Research Article
21 May 2015

Development and Application of a Blastocystis Subtype-Specific PCR Assay Reveals that Mixed-Subtype Infections Are Common in a Healthy Human Population

ABSTRACT

The human gut is host to a diversity of microorganisms, including the single-celled microbial eukaryote Blastocystis. Research has shown that most carriers host a single Blastocystis subtype (ST), which is unusual given the considerable within-host species diversity observed for other microbial genera in this ecosystem. However, our limited knowledge of both the incidence and biological significance of Blastocystis diversity within hosts (i.e., so-called mixed infections) is likely due to problems with existing methodologies. Here, we developed and applied Blastocystis ST-specific PCRs for the investigation of the most common subtypes of Blastocystis (ST1 to ST4) to a healthy human cohort (n = 50). We detected mixed infections in 22% of the cases, all of which had been identified as single-ST infections in a previous study using state-of-the-art methods. Our results show that certain STs occur predominantly as either single (ST3 and 4) or mixed (ST1) infections, which may reflect inter alia transient colonization patterns and/or cooperative or competitive interactions between different STs. Comparative analyses with other primers that have been used extensively for ST-specific analysis found them unsuitable for detection of mixed- and, in some cases, single-ST infections. Collectively, our data shed new light on the diversity of Blastocystis within and between human hosts. Moreover, the development of these PCR assays will facilitate future work on the molecular epidemiology and significance of mixed infections in groups of interest, including health and disease cohorts, and also help identify sources of Blastocystis transmission to humans, including identifying potential animal and environmental reservoirs.

INTRODUCTION

The human gut is a complex, open-ended ecosystem that is host to a diversity of microorganisms, including the single-celled microbial eukaryote Blastocystis (1, 2). Blastocystis is a member of the Stramenopiles or Heterokonta branch of the Eukarya (3) and is phylogenetically distinct from other microbial species of Eukarya such as protozoa, molds, and yeasts that also colonize and/or infect the human gut. Blastocystis has a global distribution and is estimated to colonize between 1 billion and 2 billion people worldwide. In addition to humans, Blastocystis spp. are common inhabitants of the gastrointestinal tract (GIT) of a wide range of other mammalian and nonmammalian hosts, such as livestock, primates, reptiles, and insects (46). To date, 17 subtypes (STs) have been described, 9 of which have been detected in human populations. The majority of human-associated STs (∼90%), however, are categorized into one of four STs (ST1, ST2, ST3, and ST4) (4).
One of the most important recent advances in Blastocystis research is the development and application of sensitive PCR methodologies to study the prevalence and diversity of Blastocystis in human populations (79). Emerging data from such studies have indicated that there is significant variation in the distribution of Blastocystis STs within and between geographical regions, with prevalences ranging from 24% to 56% in developed countries and up to 100% in developing countries (1012). Given the widespread distribution of Blastocystis in both human and animal hosts and its unresolved status in human disease, much of the current Blastocystis research focuses on its role as a potential human pathogen (13, 14). However, in addition to furthering our knowledge of how this microbe impacts human health and disease, researchers also need to address many outstanding basic ecological issues regarding Blastocystis, including a better understanding of its diversity and functionality in the human host, its interactions with other components of the gut microbiota, and the factors that determine the variation in colonization patterns observed within and between individuals and populations of human hosts (12, 14, 15).
One outstanding topic that has received little attention is that of Blastocystis mixed “infections” or the ability of multiple different STs to co-colonize a single human host. The study of mixed infections is important for a number of reasons. First, from an ecological perspective, a detailed understanding of the diversity of different Blastocystis STs within and between individual hosts is required to gain insight into any potential competition or cooperation between Blastocystis STs, which may be a relevant factor for successful gut colonization, and more generally, this knowledge will further our understanding of the microbial eukaryotic diversity of the human intestinal tract (15). Second, the application of sensitive molecular PCR-based approaches that have the capacity to provide accurate assessments of Blastocystis ST diversity and distribution between different geographical regions, including health and disease cohorts, animal groups, and potential environmental reservoirs, is crucial to establishing any potential links between mixed infections, including specific mixed-ST infection combinations and symptomatic carriage, and sources of Blastocystis transmission to humans.
It is widely accepted that there are inherent difficulties in accurately assessing the distribution of mixed infections owing to the methodologies employed (4, 16, 17). In studies where information on mixed infections is available, this is generally given as an incidental finding, and the results are based primarily on data generated by one of three PCR-based methods. The first method relies on direct amplification of 18S ribosomal DNA (rDNA) by using universal and/or Blastocystis-specific primer pairs (e.g., RD5 and BhRDr), using DNAs extracted either from in vitro cultures of Blastocystis or directly from fecal material (9, 18). In this scenario, PCR products that yield a mixed trace based on chromatogram analysis of Sanger-sequenced products are indicative of a mixed infection; these products may then be cloned and sequenced to determine the presence of multiple subtypes (10, 19). The second method that has been used to report mixed infections is based on the use of ST-specific primers (sequence-tagged-site [STS] primers) (20), which are also used directly on DNAs extracted from fecal material or in vitro cultures (9, 17). Unfortunately, however, recent analyses have shown that these STS primers are insufficient for Blastocystis subtyping in human populations and give inconsistent results, even on DNAs extracted from the same small-subunit (SSU) rRNA allelic variant of certain STs (17). Finally, although it is no longer widely used, PCR-restriction fragment length polymorphism (PCR-RFLP) analysis of SSU rDNA has also been used in Blastocystis genotyping studies. In these studies, the presence of ambiguous PCR-RFLP profiles that cannot be classified is interpreted as evidence for mixed infections (16).
Currently, there is only one study that has explicitly investigated mixed infections of Blastocystis in humans (19). Based on an analysis of 50 clones, the authors of that study detected three different subtypes of Blastocystis within a single host (ST2, ST3, and ST4). However, a major drawback of that study is that the analysis was performed on one individual only, thus limiting a more general or wider interpretation regarding the prevalence and diversity of mixed-ST infections in human populations. Moreover, the preparation of multiple clone libraries to comprehensively analyze samples from studies with large cohorts of individuals is laborious and prohibitive.
Here, we designed a set of primers for use in a nested PCR assay to target the most common Blastocystis subtypes in the human population (ST1, ST2, ST3, and ST4) (4). In doing so, our aim was to develop a quick and accurate PCR- and sequence-based approach to assessing Blastocystis ST diversity in large studies with multiple samples, thereby circumventing the requirement for the more laborious preparation of individual clone libraries from single samples. We then used these primers to assess the incidence and diversity of Blastocystis mixed-ST infections in a group of healthy human hosts together with a comparative analysis of our data and those generated from existing primer sets available for ST detection (20, 21).

