ABSTRACT

Proteins immobilized on biosilica which have superior reactivity and specificity and are innocuous to natural environments could be useful biological materials in industrial processes. One recently developed technique, living diatom silica immobilization (LiDSI), has made it possible to immobilize proteins, including multimeric and redox enzymes, via a cellular excretion system onto the silica frustule of the marine diatom Thalassiosira pseudonana. However, the number of application examples so far is limited, and the type of proteins appropriate for the technique is still enigmatic. Here, we applied LiDSI to six industrially relevant polypeptides, including protamine, metallothionein, phosphotriesterase, choline oxidase, laccase, and polyamine synthase. Protamine and metallothionein were successfully immobilized on the frustule as protein fusions with green fluorescent protein (GFP) at the N terminus, indicating that LiDSI can be used for polypeptides which are rich in arginine and cysteine. In contrast, we obtained mutants for the latter four enzymes in forms without green fluorescent protein. Immobilized phosphotriesterase, choline oxidase, and laccase showed enzyme activities even after the purification of frustule in the presence of 1% (wt/vol) octylphenoxy poly(ethyleneoxy)ethanol. An immobilized branched-chain polyamine synthase changed the intracellular polyamine composition and silica nanomorphology. These results illustrate the possibility of LiDSI for industrial applications.
IMPORTANCE Proteins immobilized on biosilica which have superior reactivity and specificity and are innocuous to natural environments could be useful biological materials in industrial processes. Living diatom silica immobilization (LiDSI) is a recently developed technique for in vivo protein immobilization on the diatom frustule. We aimed to explore the possibility of using LiDSI for industrial applications by successfully immobilizing six polypeptides: (i) protamine (Oncorhynchus keta), a stable antibacterial agent; (ii) metallothionein (Saccharomyces cerevisiae), a metal adsorption molecule useful for bioremediation; (iii) phosphotriesterase (Sulfolobus solfataricus), a scavenger for toxic organic phosphates; (iv) choline oxidase (Arthrobacter globiformis), an enhancer for photosynthetic activity and yield of plants; (v) laccase (Bacillus subtilis), a phenol oxidase utilized for delignification of lignocellulosic materials; and (vi) branched-chain polyamine synthase (Thermococcus kodakarensis), which produces branched-chain polyamines important for DNA and RNA stabilization at high temperatures. This study provides new insights into the field of applied biological materials.

INTRODUCTION

Proteins (or polypeptides) are utilized in a variety of technical processes in modern society. Compared to chemical materials, proteins including enzymes often show superior reactivity and specificity and are innocuous to natural environments. However, these biological materials can be easily inactivated during the production process and thus are inefficient in terms of yield and cost. Therefore, it is highly desirable to establish more efficient and stable systems to produce reusable proteins which can be used for technological processes. Immobilization is one of the most popular ways to enhance the stability and accessibility of proteins, and it is generally achieved through physisorption, covalent attachment, and in situ incorporation during solid material formation; this is applicable to robust proteins that are available for large-scale preparation in vitro, but not for many other delicate ones.
Alternatively, one seminal technology, living diatom silica immobilization (LiDSI), has been developed for the marine diatom Thalassiosira pseudonana to immobilize proteins on biological solid materials in vivo (1, 2). Diatoms are a large and abundant group of single-celled photosynthetic eukaryotes in which the protoplast is encapsulated in a biomineralized silica wall, termed the frustule. The unique feature of the diatom frustule is the hierarchical arrangement of three-dimensional patterns of pores with diameters in the nm- to μm-scale range (20 nm ~ 2 μm), which exhibits exceptionally high mechanical stability and is resistant to elevated temperatures (<100°C), high salt concentrations, and acidic conditions (pH > 2) (2). Overall, the diatom frustule is a desirable biosilica matrix for protein immobilization and is of interest to the materials research community. Indeed, the frustule can be applied in the fields of sensor technology, organic synthesis, degradation of harmful chemicals, and drug delivery (3, 4). In the diatom T. pseudonana, the silaffin TpSil3 is localized to the silica cell wall. The LiDSI method takes advantage of this TpSil3 localization, allowing for the incorporation of foreign proteins into the cell wall through genetic engineering and the expression of TpSil3-fusion proteins. That is, protein immobilization in vivo is performed in a milder environment than in the in vitro methods described above. LiDSI has been already succeeded for a variety of proteins in previous studies, including hydroxylaminobenzene mutase, β-glucuronidase, glucose oxidase, galactose oxidase, horseradish peroxidase, and an immunoglobulin G-binding domain of protein G (1, 2, 5). However, the molecular mechanism of protein transport from the cytosol to the cell wall is still not fully understood. Overall, more trials on a variety of proteins are needed to obtain basic understanding to establish LiDSI for technological processes.
Here, we sought to immobilize six proteins with different biophysical and biochemical profiles to explore the effects of protein features on transport to the cell wall (Table 1). (i) Protamine derived from the testes of salmon, Oncorhynchus keta (OkProtamine), was selected as a stable antibacterial agent. (ii) We targeted three tandem-repeated metallothionein derived from the budding yeast, Saccharomyces cerevisiae (ScMT3), as a candidate utilized for removing heavy metals in bioremediation. (iii) Phosphotriesterase of the hyperthermophilic bacterium Sulfolobus solfataricus was targeted as an enzyme that catalyzes the hydrolysis of toxic organic phosphates. (iv) Choline oxidase of the soil bacterium Arthrobacter globiformis is an enzyme that can be utilized to produce glycine betaine. (v) Laccase derived from the Gram-positive bacteria Bacillus subtilis was applied to LiDSI as an important enzyme for delignification of lignocellulosic materials, cross-linking of polysaccharides, and bioremediation. (vi) Branched-chain polyamine synthase A from the hyperthermophilic archaeon Thermococcus kodakarensis (TkBpsA) produces branched-chain polyamines that contribute to the stabilization of nucleic acids such as DNA and RNA at high temperature (6). In T. pseudonana, long-chain polyamines are produced and transported into the silica deposition vesicle (SDV), where they form a matrix onto which the supersaturated silica precipitates in an amorphous form. Branched-chain polyamines are hence expected to affect the shape of the diatom frustule. These six candidates were introduced in the form of TpSil3-tagged polypeptides into the frustule of T. pseudonana by LiDSI. Immobilization of OkProtamine and ScMT3 was confirmed by the fluorescence derived from GFP fused to the products. The latter four enzymes (SsPTE, AgCOD, BsLaccase, and TkBpsA) were confirmed by either immunofluorescence or enzyme activity.
TABLE 1
TABLE 1 Target polypeptides for biosilica immobilizationa
PolypeptideOrganismMwpI
ProtamineOncorhynchus keta4.2k13.30
MetallothioneinSaccharomyces cerevisiae20.2k5.97
PhosphotriesteraseSulfolobus solfataricus35.4k6.12
Choline oxidaseArthrobacter globiformis59.7k4.95
LaccaseBacillus subtilis30.8k6.19
Polyamine synthaseThermococcus kodakarensis40.2k4.83
a
Mw, molecular mass; pI, isoelectric point; k, kilo. Mw and pI of the polypeptides were calculated with an Expasy tool (https://www.expasy.org/) based on the amino acid sequences (monomer) shown in the database or Table S1 in the supplemental material. Metallothionein was expressed in the three-tandem repeat form.

