Free access
Research Article
1 March 2003

A Real-Time PCR Assay for the Detection of Campylobacter jejuni in Foods after Enrichment Culture


A real-time PCR assay was developed for the quantitative detection of Campylobacter jejuni in foods after enrichment culture. The specificity of the assay for C. jejuni was demonstrated with a diverse range of Campylobacter species, related organisms, and unrelated genera. The assay had a linear range of quantification over six orders of magnitude, and the limit of detection was approximately 12 genome equivalents. The assay was used to detect C. jejuni in both naturally and artificially contaminated food samples. Ninety-seven foods, including raw poultry meat, offal, raw shellfish, and milk samples, were enriched in blood-free Campylobacter enrichment broth at 37°C for 24 h, followed by 42°C for 24 h. Enrichment cultures were subcultured to Campylobacter charcoal-cefoperazone-deoxycholate blood-free selective agar, and presumptive Campylobacter isolates were identified with phenotypic methods. DNA was extracted from enrichment cultures with a rapid lysis method and used as the template in the real-time PCR assay. A total of 66 samples were positive for C. jejuni by either method, with 57 samples positive for C. jejuni by subculture to selective agar medium and 63 samples positive in the real-time PCR assay. The results of both methods were concordant for 84 of the samples. The total time taken for detection from enrichment broth samples was approximately 3 h for the real-time PCR assay, with the results being available immediately at the end of PCR cycling, compared to 48 h for subculture to selective agar. This assay significantly reduces the total time taken for the detection of C. jejuni in foods and is an important model for other food-borne pathogens.
Campylobacter jejuni is the most common cause of acute bacterial gastroenteritis in the United Kingdom and the rest of the developed world (33). A recent study from the United States concluded that gastrointestinal infection with C. jejuni causes significant morbidity and mortality, with the estimated number of cases a year exceeding 2 million and the numbers of deaths attributed to infection being estimated at greater than 2,000 (21). The majority of infections are sporadic, and the sources of infection are rarely determined (7). Outbreaks occur infrequently (28), but a number of vehicles, including untreated milk (9) and untreated water (2), have been demonstrated to be responsible for large outbreaks of gastroenteritis. C. jejuni is found in the normal gastrointestinal flora of poultry, swine, and cattle, and the epidemiological evidence suggests that these may be reservoirs for strains infecting humans (13).
Conventional methods for the isolation and identification of campylobacters from food products require enrichment culture for up to 48 h and subculture to selective agar followed by phenotypic identification; this method takes up to 5 days in total to obtain a result (6). The PCR is a rapid and specific nucleic acid amplification method for the detection of food-borne pathogens, and a number of PCR assays have been described for the detection of campylobacters in foods (8, 11, 12, 23, 27, 34, 35). However, complex sample preparation methods and the use of gel electrophoresis endpoint detection methods that require manipulation of the amplification products after PCR cycling have hampered the transition of these methods from research to routine use in food microbiology laboratories.
The adaptation of PCR assays into a solution hybridization colorimetric endpoint detection format (PCR enzyme-linked immunosorbent assay [ELISA]) allows the specific and sensitive detection of PCR amplification products (16, 27, 32). Although this can increase the number of samples that can be tested, manipulation of the PCR products after thermal cycling is still required.
Quantitative PCR methods with endpoint detection which utilize internal or external controls of known concentrations which are amplified in parallel with the samples of interest have been described. After PCR cycling, the unknown test samples are compared to the controls, and a quantitative value is assigned to the test samples (31). Because the final amount of accumulated product at the end of the PCR process is very susceptible to minor variations in reagents and sample matrices, there are limitations on the accuracy of quantitative PCR methods based on endpoint detection (30).
The TaqMan 5′ nuclease PCR method detects the accumulation of PCR product during the amplification reaction via the hybridization and cleavage of a fluorogenically labeled probe (17). The method removes the need to manipulate the PCR products after amplification, reducing the risk of false-positive results through cross-contamination between amplification products and subsequent test samples. Cleavage of the probe leads to an increase in fluorescence, which is directly proportional to the accumulation of specific PCR product. With the ABI Prism 7700 sequence detection system, the increase in fluorescence can be monitored in real time, which allows accurate quantification over six orders of magnitude of the DNA or RNA target sequence (10). Reactions are quantified by the point in time during cycling when amplification is detected rather than by the amount of PCR product accumulated after a fixed number of cycles.
Two 5′ nuclease (TaqMan) assays for the detection of C. jejuni have been described. Wilson and colleagues (36) described an assay for the detection of ciprofloxacin-resistant strains of C. jejuni, and Nogva and colleagues (25) described a quantitative assay for the detection of C. jejuni, but they did not validate the assay for the detection of C. jejuni in naturally contaminated food samples. Jackson and colleagues previously reported a PCR assay for the detection and identification of C. jejuni, C. coli, and C. upsaliensis which targeted a 256-bp region of an open reading frame adjacent to and downstream from a novel two-component regulatory gene (12).
The aim of this study was to develop a real-time PCR assay with the 5′ nuclease system to target the open reading frame (ORF) C sequence specific for C. jejuni. The specificity and sensitivity for the detection and quantification of C. jejuni in naturally contaminated foods after 48 h of enrichment culture were investigated, and the results were compared with those of subculture to a selective agar medium.


Media, bacterial isolates, and culture conditions.

Maximum recovery diluent (MRD) (CM733, Oxoid, Basingstoke, United Kingdom) was used to suspend cultures and to prepare food rinse samples. Luria-Bertani (LB) broth (1 liter) was prepared with 10 g of tryptone (L-42; Oxoid, Basingstoke, United Kingdom), 5 g of yeast extract (0127-17-9; Difco, East Molesey, United Kingdom), and 10 g of sodium chloride (BDH, Poole, United Kingdom). Campylobacter enrichment broth (Bolton broth) was prepared with selective supplement X-131 (Lab M, Bury, United Kingdom) without the addition of blood and was used for selective enrichment of food samples. Campylobacter blood-free selective agar plates (CM739; Oxoid, Basingstoke, United Kingdom) containing charcoal-cefoperazone-deoxycholate agar (mCCDA) selective supplement (SR155E; Oxoid, Basingstoke, United Kingdom) were used for subculture of enrichment cultures.
The bacterial isolates used in the specificity studies are listed in Table 1. Isolates were stored at −70°C in brain heart infusion broth (CM 225; Oxoid, Basingstoke, United Kingdom) containing 15% (vol/vol) glycerol (BDH, Poole, United Kingdom). Isolates were recovered from −70°C storage and grown on Columbia blood agar (CM 331; Oxoid, Basingstoke, United Kingdom) containing 5% (vol/vol) whole horse blood. Campylobacter, Arcobacter, and Helicobacter isolates were incubated microaerobically at 37°C for 48 h. Other bacterial strains were incubated either aerobically or anaerobically, as appropriate, at 37°C.

