serotypes plus 6 additional capsular serotypes (1, 3, 5, 6A, 7F, and 19A) known to cause IPD. PCV13 has also been licensed for use against otitis media (11). Previous reports have shown that PCV13 protects against approximately 60 to 70% of all pneumococci globally postintroduction of the PCV7 (6, 12–14), and nonvaccine serotypes have been reported to cause serious diseases, such as meningitis (6, 8). The occurrence of serotype replacement only a few years following the introduction of PCV7 and the fact that there are >90 known capsular serotypes (15) raise concerns about the long-term usage of capsule-based vaccines.
One potential strategy to reduce serotype replacement is the inclusion of protein vaccine immunogens to provide protection that is not dependent on the antibody responses to capsular polysaccharides. Several candidate protein antigens exist, and previous studies have indicated that combinations of protein immunogens might provide a way to protect against a wider number of serotypes and diseases (16–19). The surface virulence proteins of pneumococci, in particular, are important nonpolysaccharide vaccine candidates. Pneumococcal surface protein A (PspA) is a protein on virtually all pneumococci (6, 20) and is important for the inhibition of the classical complement pathway, working specifically by competing with binding by C-reactive protein to block complement deposition (21). PspA elicits antibody-mediated protection against invasive infection through its alpha-helical regions. Moreover, the alpha-helical regions within, and frequently between, different PspA families are cross-reactive and cross-protective (22–26).
Another important surface protein is pneumococcal surface protein C (PspC; also known as CbpA), which has structural features similar to those of PspA and has been demonstrated to bind factor H, thus inhibiting the alternative pathway of complement deposition (27–30). PspC has also been shown to be important for adherence through its interaction with the polymeric Ig receptor (31, 32) and binding of secretory IgA (27). Mice immunized with PspC have been demonstrated to develop protective antibodies against pneumonia, sepsis, and colonization, and immunization with the PspC proline-rich region was found to be cross-protective against a pneumococcal strain lacking the pspC gene (33–37).
Pili were recently discovered in pneumococci (38–40). Pilus type 1, encoded by the rlaA islet, is an adhesin that binds to epithelial cells (41, 42). The major subunits, rrgA, rrgB, and rrgC, are all able to elicit active and passive protection (43), and rrgC is highly conserved among all serotypes of pneumococci with pilus type 1 (44, 45). Furthermore, for pneumococci that are piliated, immunity to pili has been shown to be protective against sepsis and colonization (43).
In this study, we present data on the capsular serotype distribution of pneumococci collected (n = 1,058) between 2002 and 2010 from noninvasive sites in pediatric patients. We also determined the gene frequencies of the pneumococcal protein-based vaccine candidates pspA, pspC, and rrgC (pilus type 1) in a subset of noninvasive isolates (this study) and previously characterized IPD isolates (6).
(This study was presented in part at the 7th Extraordinary International Symposium on Recent Advances in Otitis Media, June 2013, Stockholm, Sweden.)
MATERIALS AND METHODS
Data and patient selection.
All viable pneumococci from sequential routine clinical specimens submitted to the Clinical Microbiology Laboratory at Children's of Alabama in Birmingham, AL, between July 2002 and June 2010 were collected prospectively from patients aged 0 to 18 years old. The site of isolation, clinical disease diagnosis, date of culture, antimicrobial susceptibilities, and patient demographic data associated with each strain were retrieved from the electronic medical records under an approved protocol of the institutional review board of the University of Alabama at Birmingham with a waiver of informed consent. Noninvasive pneumococci for this study were defined as S. pneumoniae strains causing infection detected in ear, eye, nasopharynx, or tracheal aspirate specimens and in which no invasive (sterile site) isolates were collected from the same patient. Nasopharyngeal isolates were not collected as part of a screen for normal carriage flora but from surgical samples and patients being screened for pathogens in their nasopharynx as part of routine medical care. A total of 1,130 noninvasive strains were collected; 72 strains were excluded because they were duplicates of the same capsular type from the same patient, similar to another isolate from the same clinical episode, not viable, or the patient was >18 years old. The analyses included 1,058 noninvasive isolates and 157 IPD isolates characterized previously (6).
Multiplex assays for serotype detection.
The strains were typed serologically and/or by PCR for the 93 known pneumococcal capsular types. The strains were first subjected to a multiplex immunoassay with monoclonal antibodies that were specific for 26 serotypes as described by Yu et al. (46). Isolates that were not typeable by the multiplex immunoassay were further typed using a multiplex PCR assay for the remaining serotypes, which also included the detection of autolysin (lytA), two different primer sets for the detection of cpsA, and the nontypeable groups NCC2 and NCC3 (47) of S. pneumoniae. For analyses, strains were grouped according to whether their capsular serotype was included or not included as an antigen in: (i) the original heptavalent PCV (PCV7), (ii) the capsule antigens for the 7 serotypes in PCV7 plus six additional serotypes (PCV13), (iii) strains with capsule types not included in PCV13 but including isolates with typeable capsules (NVT), and (iv) those with nontypeable capsules (NT).
NT strains were confirmed to be from S. pneumoniae through testing for optochin sensitivity, bile solubility, and presence of the pneumolysin gene (ply) (Table 1) (48). Strains that were bile insoluble and not positive for ply were removed from analyses.
Table 1
| Primer name | Gene | Sequence (5′ to 3′) | Reference or source |
|---|---|---|---|
| LSM12 | pspA | CCGGATCCAGCGTCGCTATCTTAGGGGCTGGTT | 49 |
| SKH63 | pspA (family 1) | TTTCTGGCTCATYAACTGCTTTC | 49 |
| SKH52 | pspA (family 2) | TGGGGGTGGAGTTTCTTCTTCATCT | 49 |
| ABW13 | pspC fragment | CGACGAATAGCTGAAGAGG | 35 |
| SKH2 | pspC fragment | CCACATACCGTTTTCTTGTTTCCAGCC | 35 |
| pspC_gates1 | pspC full length | GAAAAAATATAGAAGGAAATAAAC | This study |
| pspC_gates2 | pspC full length | CAGTATTAACTAGTTATATTAGG | This study |
| C5 | rrgC | GCTCTGTGTTTTTCTCTTGTATGG | 45 |
| C3 | rrgC | ATCAATCCGTGGTCGCTTGTTATTTTTA | 45 |
| plyF | ply fragment | ATTTCTGTAACAGCTACCAACGA | 48 |
| plyR | ply fragment | GAATTCCCTGTCTTTTCAAAGTC | 48 |
Gene typing.