RESULTS AND DISCUSSION

Protamine.

Protamine is the arginine-rich polypeptide which protects DNA in the nuclei in the mature sperm cells of vertebrates. Because of its small molecular mass (4 ~ 5 kDa) and strong positive charge, protamine is commonly utilized as a stable antibacterial agent, especially against Gram-positive bacteria. Protamine is highly soluble but can be easily recovered if it is immobilized on the biosilica. The codon-optimized OkProtamine was introduced into T. pseudonana by LiDSI in the form of GFP fusion at the N and C termini, respectively, designated TpSil3-GFP-OkProtamine and TpSil3-OkProtamine-GFP. Whereas TpSil3-GFP-OkProtamine was successfully localized in the frustule, similarly to the localization of the TpSil3-tagged GFP, the fluorescence of TpSil3-OkProtamine-GFP was detected in the cytosol, resembling the localization of the GFP control (Fig. 1). These results clearly suggest that transport from the cytosol to the cell wall is inhibited by OkProtamine if it is fused at the C terminus of TpSil3. Even though it is possible that the strong basicity of OkProtamine affected the translocation of endoplasmic reticulum (ER)-recruited peptide to the Golgi apparatus, it is rather unlikely because the silaffins are also highly basic proteins whose GFP fusion can be displayed on the frustule (7). Overall, OkProtamine was immobilized on the T. pseudonana frustule although the antibacterial activity remains to be quantitatively assessed in future works.
FIG 1
FIG 1 Immobilization of green fluorescent protein (GFP)-fused OkProtamine on the frustule of Thalassiosira pseudonana. Bright field (BF), chlorophyll autofluorescence (FChl), and GFP fluorescence (FGFP) images were obtained and merged. The mutants which expressed only GFP and TpSil3-fused GFP were analyzed as controls. GFP was fused to both the N and C termini of OkProtamine. White scale bars = 2 μm.

Metallothionein.

Metallothionein is a small polypeptide (>10 kDa) containing 10 ~ 20 cysteine residues, with a high affinity for multivalent metals such as zinc, copper, and cadmium (8). Due to these features, metallothionein has been reported to function as an antioxidant and to be valuable for bioremediation as a metal adsorption molecule (9, 10). The three-tandem repeat of metallothionein (ScMT3) was introduced to T. pseudonana as a GFP fusion at the N or C terminus. The mutants were analyzed in the case of the N-terminal GFP adduct, and TpSil3-GFP-ScMT3 was found to be localized in the frustule or a part of it (Fig. 2), indicating that ScMT3 was successfully expressed and transported onto the T. pseudonana cell wall. In contrast, we obtained no GFP-positive clones among nourseothricin-resistant colonies, which potentially express C-terminal GFP fusion of ScMT3. Possibly, the addition of GFP to the C terminus of ScMT3 destabilized the polypeptide itself or disturbed the folding of GFP tag. Immobilized ScMT3 on the T. pseudonana frustule is assumed to mainly harbor zinc derived from F/2 artificial seawater.
FIG 2
FIG 2 Immobilization of GFP-fused ScMetallothioneins (ScMT3) on the frustule of T. pseudonana. Bright field (BF), chlorophyll autofluorescence (FChl), and GFP fluorescence (FGFP) images were obtained and merged. GFP was fused to the N terminus of ScMT3. White scale bars = 2 μm.

Phosphotriesterase.