Preparation of PCR standard for use in real-time PCR assay.

A PCR standard containing the C. jejuni ORF-C target sequence was constructed by cloning the target sequence into a plasmid vector with a Topo TA dual-promoter cloning kit (Invitrogen, Paisley, United Kingdom) according to the manufacturer's instructions. The recombinant Escherichia coli strain carrying the C. jejuni recombinant plasmid was inoculated into LB broth (20 ml) and incubated at 37°C overnight with horizontal shaking. Plasmid DNA was extracted from the culture with a S.N.A.P. miniprep kit (Invitrogen, Paisley, United Kingdom) according to the manufacturer's instructions. The plasmid DNA concentration was determined spectrophotometrically with a GeneQuant II RNA/DNA calculator (Amersham-Pharmacia Biotech, Amersham, United Kingdom), and the DNA was used as the template in the ORF-C PCR assay (12) to confirm the presence of the C. jejuni ORF-C insert. Standards were prepared from the plasmid DNA preparation containing between 1.2 and 1.2 × 108 genome equivalents per 3 μl of plasmid DNA template, and these were stored at −20°C and thawed and refrozen a maximum of three times prior to use.

PCR primers and probe.

The PCR primers and probe (CJTP2) were designed with Primer Express software (PE-Applied Biosystems, Warrington, United Kingdom) to target the C. jejuni-specific region of the ORF-C sequence. The probe was labeled with the fluorescent dye 6-carboxyfluorescein on the 5′ end and 6-carboxytetramethylrhodamine on the 3′ end, and thymidine residues were replaced with 5-propyne-2′-deoxyuridine. The primers and probe were synthesized by PE-Applied Biosystems (Warrington, United Kingdom) and stored at −20°C prior to use. The forward primer (82F) sequence was TTGGTATGGCTATAGGAACTCTTATAGCT, the reverse primer (197R) sequence was CACACCTGAAGTATGAAGTGGTCTAAGT, and the CJTP2 probe sequence was TGGCATATCCTAATTTAAATTATTTACCAGGAC.

Real-time PCR assay.

The real-time PCR assay was carried out in a 25-μl volume and contained TaqMan Universal PCR reagent; primers (final concentration, 300 nM), the C. jejuni probe (final concentration, 300 nM), and 3 μl of template DNA. Thermal cycling conditions were as follows: 50°C for 2 min, 95°C for 10 min, and 45 cycles of 95°C for 15 s and 60°C for 1 min. Thermal cycling, fluorescent data collection, and data analysis were carried out with the ABI Prism 7700 sequence detection system according to the manufacturer's instructions.

Interpretation of data and assignment of ΔRn and CT.

The TaqMan Universal PCR reagent contains a passive reference dye as an internal reference to which the reporter dye was normalized during data analysis. This allows correction for fluctuations in fluorescence due to changes in concentration and volume of the reaction mixture. All of the dyes present in the 5′ nuclease PCR contribute to the fluorescent spectra, generating an overlapping composite spectrum. The detection system analyzes these multiple components by monitoring the dye-specific emission frequencies. Normalization of the reporter dye was achieved by dividing its emission intensity by the intensity of the passive reference dye to obtain a ratio defined as the Rn (normalized reporter) for a given reaction. Rn+ is the Rn value of a reaction containing all components including the template. Rn is the Rn value of an unreacted sample, which was obtained during the early PCR cycles prior to a detectable increase in fluorescence. The ΔRn is the difference between the Rn+ value and the Rn value and indicates the magnitude of the signal generated by the PCR. A positive reaction was determined automatically by the detection system and corresponded to any reaction which produced a ΔRn above a threshold set during the early cycles.
The CT value is the cycle at which a statistically significant increase in ΔRn was first detected associated with exponential growth of PCR product. The threshold was defined as 10 times the standard deviation of the mean baseline emission calculated for PCR cycles 3 to 15. The detection system constructed a standard curve by plotting the CT values against each dilution of the known standard (1.2 and 1.2 × 108 genome equivalents) and used this to determine the quantitative value for test samples from the CT value detected.

Investigation of specificity of real-time PCR assay.

Overnight cultures of a wide range of Campylobacter species, related organisms, and unrelated genera (Table 1) were prepared, and DNA was extracted with an Isoquick nucleic acid extraction kit according to the manufacturer's instructions (Orca Research). DNA extracts were quantified, and the purity was assessed spectrophotometrically with a GeneQuant II RNA/DNA calculator (Amersham-Pharmacia Biotech, Amersham, United Kingdom). Samples of the purified DNA (10 ng) were used as the template in the real-time PCR assay with the thermal cycling conditions and data analysis as described above.

Enrichment culture for C. jejuni in foods.