Gene typing was performed on all IPD isolates and a random sample of the noninvasive strains (strains selected by using the random number generator function on Microsoft Office Excel [Microsoft Redmond Campus, Redmond, WA]). Genomic DNA was prepared using a modified protocol with the Easy-DNA kit (Life Technologies, Carlsbad, CA). Briefly, the strains were streaked from frozen glycerol stock onto blood agar plates and incubated overnight in a candle jar in a 37°C incubator. The next day, the entire plate was swabbed into 3 ml of Todd-Hewitt medium with 5% yeast and grown for 4 to 6 h. DNA was then isolated according to the manufacturer's instructions, the concentration was determined by the NanoDrop 2000 (Thermo Scientific, Waltham, MA), and DNA was diluted to a final concentration of 100 ng/μl for further use.
Statistical analysis.
The statistical analyses between proportions of groups were performed using the χ2 test, the χ2 test for trend, or Fisher's exact test. Bonferroni's correction was applied when necessary. A P value of <0.05 was considered statistically significant.
To determine the probabilities of invasive disease potential in the serotypes, odds ratios (ORs) were calculated as (ad)/(bc), where a represents the number of invasive A serotypes, b represents the number of noninvasive A serotypes, c represents the number of invasive non-A serotypes, and d represents the number of noninvasive non-A serotypes or clones (51). An OR of >1 indicates increased invasive potential, whereas an OR of <1 indicates decreased invasive potential. An OR was considered statistically significant at a P value of <0.05. All tests were performed in GraphPad InStat version 5.0 (GraphPad, La Jolla, CA).
RESULTS
Patient demographics and serotype distribution of isolates from 2002 to 2010.
The population was 60% male, 63% Caucasian, and 14% African-American (data on race/ethnicity were missing for 18% of patients). Of 1,055 IPD isolates for which the patient age was available, 675 (64%) isolates were obtained from children <24 months of age, 282 (27%) isolates were from children aged 24 to 60 months, and 98 (9%) isolates were from children >60 months. In order to capture the seasonality of pneumococcal illness, the data were grouped by year, with the year being defined from July 1 through June 30. Thirty-three serotypes, including the nontypeable serotypes, were identified in the noninvasive strains. The PCV7 capsular types comprised approximately 29% of the noninvasive strains in 2002 and had virtually disappeared by 2010 (2002 to 2008 versus 2008 to 2010, P < 0.0001). There was no statistically significant difference between patient age and PCV13 versus non-PCV13 types (P = 0.3627, data not shown). The proportion of non-PCV13 capsular types also remained steady at approximately 50% from 2002 to 2010. A total of 21 different non-PCV13 capsular types were observed among the strains shown in Fig. 1. Serotype 19A was the predominant serotype isolated from noninvasive strains (32%), followed by 35B (9%), 19F (7%), and 6C (6%) (Table 2). The majority of the noninvasive isolates came from the ear (64%), and the serotype distribution of the noninvasive isolates varied depending on the site of isolation. However, this difference was not statistically significant (PCV13 versus non-PCV13 types, P = 0.3205). Compared with IPD serotype distribution, serotypes 14, 5, 7F, 12F/B, and 17F/A were found to have more invasive potential, whereas serotype 35B and NT strains were associated with lower invasiveness (Table 3).
Fig 1
Table 2
| PCV group and serotype | No. (%) of noninvasive strains from each isolation sitea | Total no. of strains (% of total) | ||||
|---|---|---|---|---|---|---|
| Ear | Eye | Np | Trach | Other | ||
| PCV7 | ||||||
| 19F | 49 (7.2) | 1 (1.2) | 8 (8.6) | 14 (8.3) | 3 (8.3) | 75 (7.1) |
| 6B | 3 (0.44) | 3 (3.6) | 6 (3.6) | 1 (2.8) | 13 (1.2) | |