Phosphotriesterase catalyzes the hydrolysis of organic phosphates (11). It has been reported that the phosphotriesterase from the hyperthermophile Sulfolobus solfataricus (SsPTE) was successfully immobilized on positively charged alumina nanofiber (12). Immobilized SsPTE is expected to decompose refractory and toxic organic phosphates, such as pesticides and herbicides, in an environmentally innocuous manner. The display of SsPTE on frustules was confirmed by indirect immunofluorescence staining using an anti-FLAG antibody and secondary antibody conjugated with Alexa Fluor 488 (AF488) in comparison with wild-type cells. In lysed cells of the transformant, chlorophyll autofluorescence was no longer detected, and the green fluorescence derived from AF488 was observed in the frustule labeled by 2-(4-pyridyl)-5-[(4-{2-dimethylaminoethylaminocarbamoyl}methoxy)-phenyl]oxazole (PDMPO), while no AF488 signal was detected in wild-type cells (Fig. 3A). Immobilization of SsPTE on the frustule was also verified by enzyme assay. The hydrolysis rate of the pesticide paraoxon was determined as the SsPTE activity in the extracted frustule. Unlike the frustule of wild-type T. pseudonana, the mutant frustules exhibited the activity at approximately 7 nmol (mg frustule)−1 · min−1 (Fig. 3B), indicating that the immobilized SsPTE sustained its activity during the process of frustule extraction. The recombinant SsPTE protein produced by Escherichia coli was reported to catalyze the hydrolysis of paraoxon at about 350 nmol (mg protein)−1 · min−1 at pH 8 at 70°C (11). Although it is still unclear how many proteins are immobilized on the frustule and how much activity was sustained in the immobilized form, here, we estimated the immobilization yield (%) of SsPTE to the frustule simply as the ratio (wt/wt) of the target protein amount to the frustule weight. The enzyme reaction rates with saturated substrate concentrations were determined at the purified protein level (Vp) in a previous report (11) and at the extracted frustule level (Vf) in this study (Fig. 3B), as shown in equations 1 and 2, respectively.
VP =350 nmol (mg protein)–1 min–1
(1)
Vf =7 nmol (mg frustule)–1 min–1
(2)
FIG 3
FIG 3 Immobilization of SsPhosphotriesterase (SsPTE) on the frustule of T. pseudonana. (A) Immunofluorescence of FLAG-tagged SsPTE. Images of bright field (BF), chlorophyll autofluorescence (FChl), green fluorescence derived from Alexa Fluor 488 (FAF488), and PDMPO fluorescence (FPDMPO) were observed. The wild-type cells were also observed as a control. White scale bars = 2 μm. (B) Enzyme activity of immobilized SsPTE. Data are shown as means with standard deviations (n =3, biological replicates). Asterisk indicates significant difference between wild type and mutant (**, P < 0.01).
With the assumption that enzyme activity was the same in the immobilized form as the reported value from the recombinant protein produced by E. coli, Vf can be represented as shown in equation 3.
Vf = VP×immobolization yield
(3)
Finally, the amount of immobilized protein per frustule (%) can be roughly estimated in reference to the values of enzyme reaction rates. This idea gave a rough estimation for the immobilization yield of SsPTE in LiDSI as 2% (wt/wt).

Choline oxidase.

Choline oxidase catalyzes the one-step oxidation of choline to betaine with the generation of hydrogen peroxide (H2O2) in microorganisms such as the soil bacterium Arthrobacter globiformis, which was utilized for genetic engineering of enhanced glycine betaine biosynthesis in plants (13). Glycine betaine is a compatible solute which accumulates in the cells of halophytes under abiotic stresses. Foliar application of glycine betaine biosynthesis enhanced photosynthetic activity and fruit yield in tomato plants grown in saline soils (14). The A. globiformis choline oxidase (AgCOD) has been applied to platinum to develop a choline-sensor element (15). We succeeded in immobilizing AgCOD by LiDSI, as shown by the immunofluorescence detected on the frustule labeled by PDMPO (Fig. 4A). AgCOD activity was also assessed via H2O2-dependent peroxidation to form quinoneimine dye in the frustule extracted from wild-type cells and mutants, giving an oxidation rate of choline of approximately 14 nmol (mg frustule)−1 · min−1 in the mutant frustules (Fig. 4B), while wild-type frustule showed no COD activity. Choline oxidase requires FAD as the cofactor for its activity. That is, the incorporation of FAD into AgCOD functioned in the diatom cells as reported previously (2). In the AgCOD recombinant protein expressed by E. coli, the catalytic activity was reported to be approximately 5 μmol (mg protein)−1  · min−1 at a pH of 7.0 at 25°C (16). In a rough estimation, enzyme activity equivalent to 0.3% (wt/wt) of protein per frustule was effectively appended on the silica frustule of T. pseudonana.
FIG 4
FIG 4 Immobilization of AgCholine oxidase (AgCOD) on the frustule of T. pseudonana. (A) Immunofluorescence of FLAG-tagged AgCOD. Images of bright field (BF), chlorophyll autofluorescence (FChl), green fluorescence derived from Alexa Fluor 488 (FAF488), and PDMPO fluorescence (FPDMPO) were observed. White bars mean the scale 2 μm. (B) Enzyme activity of immobilized AgCOD. Data are shown as means with standard deviations (n =3, biological replicates). Asterisk indicates the significant difference between wild type and the mutant (**, P < 0.01).

Laccase.

Laccase (benzenediol:oxygen oxidoreductase), categorized into the multicopper oxidase family, oxidizes a variety of phenols with the low substrate specificity (17). Industrially, laccase is currently utilized for delignification of lignocellulosic materials, cross-linking of polysaccharides, bioremediation, and so on (18). Since bacterial laccase is reported to be more stable than fungal laccase (19), we targeted laccase derived from Bacillus subtilis (BsLaccase). BsLaccase was introduced into T. pseudonana with tags to TpSil3 and FLAG, which was successfully observed in the frustule as shown by the immunofluorescence (Fig. 5A). In the extracted frustule, the BsLaccase activity was measured with 2-2-azinobis (3-ethylbenzthiazoline-6-sulfonic acid) (ABTS) as the substrate. Trace phenol oxidase activity was detected also in the wild-type frustule, suggesting the occurrence of an unknown ABTS-oxidizing component in the frustule extracts of T. pseudonana. The mutant frustule showed significantly higher activity than the wild type, approximately corresponding to 0.6 nmol (mg frustule)−1 · min−1 (Fig. 5B). These data indicate that BsLaccase maintained activity on the silica frustule even after the extraction procedure. The BsLaccase recombinant protein produced by E. coli has been reported to show approximately 260 μmol (mg protein)−1 · min−1 for the substrate ABTS (20). With the tentative assumption that this enzyme activity was fully sustained on the T. pseudonana frustule, the immobilization yield was roughly estimated to be 0.0002% (wt/wt).
FIG 5
FIG 5 Immobilization of BsLaccase on the frustule of T. pseudonana. (A) Immunofluorescence of FLAG-tagged BsLaccase. Images of bright field (BF), chlorophyll autofluorescence (FChl), green fluorescence derived from Alexa Fluor 488 (FAF488), and 2-(4-pyridyl)-5-[(4-{2-dimethylaminoethylaminocarbamoyl}methoxy)-phenyl]oxazole (PDMPO) fluorescence (FPDMPO) were observed. White scale bars = 2 μm. (B) Enzyme activity of immobilized BsLaccase. Data are shown as means with standard deviations (n =3, biological replicates). Asterisk indicates significant difference between wild type and mutant (*, P < 0.05).