Ninety-seven food samples, including naturally contaminated raw chicken, offal, shellfish, raw meat, and artificially contaminated (spiked) milk samples, were included in this study. Samples were purchased from six local retail outlets over a period of 3 months and were transported to the laboratory at ambient temperature within 1 h of purchase. All samples were stored at 4°C prior to testing and were tested within 24 h of receipt. Approximately 100 g of the food was placed in a Stomacher 400 filter bag (Seward, London, United Kingdom), and MRD was added in a ratio of 1 ml per 2 g of food. The sample and diluent were then mixed by hand for 30 s, and a 25-ml sample of rinse fluid was added to 225 ml of Bolton broth in a sterile 250-ml plastic screw-cap container (Bibby Sterilin, Stone, United Kingdom). Enrichment cultures were incubated at 37°C for 24 h and then at 42°C for a further 24 h. After incubation, enrichment cultures were subcultured to mCCDA medium, and the culture plates were incubated microaerobically at 37°C for 48 h. Subculture plates negative for campylobacters after 48 h of incubation were reincubated for an additional 24 h to facilitate the isolation of Campylobacter species from samples containing small numbers of cells.
Milk samples were inverted 10 times to mix the milk and cream layers, and a 25-ml aliquot of milk was added to 225 ml of Bolton broth in a sterile 250-ml plastic screw-cap container. A second 25-ml aliquot of the milk sample was artificially contaminated (spiked) by adding C. jejuni NCTC 11168 to a total viable-cell concentration of approximately 10 CFU per 25-ml sample. Enrichment cultures were incubated and subcultured as described above.
Shellfish samples were collected from harvesting beds and transported to the laboratory at 4°C. The exterior surfaces of the samples were washed in fresh water to remove sand and other debris. Shells were opened with an oyster knife. The tissue was placed into a sterile container, 50 g of shellfish tissue was added to 450 ml of MRD and mixed, and 25 ml of the suspension was added to 225 ml of Bolton broth. The enrichment broth cultures were then incubated and subcultured as described above.
Total viable Campylobacter counts were performed on enrichment cultures by a surface count method (22). Tenfold dilutions of the cultures were made in MRD, and dilutions were inoculated onto surface-dried CCDA agar plates containing 2% (wt/vol) agar (prepared by the addition of an extra 8 g of Technical agar per liter; L13, Oxoid, Basingstoke, United Kingdom). Plates were incubated microaerobically at 37°C for 48 h, the colonies were counted, and the total viable Campylobacter counts were determined. Positive and negative control samples were included with each set of samples. The positive control sample was prepared from an overnight culture of C. jejuni NCTC 11168 in Bolton enrichment broth (prepared without blood or selective supplement) and diluted in MRD to a cell concentration of approximately 1 CFU/ml. A 25-ml aliquot was added to 225 ml of Bolton broth and incubated and subcultured as described above. The negative control sample was uninoculated enrichment broth, which was included with each set of tests.

Identification of Campylobacter isolates.

Identification of presumptive Campylobacter isolates was based on colony morphology, Gram stain, the oxidase test, and growth only in a microaerobic atmosphere. Identification to species level was performed with the hippurate hydrolysis test, the indoxyl acetate test, urea fermentation test, growth at 42°C, 37°C, and 25°C microaerobically, growth aerobically at 37°C, and sensitivity to cephalothin (30-μg disk) and nalidixic acid (30-μg disk) (3).

Extraction of DNA from enrichment broth cultures.

DNA was extracted from enrichment broth cultures with PrepMan sample preparation reagent according to the manufacturer's instructions (Applied Biosystems, Warrington, United Kingdom). An aliquot (1 ml) of enrichment broth culture was centrifuged at 16,000 × g for 10 min to sediment food particles and bacterial cells, and the supernatant was carefully aspirated and discarded. Samples were centrifuged again at 16,000 × g for 1 min, all remaining traces of supernatant were removed, and the pellet was resuspended in 200 μl of sample preparation reagent by vigorous vortexing. The suspensions were heated by floating on a boiling waterbath for 10 min; the samples were removed and allowed to cool to room temperature for 2 min and then centrifuged at 16,000 × g for 2 min. A 50-μl aliquot of the supernatant was added to 50 μl of molecular biology grade water, and the diluted DNA sample was used as a template in the PCR assay. These samples had been previously investigated with a PCR ELISA (4) and then stored at −20°C for up to 1 year prior to testing in the real-time PCR assay reported here.


Investigation of specificity of real-time PCR assay.

All 15 C. jejuni isolates tested were positive in the real-time PCR assay and produced ΔRn values of between 0.50 and 1.96 and CT values of between 22.2 and 30.4 (Table 1). All of the other Campylobacter, Arcobacter, Helicobacter, and non-Campylobacter organisms were negative in the assay and produced CT values of >45.0.

Determination of linear range of quantification for real-time PCR assay.

To determine the linear range of quantification, a standard curve of the template DNA genome equivalent copy number and CT was automatically generated by the instrument for two replicate sets of controls in the real-time PCR assay. The assay had a linear range of quantification of between 1.2 × 101 and 1.2 × 107 genome equivalents per PCR, and the limit of detection was approximately 12 genome equivalents per reaction.

Detection of C. jejuni enrichment cultures by PCR and subculture to selective agar.

Results of the PCR assay and enrichment culture and subculture to selective agar are presented in Table 2. Any samples that gave results which did not correlate in both methods were retested in the PCR assay, and the original results were confirmed. C. jejuni was isolated from 57 samples, C. coli was isolated from two samples of porcine liver and a chicken meat sample, and C. lari was isolated from one raw shellfish sample. Twenty-six enrichment culture samples enumerated by surface counts had total viable Campylobacter counts ranging from 3 × 104 CFU/ml to greater than 1 × 107 CFU/ml. One sample had a count of approximately 104 CFU/ml, six samples had counts of approximately 106 CFU/ml, and all other samples had counts greater than 107 CFU/ml.
A comparison of the results of the real-time PCR assay and culture is summarized in Table 3. Sixty-three samples were positive in the PCR assay and 57 samples were culture positive for C. jejuni by subculture to selective agar. A total of 66 samples were positive by either method, and 54 of these samples were positive in both methods and 30 samples were negative by both methods. The results of the samples with discrepant results are presented in the lower half of Table 2. Ten samples were PCR positive/culture negative for C. jejuni, although two of these samples (samples 42 and 83) grew C. coli. Three samples (samples 26, 41, and 58) were culture positive/PCR negative. The CT values in the real-time assay for the 10 PCR-positive/culture-negative samples were between 37.0 and 43.2, with eight of them being above 40.0. The 26 samples with total viable Campylobacter counts had CT values of between 21.2 and 34.4, with quantitative results being 2.9 × 104 to 2.8 × 108 genome equivalents per ml of enrichment culture.