| 23F | 4 (0.59) | 6 (3.6) | 2 (5.6) | 12 (1.1) | ||
| 9V | 1 (0.15) | 1 (1.2) | 2 (1.2) | 4 (0.38) | ||
| 18C | 2 (0.30) | 1 (1.1) | 3 (0.28) | |||
| 4 | 1 (0.15) | 1 (0.60) | 2 (0.19) | |||
| 14 | 2 (0.30) | 2 (0.19) | ||||
| PCV13 | ||||||
| 19A | 241 (35.6) | 24 (28.6) | 29 (31.2) | 34 (20.2) | 10 (27.8) | 338 (31.9) |
| 3 | 20 (3.0) | 3 (3.6) | 2 (2.2) | 4 (2.4) | 29 (2.7) | |
| 6A | 15 (2.2) | 3 (3.6) | 2 (2.2) | 5 (3.0) | 1 (2.8) | 26 (2.5) |
| 7F | 6 (0.89) | 1 (1.2) | 1 (1.1) | 1 (2.8) | 9 (0.85) | |
| 5 | 1 (1.2) | 1 (0.09) | ||||
| Non-PCV | ||||||
| NTb | 58 (8.6) | 12 (14.3) | 13 (14.0) | 24 (14.3) | 4 (11.1) | 111 (10.5) |
| 35B | 66 (9.7) | 11 (13.1) | 6 (6.5) | 12 (7.1) | 2 (5.6) | 97 (9.3) |
| 6C | 36 (5.3) | 5 (6.0) | 11 (11.8) | 12 (7.1) | 4 (11.1) | 68 (6.4) |
| 15B/C | 41 (6.1) | 2 (2.4) | 3 (3.2) | 9 (5.4) | 4 (11.1) | 59 (5.6) |
| 11A/D/F | 21 (3.1) | 5 (6.0) | 4 (4.3) | 8 (4.8) | 38 (3.6) | |
| 33F/A | 23 (3.4) | 1 (1.1) | 5 (3.0) | 29 (2.7) | ||
| 22F/A | 13 (1.9) | 4 (4.8) | 2 (2.2) | 7 (4.3) | 1 (2.8) | 27 (2.6) |
| 15A/F | 19 (2.8) | 1 (1.2) | 1 (1.1) | 2 (1.2) | 23 (2.2) | |
| 16 | 18 (2.7) | 2 (2.2) | 2 (1.2) | 22 (2.1) | ||
| 23B | 7 (1.0) | 2 (2.2) | 3 (1.8) | 12 (1.1) | ||
| 23A | 5 (0.74) | 2 (2.4) | 1 (1.1) | 1 (2.8) | 9 (0.85) | |
| 9N | 3 (0.44) | 1 (1.2) | 1 (1.1) | 3 (1.8) | 8 (0.76) | |
| 35F/47F | 4 (0.59) | 2 (2.4) | 1 (0.60) | 1 (2.8) | 8 (0.76) | |
| 7B/C/40 | 5 (0.74) | 2 (1.2) | 7 (0.66) | |||
| 17F/A | 4 (0.59) | 3 (1.8) | 7 (0.66) | |||
| 31 | 3 (0.44) | 2 (2.4) | 1 (0.60) | 6 (0.57) | ||
| 34 | 2 (0.30) | 1 (1.1) | 1 (0.60) | 4 (0.38) | ||
| 10A/39 | 1 (0.15) | 1 (0.60) | 1 (2.8) | 3 (0.28) | ||
| 21 | 2 (0.30) | 1 (1.1) | 3 (0.28) | |||
| 12F/B | 1 (0.15) | 1 (1.1) | 2 (0.19) | |||
| 11E | 1 (0.15) | 1 (0.09) | ||||
| Total | 677 (64) | 84 (7.9) | 93 (8.8) | 168 (15.9) | 36 (3.4) | 1,058 (100) |
a
Np, nasopharyngeal; Trach, tracheal aspirate; other, isolates from sinus tissue, nasal lacrimal duct, or mastoid.
b
NT, nontypeable (capsular serotype could not be determined).
Table 3
| PCV group and serotypea | No. of strains | No. of isolates by type | OR (95% CI)b | |
|---|---|---|---|---|
| IPD | Noninvasive | |||
| PCV7 | ||||
| 14 | 5 | 3 | 2 | 10.3 (1.7–62.1) |
| 4 | 3 | 1 | 2 | 3.4 (0.3–37.6) |
| 18C | 3 | 1 | 2 | 3.4 (0.3–37.6) |
| 9V | 5 | 1 | 4 | 1.7 (0.2–15.2) |
| 23F | 14 | 2 | 12 | 1.1 (0.2–5.1) |
| 6B | 15 | 2 | 13 | 1.0 (0.2–4.6) |
| 19F | 85 | 9 | 76 | 0.8 (0.4–1.6) |
| PCV13 | ||||
| 5 | 3 | 2 | 1 | 13.7 (1.2–151.5) |
| 7F | 22 | 13 | 9 | 10.5 (4.4–25.1) |
| 3 | 35 | 6 | 29 | 1.4 (0.6–3.5) |
| 19A | 389 | 51 | 338 | 1.0 (0.7–1.5) |
| 6A | 27 | 1 | 26 | 0.3 (0.03–1.9) |
| 1 | 3 | 3 | 0 | |
| Non-PCV | ||||
| 12F/B | 8 | 6 | 2 | 21.0 (4.2–105.0) |
| 11E | 2 | 1 | 1 | 6.8 (0.4–109.0) |
| 10A/39 | 5 | 2 | 3 | 4.5 (0.8–27.4) |
| 17F/A | 11 | 4 | 7 | 3.9 (1.1–13.6) |
| 23A | 13 | 4 | 9 | 3.0 (0.9–10.0) |
| 23B | 16 | 4 | 12 | 2.3 (0.7–7.2) |
| 22F/A | 33 | 6 | 27 | 1.5 (0.6–3.7) |
| 15B/C | 67 | 8 | 59 | 0.9 (0.4–1.9) |
| 9N | 9 | 1 | 8 | 0.8 (0.1–6.8) |
| 35F/47F | 9 | 1 | 8 | 0.8 (0.1–6.8) |
| 6C | 75 | 7 | 68 | 0.7 (0.3–1.5) |
| 15A/F | 25 | 2 | 23 | 0.6 (0.1–2.5) |
| 16F | 24 | 2 | 22 | 0.6 (0.1–2.6) |
| 33F/A | 31 | 2 | 29 | 0.5 (0.1–1.9) |
| 35B | 103 | 6 | 97 | 0.4 (0.2–0.9) |
| 11A/D/F | 39 | 1 | 38 | 0.2 (0.02–1.3) |
| NT | 115 | 4 | 111 | 0.2 (0.1–0.6) |
| 7B/C/40 | 7 | 0 | 7 | |
| 31 | 6 | 0 | 6 | |
| 34 | 4 | 0 | 4 | |
| 21 | 3 | 0 | 3 | |
| 13 | 1 | 1 | 0 | |
| Total | 1,215 | 157 | 1,058 | |
a
NT, nontypeable. Each serotype group is ordered by invasive potential.
b
OR, odds ratio; CI, confidence interval. An OR of >1 indicates increased invasive potential, whereas an OR of <1 indicates decreased invasive potential. ORs (95% CI) are considered statistically significant at a P value of <0.05 (shown in bold type).
Characterization of isolates for pspA, pspC, and rrgC alleles.