Branched-chain polyamine synthase.

Polyamines are ubiquitous aliphatic polycations containing two or more amino groups which play important roles in cell growth, development, chromatin structure modulation, regulation of cell proliferation and apoptosis, and stress adaptation (21, 22). Long-chain polyamines, including 1,3-diaminopropane and putrescine, are known to accumulate in the frustule of T. pseudonana, and are suggested to directly deposit silica and be important for the formation of the diatom frustule (23, 24). Meanwhile, branched-chain polyamines are not common in many organisms and are specifically found in (hyper)thermophilic bacteria and Euryarchaeota, which are important for stabilizing DNA and RNA at high temperature (6, 25, 26). TkBpsA catalyzes the conversion of spermidine to the branched-chain polyamine N4-bis(aminopropyl)spermidine [3(3)(3)4], where the numbers in brackets indicate the number of methylene (CH2) units between NH2, NH, N, or N+, through the intermediate N4-aminopropylspermidine [3(3)4]. Here, we sought to affect the polyamine structure and composition in the cell wall by immobilizing TpSil3-fused TkBpsA on the T. pseudonana frustule. The profile of the intracellular polyamines was analyzed by high-performance liquid chromatography (HPLC) using crude cell extract of the wild-type and mutant strains, because wild-type TkBpsA optimally reacts at 100°C and we used cold-acclimated mutants in this study. The mutants BpsA-D126A and -D158A were constructed by replacing Asp126 and Asp158 with Ala (26). Both mutants react at a range of 20°C - 30°C, which is the growth temperature of T. pseudonana CCMP1335. TkBpsA-D158A produces both N4-aminopropylspermidine [3(3)4] and N4-bis(aminopropyl)spermidine [3(3)(3)4], but TkBpsA-D126A cannot produce N4-bis(aminopropyl)spermidine. The accumulation of branched-chain polyamines was observed only in the mutant strains (Fig. 6) and was consistent with the products expected by previous studies (26). These data clearly supported successful immobilization of TkBpsA taking place in the cell. We next assessed the structure of the frustule by scanning electron microscopy. Both mutant strains showed smaller frustules (Fig. 7), suggesting that the intracellular polyamine composition has an impact on the silica morphology of T. pseudonana, possibly through changes in silica deposition in the cell wall. It is noteworthy that the number of strutted surface processes was also changed in the mutants (Fig. 7).
FIG 6
FIG 6 Polyamine composition in T. pseudonana and the transformants TpSil3-TkBpsA-D126A and TpSil3-TkBpsA-D158A. The intracellular polyamine composition of each trichloroacetic acid-precipitated extract of these cells was analyzed by high-performance liquid chromatography. Arrows indicate positions of standard branched-chain polyamine. 3(3)4, N4-aminopropylspermidine; 3(3)(3)4, N4-bis(aminopropyl) spermidine.
FIG 7
FIG 7 Effects of TkBpsA expression on the T. pseudonana frustule. (A) External view of the wild-type and mutant frustules by scanning electron microscopy. Black scale bars = 5 μm. The diameter of valves (B) and number of strutted process (C) were analyzed and are shown as means and standard deviation (n =50). Asterisks indicate significant differences by Student’s t test (*, P < 0.01).

Conclusions and perspectives.

Here, we report six successful examples of industrially valuable polypeptides immobilized on the frustule of T. pseudonana by LiDSI. The fluorescence microscopy results clearly indicate that the proteins were transported from the cytosol and incorporated onto the mature cell wall. The green fluorescence of GFP-fused ScMT3 was not detected all over the cell wall, unlike that of GFP-fused OkProtamine, suggesting that specific localization (e.g., valves and girdle bands) in the cell wall also depends on the features of the target polypeptides. The display and immobilized expression of SsPTE, AgCOD, and BsLaccase was confirmed also by enzyme assays of isolated frustules, which indicated that these three enzymes sustained their catalytic activities on the extracted frustule in the presence of 1% (wt/vol) octylphenoxy poly(ethyleneoxy)ethanol. The immobilization yields were roughly estimated from enzyme activities, compared with those of the recombinant proteins produced by E. coli, as the unit percentage of protein to frustule (wt/wt), respectively, giving 2%, 0.3%, and 0.0002% in SsPTE, AgCOD, and BsLaccase. These values reflect multiple parameters of the immobilized proteins—amount, stability, affinity with the frustule, and so on—which can be easy indicators for the accessibility of proteins to LiDSI. BsLaccase showed extremely low activity compared to the other enzymes, indicating that either the amount or activity of the protein was very low on the silica frustule or that the cell wall environment was far from the optimum condition for BsLaccase. We note that the exact immobilization yield is often less than 1% of proteins per frustules (2), implying that SsPTE immobilized on the diatom frustule showed higher activity than that expressed by E. coli. Introduction of branched-chain polyamine into T. pseudonana caused by the immobilized TkBpsA affected the morphology of the T. pseudonana frustule (Fig. 6 and 7), suggesting the possibility of engineering the biosilica structure using LiDSI. It has been recently reported that silica morphology and material have crucial effects on enzyme activity (7, 27). The detailed profiles of immobilized proteins and the frustule structure remain to be characterized for future work for application in technological processes.