PCR methods for the detection of C. jejuni in foods have been described, but many of these methods have not been applied to the detection of C. jejuni in naturally contaminated foods. The adoption of new methods requires validation by application to naturally contaminated samples and comparison of the results with the gold standard method of selective enrichment culture and subculture to selective agar (29). In this study, a real-time PCR assay for the detection of C. jejuni in food samples after enrichment culture was developed, with the results being compared to subculture to selective agar medium and phenotypic identification.
Primers were designed to target a 115-bp region of the ORF-C target sequence containing a C. jejuni-specific region identified previously (12). The melting point of probes can be increased by the substitution of thymidine with 5-propyne-2′-deoxyuridine (15), increasing the melting point by 1°C per substitution. These probes have been successfully used for allelic discrimination in TaqMan PCR assays (18), but they have not been described for pathogen detection assays prior to this study. Incorporation of the substitutions enables shorter probes to be synthesized while maintaining an optimal melting point of 66 to 70°C. The probe in this assay had thymidine residues replaced with 5-propyne-2′-deoxyuridine to maximize the ΔRn values produced by the assay. The specificity of the real-time PCR assay was validated with Campylobacter, Helicobacter, and Arcobacter species and isolates from other unrelated genera and was demonstrated to be specific for C. jejuni.
Real-time data collection during each cycle of TaqMan PCRs with the ABI Prism 7700 sequence detection system can determine the point in the PCR process when a significant rise in fluorescence occurs. This increase in fluorescence occurs when the reaction is in the exponential phase of the amplification and when no reaction components are in limiting concentrations. The detection system automatically calculates the cycle at which each amplification reaches a significant ΔRn, which is usually 10 times the standard deviation of the baseline threshold cycle (CT) (10). Therefore, the CT value is an accurate measure of the number of target molecules originally present in the sample.
The C. jejuni assay in this study demonstrated a linear range of quantification over six orders of magnitude and a quantitative limit of detection of approximately 12 genome equivalents, with detection below these levels being inconsistent. Previously reported sensitivities of detection of TaqMan assays vary between approximately 50 CFU per reaction for the Listeria monocytogenes assay of Bassler and colleagues (1) to 10 ± 5 CFU per reaction for the E. coli O157 assay of Witham and colleagues (37). The Salmonella assay evaluated by Chen and colleagues (5) and Kimura and colleagues (14) had an analytical sensitivity of 2 CFU/per reaction in pure cultures, but none of these assays was quantitative.
Nogva and Lillehaug (24) used the TaqMan Salmonella PCR detection kit (Applied Biosystems) in a real-time format and demonstrated quantification of Salmonella cells over six orders of magnitude in pure culture. Nogva and colleagues also reported real-time quantitative assays for L. monocytogenes (26) and C. jejuni (25), both of which had a linear range of quantification of at least six orders of magnitude. However, none of these assays was applied to the quantitative detection of these species in naturally contaminated foods.
The C. jejuni assay reported here was applied to the detection and quantification of C. jejuni in DNA extracts from enriched food samples previously investigated with a PCR ELISA (4). The samples had been stored at −20°C for up to 1 year prior to testing, and the results of the detection of C. jejuni by the PCR assay were compared with conventional culture results. The real-time PCR assay detected C. jejuni in 63 of the 97 samples, with 53 of these samples being culture positive for C. jejuni. Three samples (numbers 26, 41, and 58) which were culture positive were negative in the real-time PCR assay. These three samples had been previously demonstrated to be positive in a PCR ELISA (4). The manufacturers of the DNA extraction reagent recommend storage of DNA extracts for up to a maximum of 1 month prior to testing, and it is possible that these DNA extracts may have become degraded during the extended storage period. This may have reduced the number of template molecules to below detectable levels when tested. Alternatively, substances present in the DNA extracts may have specifically inhibited the real-time PCR, causing these false-negative reactions.
Ten samples were positive in the real-time PCR assay but culture negative for C. jejuni. Two of these samples (numbers 42 and 83) were culture positive for C. coli. To determine that the enrichment cultures contained C. jejuni cells which were not recovered on subculture, the DNA samples were used as the template in another C. jejuni-specific PCR assay that targeted the hippuricase gene of C. jejuni. Both samples were positive in the hippuricase PCR assay (data not shown), confirming that C. jejuni was present in the enrichment cultures. Only single colonies of presumptive Campylobacter isolates were picked from the subculture plates, and therefore theses samples may have contained both C. jejuni and C. coli. The ten PCR-positive/culture-negative samples had CT values of 37.0 or greater, with the mean value being 41.4, whereas the PCR-positive/culture-positive samples had CT values of between 20.8 and 37.5, with the mean value being 26.2. The CT value indicates the number of genome equivalents per reaction; therefore, all 10 of these samples may have contained very small numbers of genome equivalents per reaction.