All the IPD isolates (n = 157) and a subset of the noninvasive isolates (n = 221) were selected for genetic characterization of pneumococcal protein candidate antigens PspA, PspC, and RrgC (pilus type 1). Eleven isolates (2 IPD, 9 noninvasive) were negative for all three genes. Although the pspA and pspC genes are highly mosaic (24, 52), the majority of isolates were pspA family 1 or 2 types (97%) and carried pspC alleles (81%), regardless of the disease group (Fig. 2). We also looked at the frequency of rrgC, a highly conserved gene in strains carrying pilus type 1 (44, 45). We found a high frequency of rrgC-positive isolates in both the IPD and noninvasive strains (46 and 67%, respectively). Furthermore, noninvasive isolates (67%) were significantly more likely to be rrgC positive than IPD strains (47%) (P < 0.0001). When we looked at how the strains changed from 2002 to 2008 versus 2008 to 2010, we saw a nonsignificant increase in pspA (family 1 or 2) in the noninvasive isolates and an increase in rrgC-positive strains in both the IPD and noninvasive groups (40% versus 60% for IPD strains, P = 0.02; 61% versus 84% for noninvasive strains, P < 0.001) (Fig. 3). The frequency of pspC remained constant at 81%. Lastly, no association was seen between pspA or pspC positivity and serotype (Table 4). Although the PCV13 types were significantly more likely to be rrgC positive than the NVT strains (P < 0.001), 50% of the NVT strains were rrgC positive overall (Fig. 4). Three serotypes, 19F, 19A, and 35B, were significantly associated with being rrgC positive (78, 95, and 100%, respectively; P < 0.005).
Fig 2
Fig 3
Table 4
| Serotypea | No. (%) of strains with genes by disease group | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| IPD | Noninvasive | |||||||||
| In the presence of: | Total for serotype | In the presence of: | Total for serotype | |||||||
| pspA family | pspC | rrgC | pspA family | pspC | rrgC | |||||
| 1 | 2 | 1 | 2 | |||||||
| 4 | 1 (100) | 1 (100) | 1 (100) | 1 | ||||||
| 6B | 2 (100) | 2 (100) | 1 (50) | 2 | 2 (100) | 2 (100) | 2 (100) | 2 | ||
| 9V | 1 (100) | 1 (100) | 1 (100) | 1 | ||||||
| 14 | 1 (33) | 2 (67) | 3 (100) | 3 | ||||||
| 18C | 1 (100) | 1 (100) | 1 | |||||||
| 19F | 1 (11) | 8 (89) | 7 (78) | 9 (100) | 9 | 2 (20) | 8 (80) | 10 (100) | 9 (90) | 10 |
| 23F | 2 (100) | 2 (100) | 1 (50) | 2 | 2 (100) | 1 (50) | 1 (50) | 2 | ||
| 1 | 3 (100) | 3 (100) | 1 (33) | 3 | ||||||
| 3 | 2 (33) | 4 (67) | 4 (67) | 2 (33) | 6 | 1 (50) | 1 (50) | 1 (50) | 1 (50) | 2 |
| 5 | 2 (100) | 2 (100) | 1 (50) | 2 | ||||||
| 6A | 1 (100) | 1 (100) | 1 | 2 (67) | 1 (33) | 2 (67) | 2 (67) | 3 | ||
| 7Fb | 1 (8) | 11 (85) | 13 (100) | 2 (15) | 13 | |||||
| 19Ab | 17 (33) | 33 (65) | 44 (86) | 37 (73) | 51 | 20 (36) | 36 (64) | 55 (98) | 46 (82) | 56 |
| 6C | 7 (100) | 5 (71) | 2 (29) | 7 | 12 (100) | 11 (92) | 9 (75) | 12 | ||
| 9N | 1 (100) | 1 (100) | 1 | |||||||
| 10A/39 | 2 (100) | 2 (100) | 2 | 1 (100) | 1 (100) | 1 (100) | 1 | |||
| 11A/D/F | 1 (100) | 1 | 1 (17) | 5 (83) | 4 (67) | 4 (67) | 6 | |||
| 11E | 1 (100) | 1 (100) | 1 | |||||||
| 12F/B | 6 (100) | 5 (83) | 1 (17) | 6 | 1 (100) | 1 (100) | 1 (100) | 1 | ||
| 13 | 1 (100) | 1 (100) | 1 | |||||||
| 15A/F | 2 (100) | 1 (50) | 2 | 1 (17) | 5 (83) | 3 (50) | 2 (33) | 6 | ||
| 15B/C | 2 (25) | 6 (75) | 6 (75) | 1 (12.5) | 8 | 10 (100) | 9 (90) | 7 (70) | 10 | |
| 16F | 1 (50) | 1 (50) | 2 (100) | 2 | 2 (40) | 3 (60) | 5 (100) | 4 (80) | 5 | |
| 17F/A | 4 (100) | 3 (75) | 1 (25) | 4 | 1 (100) | 1 (100) | 1 (100) | 1 | ||
| 21 | 1 (100) | 1 (100) | 1 | |||||||
| 22F/Ab | 6 (100) | 3 (50) | 1 (17) | 6 | 2 (50) | 1 (25) | 2 (50) | 1 (25) | 4 | |
| 23A | 4 (100) | 4 (100) | 2 (50) | 4 | 1 (100) | 1 (100) | 1 | |||
| 23B | 2 (50) | 2 (50) | 3 (75) | 1 (25) | 4 | 1 (33) | 2 (67) | 1 (33) | 2 (67) | 3 |
| 31 | 2 (100) | 2 (100) | 1 (50) | 2 | ||||||
| 33F/A | 2 (100) | 2 (100) | 2 | 4 (80) | 1 (20) | 5 (100) | 1 (20) | 5 | ||
| 35B | 6 (100) | 5 (83) | 6 (100) | 6 | 19 (100) | 15 (79) | 19 (100) | 19 | ||
| 35F/47F | 1 (100) | 1 | 4 (100) | 2 (50) | 1 (25) | 4 | ||||
| NTb | 1 (25) | 1 (25) | 4 | 12 (18) | 45 (69) | 45 (69) | 34 (52) | 65 | ||
| Total | 60 (38) | 92 (59) | 127 (81) | 73 (46) | 157 | 66 (30) | 146 (66) | 180 (81) | 149 (67) | 221 |
a
NT, nontypeable.
b
These serotypes had 1 strain that was nontypeable for pspA. NT isolates had >1 strain that was nontypeable for pspA.
Fig 4
DISCUSSION
In this study, we report the capsular serotype distribution and gene frequencies of specific pneumococcal virulent proteins collected from 2002 to 2010 in noninvasive and IPD isolates to estimate the potential coverage of the PCV13. In our collection of 1,058 noninvasive strains, only 50% of all strains were PCV13 types. This was consistent from year to year, regardless of the site of isolation (data not shown). Twenty-one capsular serotypes were not covered by the PCV13, and this raises the possibility that some of them will evolve over time to become major replacement strains. Because of this, serotype replacement seems very likely considering the number of different capsular types that will have the chance to acquire the needed genes to effectively replace the PCV strains. Preclinical trials are in progress for a new conjugate vaccine, the PCV15 (53), but it will still lack coverage for 21 capsular types presently found in Alabama children and adolescents, some of which are considered to have high invasive potential (Table 3, 17F/A and 12F/B).