MATERIALS AND METHODS

Cultures.

The marine diatom T. pseudonana (Hustedt) Hasle et Heimdal (CCMP 1335) was grown axenically and photoautotrophically cultured in artificial seawater medium with the addition of 0.31% half-strength Guillard’s ‘F’ solution (28, 29) supplemented with 10 nM sodium selenite under continuous light (20°C, 40 μmol photons m−2 · s−1, fluorescent lamp). The cultures were aerated with ambient air.

Heterologous expression of polypeptides in the T. pseudonana frustule.

For the heterologous expression of polypeptides in the T. pseudonana frustule, we used the plasmid pTpNR/TpSil3-gfp, which was generated by introducing TpSil3, FLAG, and GFP into pTpNR (2, 30). There are SalI and NotI restriction sites before and after the GFP gene in pTpNR/TpSil3-gfp. For OkProtamine and ScMT3, we sought to express the polypeptides as GFP-fusion proteins. For the latter four proteins, we constructed plasmids to be expressed in the form of FLAG-tagged proteins (Fig. S1). The primers used in this study are shown in Table 2. For the cloning of OkProtamine, AgCOD, and BsLaccase, we used codon-optimized synthetic genes (Thermo Fisher Scientific, Waltham, MA; Table S1). ScMetallothionein was codon-optimized by changing an adenine to guanine (c. 15 A → G), which was cloned into pMD19 vector (Takara Bio, Shiga, Japan) with the PstI site to the 5′ end and the NsiI, HindIII, EcoRI, and PstI sites to the 3′ end. Using these restriction sites, the coding region for ScMetallothionein was additionally introduced twice to generate the triplicate-repeat-ScMetallothionein coding sequence, termed ScMT3, which was finally cloned into the NotI restriction site in pTpNR/TpSil3-gfp (Fig. S1). The coding regions of SsPTE and TkBpsA were obtained from S. solfataricus and T. kodakarensis cDNA and cloned into the SalI/NotI restriction site in pTpNR/TpSil3-gfp. After the cloning, two different point mutations (D126A and D158A, respectively) were generated by PCR in TkBpsA (26).
TABLE 2
TABLE 2 Primers used in this study
PrimerSequence (5′−3′)
OkProtamine_NotI_FAGCGGCCGCACCTCGCCGCCGTCGCTC
OkProtamine_NotI_RATAATAATGCGGCCGCCTAGCGGCGGCGGCGGCCA
OkProtamine_SalI_FACGCGTCGACCCTCGCCGCCGTCGCTCTTCTT
OkProtamine_SalI_RACGCGTCGACGCGGCGGCGGCGGCCAC
ScMT1_PstI_FCAAGGGAAAGAGTGGGAAGAACACGTATCACCCCTTCTC
ScMT1_NsiIHindIIIEcoRIPstI_RCTGCCGTTCGACGATTCTGCAGGAATTCACCACTAAGCTTACTTCCATGCATTTTCCCAGAGCAGCATGACT
ScMT2_PstI_FAACTGCAGTTCAGCGAATTAATTAACTTCCAAAA
ScMT2_HindIII_RCCCAAGCTTTTTCCCAGAGCAGCATGA
ScMT3_HindIII_FCCCAAGCTTTTCAGCGAATTGATTA
ScMT3_EcoRI_RCCGGAATTCTTTCCCAGAGCAGCA
ScMT3_NotI_FGCATGGACGAGCTGTACAAGATGTTCAGCGAATTGAT
ScMT3_NotI_RAAAACGATGAGCATCCTCATTATTTCCCAGAGCAGCAT
BsLaccase_SalINotI_FTGATGATGATAAGGTCGACAACACGTATCACCCCTTCTCG
BsLaccase_SalINotI_RGAGCATCCTCAGCGGCCGCTTAGGCTTCCTTCATGC
SsPTE_SalINotI_FACGCGTCGACAGAATACCATTAGTTGGGAAAGA
SsPTE_SalINotI_RTTTTCCTTTTGCGGCCGCTTAGCTGAAGAACTTTTTCGGAT
AgCOD_SalINotI_FACGCGTCGACCACATCGACAACATCGAGAACCTC
AgCOD_SalINotI_RAAGGAAAAAAGCGGCCGCTTAAGCGAGAGCGGCAGACAGTTCAGCA
TkBpsA_SalINotI_FAAAGTCGACATGAGGGAGATAATTG
TkBpsA_SalINotI_RAAAGCGGCCGCTCAGGTAGTCGAGCTC
The resulting plasmids were introduced into the T. pseudonana cells by biolistic particle bombardment (PDS-1000/He, Bio-Rad, Hercules, CA) as previously described (31, 32). Transformants were screened on 1.5% (wt/vol) agar plate with F/2ASW medium containing 100 μg · mL−1 nourseothricin (Jena Bioscience, Jena, Germany).

Fluorescence microscopy.

Expression of GFP-fused proteins was observed with confocal fluorescence microscopy using a Leica TCS SP8 microscope (Leica, Wetzlar, Germany). The mutant cells grown in liquid medium were collected at the logarithmic growth phase. Chlorophyll autofluorescence was evaluated from the emission between 600 and 750 nm by excitation with a 552-nm laser. GFP was excited by a 488-nm laser, and green fluorescence was detected at 500 to 520 nm.
The proteins expressed with the FLAG tag were analyzed by immunofluorescence microscopy. The wild-type and mutant cells grown in liquid medium for 1 week in the presence of PDMPO were harvested and treated with 50% (vol/vol) Pipe-Unish (SC Johnson, Racine, WI) for 5 min at room temperature. The lysed cells were washed five times with distilled water and three times with phosphate-buffered saline. The resulting T. pseudonana frustule was incubated in a phosphate-buffered saline containing 1% (wt/vol) bovine serum albumin overnight and then reacted with the specific antibody to the FLAG tag (1E6, Wako, Osaka, Japan). The secondary antibody AF488-labeled anti-mouse IgG (Thermo Fisher Scientific) was excited by a 488-nm laser, and green fluorescence was detected at 500 to 520 nm by a TCS SP8 microscope (Leica). To label the silica frustule, PDMPO was excited by a 405-nm laser and green fluorescence was detected at 520 to 540 nm.