One sample (number 97) was positive by direct culture (data not shown), although the enrichment culture was negative for Campylobacter on subculture. This enrichment culture may have contained C. jejuni cells which were not recovered by subculture to selective agar but could be detected with the real-time PCR assay. Seven of the other nine PCR-positive/culture-negative samples were previously demonstrated to be positive in a PCR ELISA that targeted the same C. jejuni sequence (4). Only a raw shellfish sample (number 53) and a raw milk sample (number 79) were not positive in the PCR ELISA. Therefore, 8 of these 10 samples contained C. jejuni DNA that may have been derived from dead, injured, or viable but nonculturable C. jejuni cells which were not recovered by conventional enrichment culture, although the DNA was detected in the PCR assay.
Quantitative PCR results were compared with total viable Campylobacter counts for 26 samples. Nonviable C. jejuni cells present in the original samples may have been detected in the PCR assay and could have contributed to the number of genome equivalents detected. Enrichment culture of the samples prior to testing may have reduced the effects of dead cells present in the foods by dilution and by increasing the number of viable cells. The total viable Campylobacter counts from the 26 enrichment broth samples varied between 4 × 105 and greater than 107 CFU/ml. Comparison of the viable counts and genome equivalent counts showed that the genome equivalent counts were greater in some of the samples than the viable counts. The Campylobacter counts were performed on selective agar, but if some of the cells were dead or injured, preventing their recovery on selective agar, then the method may have underestimated the number of total cells present.
The real-time PCR assay reported here uses a 96 well microplate format, which can test large numbers of samples rapidly and the assay uses universal PCR reagents and thermal cycling conditions facilitating the testing of multiple targets on the same analysis plate. This platform technology and common reagent format will facilitate standardization of methods between laboratories. The elimination of postamplification manipulation of the PCR products also reduces the potential for cross-contamination to subsequent PCRs, therefore reducing the probability of false positive results. The universal PCR reagent contains uracil DNA glycosylase and dUTP, which is an additional control to prevent previous amplification products being reamplified in the assay leading to false positive results (19). The assay could be adapted to be performed on any of the other real-time PCR platforms available however modifications of the protocol may have to be made.
The real-time PCR assay reported here was demonstrated to be as sensitive as conventional culture methods but significantly reduced the time taken for detection. The total time required for detection in enrichment broth samples was about 3 h (30 min for the DNA extraction and approximately 2.5 h for the real-time PCR assay) with the results being available immediately at the end of PCR cycling. This assay is the first report of the application of a real-time quantitative PCR assay to the detection of C. jejuni in naturally contaminated foods and is a model for other food-borne pathogens. The use of sensitive, quantitative methods for the detection of C. jejuni during food processing could be used to determine points in the food production process where contamination occurs and where controls could be introduced to reduce or eliminate C. jejuni from retail food products, thereby reducing the risk to the consumer (20).
TABLE 1. Specificity of detection of Campylobacter species and non-Campylobacter organisms with the real-time PCR assay
OrganismSourceaSerotype(s)bStrain or reference no.CTΔRn
Campylobacter jejuniNCTC21116823.40.94
 Chicken38, 5788086/9530.40.50
Campylobacter coliNCTCND11366>45.0−0.01
Campylobacter lariNCTC 11352>45.0−0.03
 Shellfish 77779/94>45.00.00
Campylobacter lariShellfish 77715/94>45.0−0.05
Campylobacter lari UPTCcNCTC 11928>45.0−0.05
 Shellfish 77625/94>45.0−0.04
 Shellfish 77716/94>45.00.10
Campylobacter upsaliensisNCTC 11540>45.00.01
Campylobacter helveticusNCTC 12470>45.0−0.15
Campylobacter fetus subsp. fetusNCTC 5850>45.0−0.33
Campylobacter fetus subsp. venerealisNCTC 10354>45.0−0.02
Campylobacter hyointestinalisNCTC 11609>45.0−0.09
Campylobacter mucosalisNCTC 11000>45.0−0.03
Campylobacter sputorum subsp. bubulusNCTC 11367>45.0−0.08
Campylobacter sputorum biovar faecalisNCTC 11416>45.0−0.03
Campylobacter hyoileiNCTC 12884>45.0−0.10
Helicobacter cinaediNCTC 12423>45.0−0.02
Arcobacter butzleriNCTC 12481>45.0−0.02
 Chicken 450427/98>45.0−0.01
 Chicken 450555/98>45.0−0.01
 Chicken 450556/98>45.0−0.08
Aeromonas hydrophilaNCTC 8049>45.00.00
Bacillus cereusNCTC 7464>45.00.01
Bacillus subtilisNCTC 10400>45.00.01
Clostridium perfringensNCTC 8237>45.0−0.02
Escherichia coliNCTC 10418>45.0−0.01
Escherichia coli O157, nontoxigenicNCTC 12900>45.0−0.02
Escherichia coli O157 VTECdNCTC 12079>45.00.02
Lactobacillus caseiNCTC 10302>45.00.02
Lactococcus lactisNCTC 662>45.0−0.05
Pseudomonas aeruginosaNCTC 10662>45.0−0.01
Salmonella enteritidisNCTC 400452/97>45.00.02
Salmonella enterica serovar TyphimuriumNCTC 12023>45.0−0.01
Shigella sonneiNCTC 8574>45.0−0.05
Enterococcus faecalisNCTC 775>45.0−0.02
Staphylococcus aureusNCTC 6571>45.00.02
Coagulase-negative staphylococcusNCTC 170454/97>45.00.03
Vibrio parahaemolyticusNCTC 10885>45.0−0.05
Vibrio alginolyticusNCTC 12160>45.0−0.08
Vibrio cholerae non-O:1NCTC 11348>45.0−0.04
Yersinia enterocoliticaNCTC 10460>45.00.00
Proteus mirabilisNCTC 10975>45.0−0.05
Citrobacter freundiiNCTC 9750>45.0−0.08
Legionella pneumophilaNCTC 12821>45.0−0.08
Acinetobacter lwoffiiNCTC 5866>45.00.01
Enterobacter aerogenesNCTC 10006>45.00.03