To this end, we also characterized the gene frequencies of several pneumococcal virulence factors, pspA, pspC, and rrgC, to determine the potential coverage of their proteins. While previous studies have looked at pspA frequencies (54–58), those studies were focused on pre-PCV7 strains, which are no longer representative of the serotypes currently isolated in the United States, or strains from nonpediatric populations (49). In a recent report, we showed that IPD strains collected in Alabama from 2002 to 2010 were of pspA family 1 or family 2 in 96% of cases (6). Since the majority of strains collected from patients over the same period were not from invasive sites, it was important to look at this larger group of strains since it was possible that they might provide a window into strains that cause IPD in the future. Moreover, not much is known about the epidemiology of noninvasive strains. We found that almost all noninvasive pneumococci tested contained pspA family 1 or 2 alleles (∼97%, n = 221), with pspA family 2 being the more common allele. Moreover, these distributions closely reflected that seen within the IPD collection. We also looked at the frequency of pspC. Similar to PspA, PspC is also highly variable (52); however, in our collection of strains, we found that 81% of all pneumococci were positive for pspC, regardless of the disease or S. pneumoniae serotype.
We also looked at the frequency of rrgC, a highly conserved subunit of pilus type 1 (44, 45). We found that the noninvasive isolates were significantly more likely to be rrgC positive (P < 0.0001). This makes sense because pili act as adhesins, binding to epithelial cells (41, 42). Although pili may be important for colonization, 46% of IPD isolates were rrgC positive. We also saw an association between rrgC and serotype, similar to previously reported data (44, 45, 59) where PCV13 vaccine types were more likely to be rrgC positive (P < 0.001). In our collection, serotypes 19A, 19F, and 35B in particular were highly rrgC positive (P < 0.005). However, contrary to the previous studies, we saw a significant increase in rrgC-positive strains during the period of 2008 to 2010 compared to the period from 2002 to 2008 (Fig. 3). Since many of the original PCV7 strains express rrgC, it is possible that noninvasive non-PCV7 strains with rrgC are favored by selection because they can better fill the old PCV7 niche.
This study has some limitations, in that we only looked at isolates from a single geographic region and a random sampling of noninvasive strains for the presence of genes for protein virulence factors. However, this random sample represents the overall serotype distribution very well, and the gene frequencies were similar to those of the IPD isolates. Another limitation is that we report gene frequencies and do not know whether the associated proteins are produced and/or functional in these pneumococci.
In conclusion, the serotype and gene-type distributions were remarkably similar for IPD and noninvasive strains from pediatric patients. Our Alabama strain collection contained 21 non-PCV13 serotypes that may evolve to fill the niche left following PCV usage. More importantly, these serotypes have been shown to cause life-threatening meningitis and endocarditis (6, 8). Based on our collection of isolates, the virulence proteins PspA, PspC, and RrgC have the potential to cover a wider number of strains than the PCV13 and PCV15 vaccines, although the efficacy of these proteins as vaccines in humans is still not known. The inclusion of additional proteins with PspA may not add coverage but may provide greater protective efficacy, since previous studies in mice have shown higher vaccine efficacy with mixtures of protein antigens rather than single proteins.
ACKNOWLEDGMENTS
We are very grateful for the Clinical Microbiology Laboratory at Children's of Alabama for all of their assistance with this project. We also thank Janice King, Evida Dennis, and Sarah Griffin for maintenance of the strain collection, Susan K. Hollingshead for the creation of pspC_gates primers, Pat Coan for technical assistance and support with genotyping, and Jigui Yu for technical assistance and support with serotyping.
This work was supported by grants AI-021458 (to D.E.B.) and AI-30021 (to M.H.N.) from the National Institute of Allergy and Infectious Diseases, P30 DK072482 (to M.J.C.) from the National Institute of Diabetes and Digestive and Kidney Diseases, R01 DC006452 (to S.K.J.) from the National Institute of Deafness and other Communicable Disorders, 5TL1 RR025775-04 (to C.M.C.) from the National Center for Research Resources, and the Howard Hughes Medical Institute through the Med into Grad Initiative (to C.M.C.) to the University of Alabama at Birmingham.
The contents of this paper are solely the responsibility of the authors and do not represent the views of the HHMI, NIAID, NIDDK, NCRR, NIDCD, or NIH.
D.E.B. is a consultant for Sanofi Pasteur and the PATH Foundation. The University of Alabama at Birmingham (UAB) holds intellectual property rights related to protein vaccine antigens, including PspA, and D.E.B. is an inventor on the relevant patents. UAB also holds the intellectual property rights for monoclonal antibodies used in this study. C.M.C., M.H.N., D.E.B., and M.J.C. are employees of the UAB.
REFERENCES
1.
O'Brien KL, Wolfson LJ, Watt JP, Henkle E, Deloria-Knoll M, McCall N, Lee E, Mulholland K, Levine OS, and Cherian T. 2009. Burden of disease caused by Streptococcus pneumoniae in children younger than 5 years: global estimates. Lancet 374:893–902.
2.
O'Brien MA, Prosser LA, Paradise JL, Ray GT, Kulldorff M, Kurs-Lasky M, Hinrichsen VL, Mehta J, Colborn DK, and Lieu TA. 2009. New vaccines against otitis media: projected benefits and cost-effectiveness. Pediatrics 123:1452–1463.
3.
Adegbola RA, Falade AG, Sam BE, Aidoo M, Baldeh I, Hazlett D, Whittle H, Greenwood BM, and Mulholland EK. 1994. The etiology of pneumonia in malnourished and well-nourished Gambian children. Pediatr. Infect. Dis. J. 13:975–982.
4.
Ikeogu MO. 1988. Acute pneumonia in Zimbabwe: bacterial isolates by lung aspiration. Arch. Dis. Child. 63:1266–1267.