Enzyme assays.

The wild-type and mutant cells were harvested during the logarithmic growth phase and disrupted by sonication (UD-201, Tomy, Tokyo, Japan) in 50 mM sodium acetate (pH 5.2). The disrupted cells were centrifugally harvested and incubated in 50 mM sodium acetate (pH 5.2) containing 1% (wt/vol) octylphenoxy poly(ethyleneoxy)ethanol (Igepal CA-630) for 5 min at room temperature (1, 2). The pellet was washed with the same buffer three times and twice with 100 mM Tris-HCl (pH 8.0). The weight of the extracted frustules was determined after drying overnight at room temperature.
SsPTE activity was evaluated from the hydrolysis of paraoxon to diethyl phosphate and 4-nitrophenol. The reaction mixture contained 20 mM Tris-HCl (pH 8.0), 0.5 mM paraoxon, and an arbitrary amount of dried frustule. The reaction was performed at 70°C for 3 h and then stopped by the addition of 1 M NaOH. The frustules were quickly removed by filtration, and the SsPTE activity was defined as the production rate of 4-nitrophenol estimated from the increased absorbance at 405 nm in the supernatant (ε405 = 17,000 M−1 · cm−1) (33).
The activity of AgCOD immobilized on the frustules was spectroscopically measured through the production of H2O2. The reaction mixture contained 100 mM Tris-HCl (pH 8.0), 140 mM choline chloride, 2 mM KCl, 30 μM EDTA, 0.5 mM 4-aminoantipyrine, 2 mM phenol, 5 U · mL−1 horseradish peroxidase, and an arbitrary amount of dried frustule. The reaction was performed at 37°C for 4 min, and then the frustules were quickly removed by filtration. The AgCOD activity was defined as the production of H2O2 by AgCOD, which was determined from the increased absorbance at 500 nm (ε500 = 12,000 M−1 · cm−1) derived from quinoneimine dye generated by H2O2-dependent oxidation of 4-aminoantipyrine and phenol in the presence of peroxidase (34).
The activity of BsLaccase immobilized on the T. pseudonana frustules was measured with ABTS. The reaction mixture contained 100 mM sodium acetate (pH 4.0), 1 mM CuSO4, 10 mM ABTS, and an arbitrary amount of dried frustule. Thirty min after the oxidation of ABTS at 85°C, the frustules were quickly removed by filtration. The BsLaccase activity was defined as the production rate of ABTS2+ evaluated from the increased absorbance at 405 nm in the supernatant (ε405 = 36,000 M−1 · cm−1) (35, 36).

Determination of polyamines.

T. pseudonana CCMP1335 and its transformant cells were cultivated as previously described and harvested by centrifugation. Cells were then suspended in 50 mM phosphate buffer (pH 6.0) and disrupted by sonication. After centrifugation, supernatant was obtained and mixed with 10% trichloroacetic acid. The mixture was centrifuged, and the supernatant was filtered with a 0.45-μm Millex-LH Filter (Millipore, Bedford, MA). Each supernatant (100 μL) was analyzed by HPLC on a CK-10S cation-exchange column (6.0 mm I.D. × 50 mm; GL Science, Tokyo, Japan). The column was equilibrated with an elution buffer [100 mM potassium citrate monohydrate, 2.0 M KCl, 650 mM 2-propanol, and 2.4 mM Brij 35 (pH 3.2) (Wako, Osaka, Japan) adjusted by adding 65.0 mL of 3 M HCl per L] at a flow rate of 1.0 mL · min−1 at 70°C. The eluted polyamines were automatically mixed with a detection buffer composed of 400 mM boric acid, 400 mM NaOH, 4.9 mM Brij35, 7.5 mM O-phthalaldehyde, 171 mM ethanol, and 28 mM 2-mercaptoethanol at a flow rate of 0.5 mL · min−1 at 70°C and monitored with a fluorescence detector (GL-7453A, GL Science).

Electron microscopy.

T. pseudonana cells at the logarithmic growth phase were filtrated with filter paper (Millipore), dried, attached to the carbon tape, and platinum-vapored using an MSP-mini (Vacuum Device, Ibaraki, Japan). The pressurization voltage of the electron beam was set to 15 kV, and cells were observed using a MiniscopeR TM3030 scanning electron microscope (Hitachi High-Technologies Corporation, Tokyo, Japan).

Data availability.

The amino acid sequences of the polypeptides used in this study can be found in UniProt (https://www.uniprot.org/) by the following accession numbers: OkProtamine, P69014; ScMetallothionein, P0CX80; SsPTE, Q97VT7; AgCOD, Q7X2H8; and BsLaccase, H8WGE7; TkBpsA, Q5JIZ3.

ACKNOWLEDGMENTS

We thank Natsuki Ohnishi and Hikari Hayashi for experimental assistance. We thank Nicole Poulsen and Nils Kröger (Technische Universität Dresden) for the kind gift of the pTpNR plasmid containing TpSil3. We thank Nicole Poulsen for her critical reading of the manuscript. We also thank Katsunori Tanaka (Kwansei Gakuin University) for kindly providing the wild-type strains of S. cerevisiae.
Y.M. conceived the research plans; all authors performed experiments; G.S. analyzed the data and wrote the manuscript with assistance from S.F. and Y.M.
This work was mainly supported by the Japan Society for the Promotion of Science (JSPS) KAKENHI (19H01153 to Y.M.) and by JST CREST “Cell dynamics” (grant no. JPMJCR20E1 to Y.M.). Branched-chain polyamine expression was supported by JSPS KAKENHI (21H02112 to S.F.).
The authors have no conflicts of interest to declare.