Enterobacter cloacaeNCTC 11936>45.00.05
Proteus rettgeriNCTC 7475>45.0−0.01
Klebsiella pneumoniaeNCTC 350324/97>45.0−0.02
NCTC, National Collection of Type Cultures, PHLS Colindale; all other isolates were obtained from the Campylobacter Collaborating Unit, Preston Public Health Laboratory.
Campylobacter Penner heat-stable serotype. ND, not determined.
UPTC, urease-positive thermophilic Campylobacter.
VTEC, verocytotoxin-producing E. coli.
TABLE 2. Detection of C. jejuni in food enrichment cultures by real-time PCR and subculture to selective agar
Sample no.SampleSourceConcordantaCulture resultbPhenotypic identificationReal-time PCR assayc   Total viable Campylobacter countsd
1ThighChickenY+C. jejuni2.0 × 1072.7 × 1093.7321.8ND
2ThighChickenY+C. jejuni1.3 × 1071.7 × 1093.0122.5ND
3ThighChickenY+C. jejuni6.2 × 1068.3 × 1082.8223.6ND
4ThighChickenY+C. jejuni7.4 × 1069.8 × 1082.5923.3ND
5DrumstickChickenY+C. jejuni1.4 × 1061.9 × 1081.6626.1ND
6DrumstickChickenY+C. jejuni2.6 × 1063.5 × 1081.9625.0ND
8Diced meatTurkeyY+C. jejuni4.4 × 1065.9 × 1081.8924.2ND
11LiverPigY+C. jejuni1.1 × 1031.5 × 1051.6537.5ND
16ShellfishMusselsY+C. lari  −0.0245.0ND
17LiverOxY+C. jejuni1.2 × 1061.6 × 1081.9126.3ND
18LiverOxY+C. jejuni2.0 × 1052.7 × 1072.0229.2ND
19LiverPigY+C. jejuni5.6 × 1057.5 × 1071.7227.5ND
20LiverPigY+C. jejuni1.0 × 1061.3 × 1082.3226.5ND
21DrumstickChickenY+C. jejuni1.7 × 1052.3 × 1071.5529.4ND
22DrumstickChickenY+C. jejuni4.7 × 1036.3 × 1051.4635.1ND
23ThighChickenY+C. jejuni1.0 × 1071.3 × 1092.3922.8ND
24ThighChickenY+C. jejuni2.1 × 1072.8 × 1093.0221.6ND
25QuarterChickenY+C. jejuni2.2 × 1042.9 × 1061.5232.7ND
28MeatTurkeyY+C. jejuni4.1 × 1045.5 × 1060.7831.7ND
30WingsChickenY+C. jejuni9.4 × 1031.3 × 1061.1229.0ND
31WingsChickenY+C. jejuni2.2 × 1052.9 × 1071.6024.4ND
32QuarterChickenY+C. jejuni4.9 × 1026.5 × 1040.9833.3ND
33MeatTurkeyY+C. jejuni3.8 × 1055.1 × 1071.4823.7ND
35LiverChickenY+C. jejuni2.1 × 1042.8 × 1061.2227.9ND
36LiverChickenY+C. jejuni1.0 × 1041.3 × 1061.2828.9ND
37DrumstickChickenY+C. jejuni5.8 × 1017.7 × 1030.4936.4ND
7MeatLambY   0.1945.0 
9LiverLambY   0.2945.0 
10LiverOxY   0.1145.0 
12MeatPorkY   0.3945.0 
15ShellfishCocklesY   0.0745.0 
27MeatTurkeyY   0.4045.0 
29MeatPorkY   0.3645.0 
34LiverPigsY   0.3645.0 
43QuarterChickenY   0.0845.0 
47ThighChickenY   0.1745.0 
48ThighChickenY   0.0745.0 
49DrumstickChickenY   0.0645.0 
50DrumstickChickenY   0.2845.0 
51ShellfishCocklesY   0.2845.0 
52ShellfishCocklesY   0.0945.0 
59LiverLambY   0.0845.0 
60LiverPigsY   0.3645.0 
63KidneyLambY   0.2445.0 
69MilkRawY   0.1845.0 
71MilkRawY   0.2545.0 
73MilkRawY   0.3145.0 
74MilkRaw (spiked)Y   0.1545.0 
77MilkRawY   −0.0845.0 
78MilkRaw (spiked)Y   0.0445.0 
80MilkRaw (spiked)Y   −0.0145.0 
82MeatPorkY   0.3245.0 
91LiverPigsY   0.0145.0 
92DrumstickChickenY   0.3945.0 
65ThighChickenN 4.0 × 1015.3 × 1031.0937.0 
13LiverChickenN 4.7 × 1026.3 × 1040.8838.8 
38DrumstickChickenY+C. jejuni1.1 × 1051.5 × 1071.2525.5ND
39LiverLambsY+C. jejuni4.4 × 1045.9 × 1060.7426.8ND
40LiverOxY+C. jejuni2.8 × 1063.7 × 1082.4420.8ND
44QuarterChickenY+C. jejuni5.8 × 1047.7 × 1061.5526.4ND
45WingsChickenY+C. jejuni4.3 × 1055.7 × 1071.7123.5ND
46WingsChickenY+C. jejuni3.4 × 1054.5 × 1072.2523.8ND
54DrumstickChickenY+C. jejuni2.1 × 1062.8 × 1082.0621.21.0 × 106
55DrumstickChickenY+C. jejuni6.1 × 1058.1 × 1071.9623.01.0 × 106
56DrumstickChickenY+C. jejuni5.9 × 1047.8 × 1061.6823.01.0 × 106
57DrumstickChickenY+C. jejuni1.3 × 1061.7 × 1081.6221.91.0 × 106/PICK>
61LiverOxY+C. jejuni9.0 × 1051.2 × 1082.6822.4>6 × 106
62LiverPigsY+C. jejuni4.8 × 1056.4 × 1072.7023.31.0 × 106
64MeatTurkeyY+C. jejuni5.0 × 1046.7 × 1061.1026.61.0 × 106
66DrumstickChickenY+C. coli  0.3345.01.0 × 105
67DrumstickChickenY+C. jejuni1.1 × 1041.5 × 1061.9228.81.4 × 105
68DrumstickChickenY+C. jejuni7.8 × 1051.0 × 1083.4022.62.0 × 105
70MilkRaw (spiked)Y+C. jejuni2.0 × 1052.7 × 1071.6724.6>3 × 106
72MilkRaw (spiked)Y+C. jejuni6.6 × 1058.8 × 1072.4722.8>1 × 107
76MilkRaw (spiked)Y+C. jejuni2.2 × 1012.9 × 1030.8237.83 × 104
81MeatTurkeyY+C. jejuni2.5 × 1023.3 × 1040.5434.3<1.0 × 105
84LiverChickenY+C. jejuni2.2 × 1022.9 × 1040.9634.42 × 105
85ThighChickenY+C. jejuni5.6 × 1047.5 × 1061.0826.4>4 × 105
86DrumstickChickenY+C. jejuni3.4 × 1054.5 × 1071.5623.8>1 × 107
87ThighChickenY+C. jejuni7.3 × 1059.8 × 1072.2522.7>1 × 107
88MilkPasteurized (spiked)Y+C. jejuni7.9 × 1051.1 × 1081.4722.6>1 × 107
89MilkPasteurized (spiked)Y+C. jejuni1.9 × 1062.5 × 1081.9721.3>1 × 107
90LiverOxY+C. jejuni3.9 × 1055.2 × 1071.4023.6>1 × 107
94DrumstickChickenY+C. jejuni1.5 × 1012.0 × 1030.5838.43.0 × 105
95ThighChickenY+C. jejuni2.9 × 1043.9 × 1061.0327.46 × 107
96ThighChickenY+C. jejuni1.1 × 1061.5 × 1084.1222.29 × 107
93DrumstickChickenN 3.24.3 × 1020.6440.6 
53ShellfishCocklesN 3.04.0 × 1020.4540.7 
14LiverChickenN 7.5 × 1011.0 × 1040.7441.8 
97ThighChickenN 5.87.7 × 1020.9241.9 
75MilkRawN 1.01.3 × 1020.7142.3 
79MilkRawN 5.4 × 1017.2 × 1030.5343.2 
83LiverPigsN+C. coli5.3 × 1017.1 × 1030.4843.21.4 × 106
42LiverPigsN+C. coli2.1 × 1012.8 × 1030.4544.6ND
41LiverPigsN+C. jejuni  0.2745.0ND
58LegChickenN+C. jejuni  0.0645.01.6 × 106
26MeatTurkeyN+C. jejuni  0.0845.0ND
Concordant: Y, yes; N, no.
Results of subculture to selective agar medium.
GE-PCR, genome equivalents per real-time PCR reaction; GE-ml, genome equivalents per milliliter of enrichment culture.
Total viable Campylobacter count on selective agar after 48 h of enrichment culture (CFU milliliter of enrichment culture). ND, not determined.
TABLE 3. Summary of the results of the PCR assay and subculture to selective agar for the detection of C. jejuni in enrichment cultures
Sample typeNo. of samples testedNo. positive on subculture to selective agarNo. positive in real-time PCRNo. positive by either methodNo. positive by both methods
Raw meat116565
Milk (spiked)85555
Shellfish (raw)50110