5.
Wasas A, Huebner R, and Klugman KP. 1998. Trends in serotypes/groups of pneumococci and pneumococcal diseases in South Africa, p 22. Proceedings of the 1st International Symposium on Pneumococci and Pneumococcal Diseases. Statens Serum Institute, Copenhagen, Denmark.
6.
Croney CM, Coats MT, Nahm MH, Briles DE, and Crain MJ. 2012. PspA family distribution, unlike capsular serotype, remains unaltered following introduction of the heptavalent pneumococcal conjugate vaccine. Clin. Vaccine Immunol. 19:891–896.
7.
Hicks LA, Harrison LH, Flannery B, Hadler JL, Schaffner W, Craig AS, Jackson D, Thomas A, Beall B, Lynfield R, Reingold A, Farley MM, and Whitney CG. 2007. Incidence of pneumococcal disease due to non-pneumococcal conjugate vaccine (PCV7) serotypes in the United States during the era of widespread PCV7 vaccination, 1998–2004. J. Infect. Dis. 196:1346–1354.
8.
Hsu HE, Shutt KA, Moore MR, Beall BW, Bennett NM, Craig AS, Farley MM, Jorgensen JH, Lexau CA, Petit S, Reingold A, Schaffner W, Thomas A, Whitney CG, and Harrison LH. 2009. Effect of pneumococcal conjugate vaccine on pneumococcal meningitis. N. Engl. J. Med. 360:244–256.
9.
Kyaw MH, Lynfield R, Schaffner W, Craig AS, Hadler J, Reingold A, Thomas AR, Harrison LH, Bennett NM, Farley MM, Facklam RR, Jorgensen JH, Besser J, Zell ER, Schuchat A, Whitney CG, and Active Bacterial Core Surveillance of the Emerging Infections Program Network. 2006. Effect of introduction of the pneumococcal conjugate vaccine on drug-resistant Streptococcus pneumoniae. N. Engl. J. Med. 354:1455–1463.
10.
Singleton RJ, Hennessy TW, Bulkow LR, Hammitt LL, Zulz T, Hurlburt DA, Butler JC, Rudolph K, and Parkinson A. 2007. Invasive pneumococcal disease caused by nonvaccine serotypes among Alaska native children with high levels of 7-valent pneumococcal conjugate vaccine coverage. JAMA 297:1784–1792.
11.
Nuorti JP and Whitney CG. 2010. Prevention of pneumococcal disease among infants and children—use of 13-valent pneumococcal conjugate vaccine and 23-valent pneumococcal polysaccharide vaccine: recommendations of the Advisory Committee on Immunization Practices (ACIP). MMWR Recommend. Rep. 59(RR11):1–18.
12.
Pilishvili T, Lexau C, Farley MM, Hadler J, Harrison LH, Bennett NM, Reingold A, Thomas A, Schaffner W, Craig AS, Smith PJ, Beall BW, Whitney CG, Moore MR, and Active Core Bacterial Surveillance/Emerging Infections Program Network. 2010. Sustained reductions in invasive pneumococcal disease in the era of conjugate vaccine. J. Infect. Dis. 201:32–41.
13.
Jauneikaite E, Jefferies JM, Hibberd ML, and Clarke SC. 2012. Prevalence of Streptococcus pneumoniae serotypes causing invasive and non-invasive disease in South East Asia: a review. Vaccine 30:3503–3514.
14.
Adetifa IM, Antonio M, Okoromah CA, Ebruke C, Inem V, Nsekpong D, Bojang A, and Adegbola RA. 2012. Pre-vaccination nasopharyngeal pneumococcal carriage in a Nigerian population: epidemiology and population biology. PLoS One 7:e30548.
15.
Calix JJ, Porambo RJ, Brady AM, Larson TR, Yother J, Abeygunwardana C, and Nahm MH. 2012. Biochemical, genetic, and serological characterization of two capsule subtypes among Streptococcus pneumoniae serotype 20 strains: discovery of a new pneumococcal serotype. J. Biol. Chem. 287:27885–27894.
16.
Ogunniyi AD, Folland RL, Briles DB, Hollingshead SK, and Paton JC. 2000. Immunization of mice with combinations of pneumococcal virulence proteins elicits enhanced protection against challenge with Streptococcus pneumoniae. Infect. Immun. 68:3028–3033.
17.
Briles DE, Swiatlo E, and Edwards K. 2000. Vaccine strategies for Streptococcus pneumoniae, p 419–433. In Stevens DL and Kaplan EL (ed), Streptococcal infections. Oxford, New York, NY.
18.
Briles DE, Hollingshead SK, Crain MJ, Ren B, Watt J, and Johnston J. 2003. Pneumococcal proteins that may constitute the next generation vaccine for pneumococcal disease, p27–31. In Current topics on tonsils and mucosal barriers of upper airways. Proceedings of the 5th International Symposium on Tonsils and Mucosal Barriers of Upper Airways. Elsevier, Amsterdam, the Netherlands.
19.
Tai SS. 2006. Streptococcus pneumoniae protein vaccine candidates: properties, activities and animal studies. Crit. Rev. Microbiol. 32:139–153.
20.
Crain MJ, Waltman WD Jr, Turner JS, Yother J, Talkington DF, McDaniel LS, Gray BM, and Briles DE. 1990. Pneumococcal surface protein A (PspA) is serologically highly variable and is expressed by all clinically important capsular serotypes of Streptococcus pneumoniae. Infect. Immun. 58:3293–3299.
21.
Mukerji R, Mirza S, Roche AM, Widener RW, Croney CM, Rhee DK, Weiser JN, Szalai AJ, and Briles DE. 2012. Pneumococcal surface protein A inhibits complement deposition on the pneumococcal surface by competing with the binding of C-reactive protein to cell-surface phosphocholine. J. Immunol. 189:5327–5335.
22.
Briles DE, Hollingshead S, Brooks-Walter A, Nabors GS, Ferguson L, Schilling M, Gravenstein S, Braun P, King J, and Swift A. 2000. The potential to use PspA and other pneumococcal proteins to elicit protection against pneumococcal infection. Vaccine 18:1707–1711.
23.