Supplemental Material

File (aem.01153-22-s0001.pdf)
ASM does not own the copyrights to Supplemental Material that may be linked to, or accessed through, an article. The authors have granted ASM a non-exclusive, world-wide license to publish the Supplemental Material files. Please contact the corresponding author directly for reuse.

REFERENCES

1.
Poulsen N, Berne C, Spain J, Kröger N. 2007. Silica immobilization of an enzyme through genetic engineering of the diatom Thalassiosira pseudonana. Angew Chem Int Ed Engl 46:1843–1846.
2.
Sheppard VC, Scheffel A, Poulsen N, Kröger N. 2012. Live diatom silica immobilization of multimeric and redox-active enzymes. Appl Environ Microbiol 78:211–218.
3.
Avnir D, Coradin T, Lev O, Livage J. 2006. Recent bio-applications of sol-gel materials. J Mater Chem 16:1013–1030.
4.
Mansur HS, Oréfice RL, Vasconcelos WL, Lobato ZP, Machado LJC. 2005. Biomaterial with chemically engineered surface for protein immobilization. J Mater Sci Mater Med 16:333–340.
5.
Delalat B, Sheppard VC, Rasi Ghaemi S, Rao S, Prestidge CA, McPhee G, Rogers M-L, Donoghue JF, Pillay V, Johns TG, Kröger N, Voelcker NH. 2015. Targeted drug delivery using genetically engineered diatom biosilica. Nat Commun 6:8791.
6.
Terui Y, Ohnuma M, Hiraga K, Kawashima E, Oshima T. 2005. Stabilization of nucleic acids by unusual polyamines produced by an extreme thermophile, Thermus thermophilus. Biochem J 388:427–433.
7.
Kumari E, Görlich S, Poulsen N, Kröger N. 2020. Genetically programmed regioselective immobilization of enzymes in biosilica microparticles. Adv Funct Mater 30:2000442.
8.
Coyle P, Philcox JC, Carey LC, Rofe AM. 2002. Metallothionein: the multipurpose protein. Cell Mol Life Sci 59:627–647.
9.
Miura T, Muraoka S, Ogiso T. 1997. Antioxidant activity of metallothionein compared with reduced glutathione. Life Sciences 60:301–309.
10.
Lin K-H, Chien M-F, Hsieh J-L, Huang C-C. 2010. Mercury resistance and accumulation in Escherichia coli with cell surface expression of fish metallothionein. Appl Microbiol Biotechnol 87:561–569.
11.
Merone L, Mandrich L, Rossi M, Manco G. 2005. A thermostable phosphotriesterase from the archaeon Sulfolobus solfataricus: cloning, overexpression and properties. Extremophiles 9:297–305.
12.
Ng FSW, Wright DM, Seah SYK. 2011. Characterization of a phosphotriesterase-like lactonase from Sulfolobus solfataricus and its immobilization for disruption of quorum sensing. Appl Environ Microbiol 77:1181–1186.
13.
Sakamoto A, Murata N. 2000. Genetic engineering of glycinebetaine synthesis in plants: current status and implications for enhancement of stress tolerance. J Exp Bot 51:81–88.
14.
Mäkelä P, Jokinen K, Kontturi M, Peltonen-Sainio P, Pehu E, Somersalo S. 1998. Foliar application of glycinebetaine—a novel product from sugar beet—as an approach to increase tomato yield. Ind Crop Product 7:139–148.
15.
Shi H, Yang Y, Huang J, Zhao Z, Xu X, Anzai J-I, Osa T, Chen Q. 2006. Amperometric choline biosensors prepared by layer-by-layer deposition of choline oxidase on the Prussian blue-modified platinum electrode. Talanta 70:852–858.
16.
Fan F, Ghanem M, Gadda G. 2004. Cloning, sequence analysis, and purification of choline oxidase from Arthrobacter globiformis: a bacterial enzyme involved in osmotic stress tolerance. Arch Biochem Biophys 421:149–158.
17.
Giardina P, Faraco V, Pezzella C, Piscitelli A, Vanhulle S, Sannia G. 2010. Laccases: a never-ending story. Cell Mol Life Sci 67:369–385.
18.
Madhavi V, Lele S. 2009. Laccase: properties and applications. BioResources 4:1694–1717.
19.
Arregui L, Ayala M, Gómez-Gil X, Gutiérrez-Soto G, Hernández-Luna CE, Herrera de los Santos M, Levin L, Rojo-Domínguez A, Romero-Martínez D, Saparrat MCN, Trujillo-Roldán MA, Valdez-Cruz NA. 2019. Laccases: structure, function, and potential application in water bioremediation. Microb Cell Fact 18:200.
20.
Khodakarami A, Goodarzi N, Hoseinzadehdehkordi M, Amani F, Khodaverdian S, Khajeh K, Ghazi F, Ranjbar B, Amanlou M, Dabirmanesh B. 2018. Rational design toward developing a more efficient laccase: catalytic efficiency and selectivity. Int J Biol Macromol 112:775–779.
21.
Tabor CW, Tabor H. 1985. Polyamines in microorganisms. Microbiol Rev 49:81–99.
22.
Miller-Fleming L, Olin-Sandoval V, Campbell K, Ralser M. 2015. Remaining mysteries of molecular biology: the role of polyamines in the cell. J Mol Biol 427:3389–3406.
23.
Kröger N, Lorenz S, Brunner E, Sumper M. 2002. Self-assembly of highly phosphorylated silaffins and their function in biosilica morphogenesis. Science 298:584–586.
24.
Sumper M, Lorenz S, Brunner E. 2003. Biomimetic control of size in the polyamine-directed formation of silica nanospheres. Angew Chem 115:5350–5353.
25.
Okada K, Hidese R, Fukuda W, Niitsu M, Takao K, Horai Y, Umezawa N, Higuchi T, Oshima T, Yoshikawa Y, Imanaka T, Fujiwara S. 2014. Identification of a novel aminopropyltransferase involved in the synthesis of branched-chain polyamines in hyperthermophiles. J Bacteriol 196:1866–1876.
26.
Hidese R, Tse KM, Kimura S, Mizohata E, Fujita J, Horai Y, Umezawa N, Higuchi T, Niitsu M, Oshima T, Imanaka T, Inoue T, Fujiwara S. 2017. Active site geometry of a novel aminopropyltransferase for biosynthesis of hyperthermophile-specific branched-chain polyamine. FEBS J 284:3684–3701.
27.
Gousia B, Cathleen O, Martin O, Stefan K, Eike B, Nils K. 2019. Influence of silica architecture on the catalytic activity of immobilized glucose oxidase. Bioinspired Biomimetic Nanobiomater 8:72–80.
28.
Guillard RRL. 1975. Culture of phytoplankton for feeding marine invertebrates, p 29–60. In Smith WL, Chanley MH (ed), Culture of marine invertebrate animals. Springer US, Boston, MA.
29.
Guillard RRL, Ryther JH. 1962. Studies of marine planktonic diatoms: I. Cyclotella nana hustedt, and Detonula confervacea (cleve) gran. Can J Microbiol 8:229–239.
30.
Poulsen N, Chesley PM, Kröger N. 2006. Molecular genetic manipulation of the diatom Thalassiosira pseudonana (Bacillariophyceae). J Phycol 42:1059–1065.
31.
Zaslavskaia LA, Lippmeier JC, Kroth PG, Grossman AR, Apt KE. 2001. Transformation of the diatom Phaeodactylum tricornutum (Bacillariophyceae) with a variety of selectable marker and reporter genes. J Phycol 36:379–386.
32.
Nawaly H, Tsuji Y, Matsuda Y. 2020. Rapid and precise genome editing in a marine diatom, Thalassiosira pseudonana by Cas9 nickase (D10A). Algal Res 47:101855.
33.
Hiblot J, Gotthard G, Chabriere E, Elias M. 2012. Structural and enzymatic characterization of the lactonase SisLac from Sulfolobus islandicus. PLoS One 7:e47028.
34.
Okabe H, Sagesaka K, Nakajima N, Noma A. 1977. New enzymatic assay of cholinesterase activity. Clinica Chimica Acta 80:87–94.
35.
Yaropolov AI, Skorobogat’ko OV, Vartanov SS, Varfolomeyev SD. 1994. Laccase. Appl Biochem Biotechnol 49:257–280.
36.
Heinzkill M, Bech L, Halkier T, Schneider P, Anke T. 1998. Characterization of laccases and peroxidases from wood-rotting fungi (family Coprinaceae). Appl Environ Microbiol 64:1601–1606.