This work was supported by the United Kingdom Ministry of Agriculture, Food and Fisheries (research program FS1242).
We thank Adam Corner of Applied Biosystems, United Kingdom, for help in designing the PCR primers and probes and Applied Biosystems for synthesizing them. We also thank Patricia Fields for critically reading the manuscript.


Bassler, H. A., S. J. A. Flood, K. E. Livak, J. Marmaro, R. Knorr, and C. A. Batt. 1995. Use of a fluorogenic probe in a PCR-based assay for the detection of Listeria monocytogenes. Appl. Environ. Microbiol.61:3724-3728.
Blaser, M. J., D. N. Taylor, and R. A. Feldman. 1983. Epidemiology of Campylobacter jejuni infections. Epidemiol. Rev.5:157-176.
Bolton, F. J., D. R. A Wareing, M. B. Skirrow, and D. N. Hutchinson. 1992. Identification and biotyping of campylobacters, p. 151-162. In R. G. Board, D. Jones, and F. A. Skinner (ed.), Identification methods in applied and environmental microbiology. Blackwell Scientific Publications, Oxford, United Kingdom.
Bolton, F. J., A. D. Sails, A. J. Fox, D. R. A. Wareing, and D. L. A. Greenway. Detection of Campylobacter jejuni and Campylobacter coli in foods by enrichment culture and PCR ELISA. J. Food Prot.65:760-767.
Chen, S., A. Yee, M. Griffiths, C. Larkin, C. T. Yamashiro, R. Behari, C. Paszko-Kolva, K. Rahn, and S. A. De Grandis. 1997. The evaluation of a fluorogenic polymerase chain reaction assay for the detection of Salmonella species in food commodities. Int. J. Food Microbiol.35:239-250.
Corry, J. E. L., D. E. Post, P. Colin, and M. J. Laisney. 1995. Culture media for the isolation of campylobacters. Int. J. Food Microbiol.26:43-76.
Cowden, J. 1992. Campylobacter: epidemiological paradoxes. Br. Med. J.305:132-133.
Docherty, L., M. R. Adams, P. Patel, and J. McFadden. 1996. The magnetic immuno-polymerase chain reaction assay for the detection of Campylobacter in milk and poultry. Lett. Appl. Microbiol.22:288-292.
Fahey, T., D. Morgan, C. Gunneburg, G. K. Adak, F. Majid, and E. Kaczmarski. 1995. An outbreak of Campylobacter jejuni enteritis associated with failed milk pasteurisation. J. Infect.31:137-143.
Gibson, U. E. M., C. A. Heid, and M. Williams. 1996. A novel method for real time quantitative PCR. Genome Res.6:995-1001.
Giesendorf, B. A., W. G. Quint, M. H. Henkens, H., Stegeman, F. A. Huf, and H. G. Niesters. 1992. Rapid and sensitive detection of Campylobacter spp. in chicken products by the polymerase chain reaction. Appl. Environ. Microbiol.58:3804-3808.
Jackson, C. J., A. J. Fox, and D. M. Jones. 1996. A novel polymerase chain reaction assay for the detection and speciation of thermophilic Campylobacter spp. J. Appl. Bacteriol.81:467-473.
Jones, D. M., J. D. Abbott, M. J. Painter, and E. M. Sutcliffe. 1984. Comparison of biotypes and serotypes of Campylobacter spp. isolated from patients with enteritis and from animal sources. J. Infect.9:51-58.
Kimura, B., S. Kawasaki, T. Fujii, J. Kusunoki, T. Itoh, and S. J. A. Flood. 1999. Evaluation of the TaqMan PCR assay for detecting Salmonella in raw meat and shrimp. J. Food Prot.62:329-335.
Kuimelis, R. G., K. J. Livak, B. Mullah, and A. Andrus. 1997. Structural analogues of TaqMan probes for real-time quantitative PCR. Nucleic Acids Symp. Ser.37:255-256.
Lawson, A. J., J. M. Logan, J. O'Neill, M. Desai, and J. Stanley. 1999. Large-scale survey of Campylobacter species in human gastroenteritis by PCR and PCR-enzyme-linked immunosorbent assay. J. Clin. Microbiol.37:3860-3864.
Livak, K. J., S. J. A. Flood, J. Marmaro, W. Giusti, and K. Deetz. 1995. Oligonucleotides with fluorescent dyes at opposite ends provide a quenched probe system useful for detecting PCR product and nucleic acid hybridisation. PCR Methods Appl.4:357-362.
Livak, K. J. 1999. Allelic discrimination with fluorogenic probes and the 5′ nuclease assay. Gen. Anal. Biomol. Eng.14:14314-14319.
Longo, M. C., M. S. Berninger, and J. L. Hartley. 1990. Use of uracil DNA glycosylase to control carry-over contamination in polymerase chain reactions. Gene93:125-128.
Mandrell, R. E., and M. R. Wachtel. 1999. Novel detection techniques for human pathogens that contaminate poultry. Curr. Opin. Biotechnol.10:273-278.
Mead, P. S., L. Slutsker, V. Dietz, L. F. McCaig, J. S. Bresee, C. Shapiro, P. M. Griffin, and R. V. Tauxe. 1999. Food-related illness and death in the United States. Emerg. Infect. Dis.5:607-625.
Miles, A. A., S. S. Misra, and J. O. Irwin. 1938. The estimation of the bactericidal power of blood. J. Hyg.38:732-749.
Ng, L. K., C. I. B. Kingombe, W. Yan, D. E. Taylor, K. Hiratsuka, N. Malik, and M. M. Garcia. 1997. Specific detection and confirmation of Campylobacter jejuni by DNA hybridization and PCR. Appl. Environ. Microbiol.63:4558-4563.
Nogva, H. K., and D. Lillehaug. 1999. Detection and quantification of Salmonella in pure cultures with 5′-nuclease polymerase chain reaction. Int. J. Food Microbiol.51:191-196.
Nogva, H. K., A. Bergh, A. Holck, and K. Rudi. 2000. Application of the 5′-nuclease PCR assay in evaluation and development of methods for quantitative detection of Campylobacter jejuni. Appl. Environ. Microbiol.66:4029-4036.
Nogva, H. K., K. Rudi, K. Naterstad, A. Holck, and D. Lillehaug. 2000. Application of 5′-nuclease PCR for quantitative detection of Listeria monocytogenes in pure cultures, water, skim milk, and unpasteurized whole milk. Appl. Environ. Microbiol.66:4266-4271.
O'Sullivan, N. A., R. Fallon, C. Carroll, T. Smith, and M. Maher. 2000. Detection and differentiation of Campylobacter jejuni and Campylobacter coli in broiler chicken samples with a PCR/DNA probe membrane based colorimetric detection assay. Mol. Cell. Probes14:7-16.
Pebody, R. G., M. J. Ryan, and P. G. Wall. 1997. Outbreaks of Campylobacter infection: rare events for a common pathogen. Commun. Dis. Rep. Rev.7:R33-R37.
Pillai, S. D., and S. C. Ricke. 1995. Strategies to accelerate the applicability of gene amplification protocols for pathogen detection in meat and meat products. Crit. Rev. Microbiol.21:239-261.
Raeymaekers, L. 1995. A commentary on the practical applications of competitive PCR. Genome Res.5:91-94.
Reischl, U., and B. Kochanowski. 1995. Quantitative PCR. Mol. Biotechnol.3:55-71.
Sails, A. D., A. J. Fox, F. J. Bolton, D. R. A. Wareing, D. L. A. Greenway, and R. Borrow. 2001. Development of a PCR ELISA assay for the identification of Campylobacter jejuni and Campylobacter coli. Mol. Cell. Probes15:291-300.
Skirrow, M. B. 1994. Diseases due to Campylobacter,Helicobacter and related bacteria. J. Comp. Pathol.111:113-149.
Waage, A. S., T. Varund, V. Lund, and G. Kapperud. 1999. Detection of small numbers of Campylobacter jejuni and Campylobacter coli cells in environmental water, sewage, and food samples by a seminested PCR assay. Appl. Environ. Microbiol.65:1636-1643.
Wegmuller, B., J. Luthy, and U. Candrian. 1993. Direct polymerase chain reaction detection of Campylobacter jejuni and Campylobacter coli in raw milk and dairy products. Appl. Environ. Microbiol.59:2161-2165.
Wilson, D. L., S. R. Abner, T. C. Newman, L. S. Mansfield, and J. E. Linz. 2000. Identification of ciprofloxacin-resistant Campylobacter jejuni by use of a fluorogenic PCR assay. J. Clin. Microbiol.38:3971-3978.
Witham, P. K., C. T. Yamashiro, K. L. Livak, and C. A. Batt. 1996. A PCR-based assay for the detection of Escherichia coli Shiga-like toxin genes in ground beef. Appl. Environ. Microbiol.62:1347-1353.