Briles DE, Hollingshead SK, King J, Swift A, Braun PA, Park MK, Ferguson LM, Nahm MH, and Nabors GS. 2000. Immunization of humans with recombinant pneumococcal surface protein A (rPspA) elicits antibodies, which passively protect mice from fatal infection with Streptococcus pneumoniae bearing heterologous PspA. J. Infect. Dis. 182:1694–1701.
24.
Hollingshead SK, Becker RS, and Briles DE. 2000. Diversity of PspA: mosaic genes and evidence for past recombination in Streptococcus pneumoniae. Infect. Immun. 68:5889–5900.
25.
Nabors GS, Braun PA, Herrmann DJ, Heise ML, Pyle DJ, Gravenstein S, Schilling M, Ferguson LM, Hollingshead SK, Briles DE, and Becker RS. 2000. Immunization of healthy adults with a single recombinant pneumococcal surface protein A (PspA) variant stimulates broadly cross-reactive antibodies to heterologous PspA molecules. Vaccine 18:1743–1754.
26.
Roche H, Ren B, McDaniel LS, Håkansson A, and Briles DE. 2003. Relative roles of genetic background and variation in PspA in the ability of antibodies to PspA to protect against capsular type 3 and 4 strains of Streptococcus pneumoniae. Infect. Immun. 71:4498–4505.
27.
Dave S, Carmicle S, Hammerschmidt S, Pangburn MK, and McDaniel LS. 2004. Dual roles of PspC, a surface protein of Streptococcus pneumoniae, in binding human secretory IgA and factor H. J. Immunol. 173:471–477.
28.
Dave S, Brooks-Walter A, Pangburn MK, and McDaniel LS. 2001. PspC, a pneumococcal surface protein, binds human factor H. Infect. Immun. 69:3435–3437.
29.
Duthy TG, Ormsby RJ, Giannakis E, Ogunniyi AD, Stroeher UH, Paton JC, and Gordon DL. 2002. The human complement regulator factor H binds pneumococcal surface protein PspC via short consensus repeats 13 to 15. Infect. Immun. 70:5604–5611.
30.
Jarva H, Janulczyk R, Hellwage J, Zipfel PF, Björck L, and Meri S. 2002. Streptococcus pneumoniae evades complement attack and opsonophagocytosis by expressing the pspC locus-encoded Hic protein that binds to short consensus repeats 8–11 of factor H. J. Immunol. 168:1886–1894.
31.
Hammerschmidt S, Tillig MP, Wolff S, Vaerman JP, and Chhatwal GS. 2000. Species-specific binding of human secretory component to SpsA protein of Streptococcus pneumoniae via a hexapeptide motif. Mol. Microbiol. 36:726–736.
32.
Zhang JR, Mostov KE, Lamm ME, Nanno M, Shimida S, Ohwaki M, and Tuomanen E. 2000. The polymeric immunoglobulin receptor translocates pneumococci across human nasopharyngeal epithelial cells. Cell 102:827–837.
33.
Ogunniyi AD, Woodrow MC, Poolman JT, and Paton JC. 2001. Protection against Streptococcus pneumoniae elicited by immunization with pneumolysin and CbpA. Infect. Immun. 69:5997–6003.
34.
Ogunniyi AD, Grabowicz M, Briles DE, Cook J, and Paton JC. 2007. Development of a vaccine against invasive pneumococcal disease based on combinations of virulence proteins of Streptococcus pneumoniae. Infect. Immun. 75:350–357.
35.
Brooks-Walter A, Briles DE, and Hollingshead SK. 1999. The pspC gene of Streptococcus pneumoniae encodes a polymorphic protein, PspC, which elicits cross-reactive antibodies to PspA and provides immunity to pneumococcal bacteremia. Infect. Immun. 67:6533–6542.
36.
Balachandran P, Brooks-Walter A, Virolainen-Julkunen A, Hollingshead SK, and Briles DE. 2002. Role of pneumococcal surface protein C in nasopharyngeal carriage and pneumonia and its ability to elicit protection against carriage of Streptococcus pneumoniae. Infect. Immun. 70:2526–2534.
37.
Rosenow C, Ryan P, Weiser JN, Johnson S, Fontan P, Ortqvist A, and Masure HR. 1997. Contribution of novel choline-binding proteins to adherence, colonization and immunogenicity of Streptococcus pneumoniae. Mol. Microbiol. 25:819–829.
38.
Hava DL and Camilli A. 2002. Large-scale identification of serotype 4 Streptococcus pneumoniae virulence factors. Mol. Microbiol. 45:1389–1406.
39.
Hava DL, Hemsley CJ, and Camilli A. 2003. Transcriptional regulation in the Streptococcus pneumoniae rlrA pathogenicity islet by RlrA. J. Bacteriol. 185:413–421.
40.
LeMieux J, Hava DL, Basset A, and Camilli A. 2006. RrgA and RrgB are components of a multisubunit pilus encoded by the Streptococcus pneumoniae rlrA pathogenicity islet. Infect. Immun. 74:2453–2456.
41.
Barocchi MA, Ries J, Zogaj X, Hemsley C, Albiger B, Kanth A, Dahlberg S, Fernebro J, Moschioni M, Masignani V, Hultenby K, Taddei AR, Beiter K, Wartha F, von Euler A, Covacci A, Holden DW, Normark S, Rappuoli R, and Henriques-Normark B. 2006. A pneumococcal pilus influences virulence and host inflammatory responses. Proc. Natl. Acad. Sci. U. S. A. 103:2857–2862.
42.
Nelson AL, Ries J, Bagnoli F, Dahlberg S, Fälker S, Rounioja S, Tschöp J, Morfeldt E, Ferlenghi I, Hilleringmann M, Holden DW, Rappuoli R, Normark S, Barocchi MA, and Henriques-Normark B. 2007. RrgA is a pilus-associated adhesin in Streptococcus pneumoniae. Mol. Microbiol. 66:329–340.
43.
Gianfaldoni C, Censini S, Hilleringmann M, Moschioni M, Facciotti C, Pansegrau W, Masignani V, Covacci A, Rappuoli R, Barocchi MA, and Ruggiero P. 2007. Streptococcus pneumoniae pilus subunits protect mice against lethal challenge. Infect. Immun. 75:1059–1062.