Information & Contributors

Information

Published In

cover image Applied and Environmental Microbiology
Applied and Environmental Microbiology
Volume 88Number 218 November 2022
eLocator: e01153-22
Editor: Nicole R. Buan, University of Nebraska-Lincoln
PubMed: 36226967

History

Received: 8 July 2022
Accepted: 20 September 2022
Published online: 13 October 2022

Permissions

Request permissions for this article.

Keywords

  1. protein immobilization
  2. silica frustule
  3. protamine
  4. metallothionein
  5. phosphotriesterase
  6. choline oxidase
  7. laccase
  8. polyamine synthase

Contributors

Authors

Department of Bioscience, School of Biological and Environmental Sciences, Kwansei Gakuin University, Sanda, Hyogo, Japan
Shota Katayama
Department of Bioscience, School of Biological and Environmental Sciences, Kwansei Gakuin University, Sanda, Hyogo, Japan
Department of Bioscience, School of Biological and Environmental Sciences, Kwansei Gakuin University, Sanda, Hyogo, Japan
Department of Bioscience, School of Biological and Environmental Sciences, Kwansei Gakuin University, Sanda, Hyogo, Japan
Department of Bioscience, School of Biological and Environmental Sciences, Kwansei Gakuin University, Sanda, Hyogo, Japan
Department of Bioscience, School of Biological and Environmental Sciences, Kwansei Gakuin University, Sanda, Hyogo, Japan
Department of Bioscience, School of Biological and Environmental Sciences, Kwansei Gakuin University, Sanda, Hyogo, Japan

Editor

Nicole R. Buan
Editor
University of Nebraska-Lincoln

Notes

The authors declare no conflict of interest.

Metrics & Citations

Metrics

Note:

  • For recently published articles, the TOTAL download count will appear as zero until a new month starts.
  • There is a 3- to 4-day delay in article usage, so article usage will not appear immediately after publication.
  • Citation counts come from the Crossref Cited by service.

Citations

If you have the appropriate software installed, you can download article citation data to the citation manager of your choice. For an editable text file, please select Medlars format which will download as a .txt file. Simply select your manager software from the list below and click Download.

View Options

Figures and Media

Figures

Media

Tables

Share

Share

Share the article link

Share with email

Email a colleague

Share on social media

American Society for Microbiology ("ASM") is committed to maintaining your confidence and trust with respect to the information we collect from you on websites owned and operated by ASM ("ASM Web Sites") and other sources. This Privacy Policy sets forth the information we collect about you, how we use this information and the choices you have about how we use such information.
FIND OUT MORE about the privacy policy