Information & Contributors


Published In

cover image Applied and Environmental Microbiology
Applied and Environmental Microbiology
Volume 69Number 3March 2003
Pages: 1383 - 1390
PubMed: 12620820


Received: 19 August 2002
Accepted: 11 December 2002
Published online: 1 March 2003


Request permissions for this article.



Andrew D. Sails
Preston Public Health Laboratory, Royal Preston Hospital, Fulwood, Preston, Lancashire PR2 9HG
Present address: National Center for Infectious Diseases, Centers for Disease Control and Prevention, Atlanta, GA 30333.
Andrew J. Fox [email protected]
Manchester Public Health Laboratory, Withington Hospital, West Didsbury, Manchester M20 2LR
Frederick J. Bolton
Preston Public Health Laboratory, Royal Preston Hospital, Fulwood, Preston, Lancashire PR2 9HG
David R. A. Wareing
Preston Public Health Laboratory, Royal Preston Hospital, Fulwood, Preston, Lancashire PR2 9HG
David L. A. Greenway
Department of Biological Sciences, University of Central Lancashire, Preston PR1 2HE, United Kingdom

Metrics & Citations


Note: There is a 3- to 4-day delay in article usage, so article usage will not appear immediately after publication.

Citation counts come from the Crossref Cited by service.


If you have the appropriate software installed, you can download article citation data to the citation manager of your choice. For an editable text file, please select Medlars format which will download as a .txt file. Simply select your manager software from the list below and click Download.

View Options

Figures and Media






Share the article link

Share with email

Email a colleague

Share on social media

American Society for Microbiology ("ASM") is committed to maintaining your confidence and trust with respect to the information we collect from you on websites owned and operated by ASM ("ASM Web Sites") and other sources. This Privacy Policy sets forth the information we collect about you, how we use this information and the choices you have about how we use such information.
FIND OUT MORE about the privacy policy