44.
Moschioni M, Donati C, Muzzi A, Masignani V, Censini S, Hanage WP, Bishop CJ, Reis JN, Normark S, Henriques-Normark B, Covacci A, Rappuoli R, and Barocchi MA. 2008. Streptococcus pneumoniae contains 3 rlrA pilus variants that are clonally related. J. Infect. Dis. 197:888–896.
45.
Regev-Yochay G, Hanage WP, Trzcinski K, Rifas-Shiman SL, Lee G, Bessolo A, Huang SS, Pelton SI, McAdam AJ, Finkelstein JA, Lipsitch M, and Malley R. 2010. Re-emergence of the type 1 pilus among Streptococcus pneumoniae isolates in Massachusetts, USA. Vaccine 28:4842–4846.
46.
Yu J, Lin J, Kim KH, Benjamin WH Jr, and Nahm MH. 2011. Development of an automated and multiplexed serotyping assay for Streptococcus pneumoniae. Clin. Vaccine Immunol. 18:1900–1907.
47.
Park IH, Kim KH, Andrade AL, Briles DE, McDaniel LS, and Nahm MH. 2012. Nontypeable pneumococci can be divided into multiple cps types, including one type expressing the novel gene pspK. mBio 3:e00035–12.
48.
Salo P, Ortqvist A, and Leinonen M. 1995. Diagnosis of bacteremic pneumococcal pneumonia by amplification of pneumolysin gene fragments in serum. J. Infect. Dis. 171:479–482.
49.
Hollingshead SK, Baril L, Ferro S, King J, Coan P, Briles DE, and Pneumococcal Proteins Epi Study Group. 2006. Pneumococcal surface protein A (PspA) family distribution among clinical isolates from adults over 50 years of age collected in seven countries. J. Med. Microbiol. 55:215–221.
50.
Brooks-Walter A, Tart RC, Briles DE, and Hollingshead SK. 1997. The pspC gene encodes a second pneumococcal surface protein homologous to the gene encoding the protection-eliciting PspA protein of Streptococcus pneumoniae, p 35. Abstr. 97th Gen. Meet. Am. Soc. Microbiol. American Society for Microbiology, Washington, DC.
51.
Smith T, Lehmann D, Montgomery J, Gratten M, Riley ID, and Alpers MP. 1993. Acquisition and invasiveness of different serotypes of Streptococcus pneumoniae in young children. Epidemiol. Infect. 111:27–39.
52.
Iannelli F, Oggioni MR, and Pozzi G. 2002. Allelic variation in the highly polymorphic locus pspC of Streptococcus pneumoniae. Gene 284:63–71.
53.
Skinner JM, Indrawati L, Cannon J, Blue J, Winters M, Macnair J, Pujar N, Manger W, Zhang Y, Antonello J, Shiver J, Caulfield M, and Heinrichs JH. 2011. Pre-clinical evaluation of a 15-valent pneumococcal conjugate vaccine (PCV15-CRM197) in an infant-rhesus monkey immunogenicity model. Vaccine 29:8870–8876.
54.
Coral MCV, Fonseca N, Castañeda E, Di Fabio JL, Hollingshead SK, and Briles DE. 2001. Pneumococcal surface protein A of invasive Streptococcus pneumoniae isolates from Colombian children. Emerg. Infect. Dis. 7:832–836.
55.
Mollerach M, Regueira M, Bonofiglio L, Callejo R, Pace J, Di Fabio JL, Hollingshead S, Briles D, and Streptococcus pneumoniae Working Group. 2004. Invasive Streptococcus pneumoniae isolates from Argentinian children: serotypes, families of pneumococcal surface protein A (PspA) and genetic diversity. Epidemiol. Infect. 132:177–184.
56.
Hotomi M, Togawa A, Kono M, Ikeda Y, Takei S, Hollingshead SK, Briles DE, Suzuki K, and Yamanaka N. 2013. PspA family distribution, antimicrobial resistance and serotype of Streptococcus pneumoniae isolated from upper respiratory tract infections in Japan. PLoS One 8:e58124.
57.
Melin MM, Hollingshead SK, Briles DE, Hanage WP, Lahdenkari M, Kaijalainen T, Kilpi TM, and Käyhty HM. 2008. Distribution of pneumococcal surface protein A families 1 and 2 among Streptococcus pneumoniae isolates from children in Finland who had acute otitis media or were nasopharyngeal carriers. Clin. Vaccine Immunol. 15:1555–1563.
58.
Hollingshead SK, Bessen D, and Briles DE. 1998. Archaeological footprints of horizontal gene transfer: mosaic cell surface proteins in Streptococcus pyogenes and Streptococcus pneumoniae, p 192–207. In Syvanen M and Kado C (ed), Horizontal gene transfer: implications and consequences. Chapman and Hall, London, United Kingdom.
59.
Basset A, Trzcinski K, Hermos C, O'Brien KL, Reid R, Santosham M, McAdam AJ, Lipsitch M, and Malley R. 2007. Association of the pneumococcal pilus with certain capsular serotypes but not with increased virulence. J. Clin. Microbiol. 45:1684–1689.
Information & Contributors
Information
Published In
Clinical and Vaccine Immunology
Volume 20 • Number 11 • November 2013
Pages: 1711 - 1718
PubMed: 24006139
Copyright
© 2013 American Society for Microbiology.
History
Received: 28 May 2013
Returned for modification: 12 July 2013
Accepted: 29 August 2013
Published online: 25 October 2013
Contributors
Metrics & Citations
Metrics
Note:
- For recently published articles, the TOTAL download count will appear as zero until a new month starts.
- There is a 3- to 4-day delay in article usage, so article usage will not appear immediately after publication.
- Citation counts come from the Crossref Cited by service.
Citations
Citation
2013.
Invasive and Noninvasive Streptococcus pneumoniae Capsule and Surface Protein Diversity following the Use of a Conjugate Vaccine. Clin Vaccine Immunol
20:.
If you have the appropriate software installed, you can download article citation data to the citation manager of your choice. For an editable text file, please select Medlars format which will download as a .txt file. Simply select your manager software from the list below and click Download.