MATERIALS AND METHODS

Sample collection.

To test for mixed-subtype infections in individual samples, we analyzed 50 DNA samples from a previous study that had yielded a single Blastocystis-positive PCR product (12). In our previous analysis, no evidence of mixed infections for any of the samples was apparent based on chromatogram analysis of Sanger-sequenced PCR products amplified by using the commonly applied “barcoding” primers RD5 and BhRDr (12, 18). These samples were originally collected as part of a study of the intestinal microbiota in control and elderly populations (Eldermet study) (22). Full details of study participants are provided in Table S1 in the supplemental material, and DNA extraction methods are provided in the original report (22). DNA was extracted from xenic cultures of each Blastocystis ST used in this study by using the automated NucliSENS easyMag protocol (23).

Primer design and nested PCR optimization for mixed-ST infection analysis.

SSU rDNA Blastocystis subtype sequence data were downloaded from the PubMLST online database (http://www.pubmlst.org/blastocystis) and aligned by using ClustalW implemented in BioEdit (24). ST-specific forward primers targeting the 5′ end of the SSU rRNA locus for each of the most prevalent subtypes found in humans (ST1, ST2, ST3, and ST4) were designed, and details are provided in Table 1.
TABLE 1
TABLE 1 Primers used in this study
PrimerSequence (5′–3′)Target Blastocystis STSpecificityAnnealing temp (°C)Product size (bp)Reference
SB83 FGAAGGACTCTCTGACGATGAST1Unknown5635120
SB83 RGTCCAAATGAAAGGCAGCST1Unknown5635120
SB340 FTGTTCTTGTGTCTTCTCAGCTCST2Unknown6670420
SB340 RTTCTTTCACACTCCCGTCATST2Unknown6670420
SB227 FTAGGATTTGGTGTTTGGAGAST3Unknown6152620
SB227 RTTAGAAGTGAAGGAGATGGAAGST3Unknown6152620
SB337 FGTCTTTCCCTGTCTATTCTGCAST4Unknown5048720
SB337 RAATTCGGTCTGCTTCTTCTGST4Unknown5048720
STS1 FTAATACATGAGAAAGTCCTCTGGST118S rRNA5733621
STS1 RCTCAATCCAATTGCAAGACST118S rRNA5733621
STS2 FGCTCGTAGTTGAAGTGAGGGAGTGST218S rRNA65203–20421
STS2 RATCGAACACGAAAGCCTTCAATCST218S rRNA65203–20421
STS3 FGATTGAGAACAACGTACAAACCST318S rRNA58339–34121
STS3 RATGAACCAAACCAATCAAATACST318S rRNA58339–34121
RD5ATCTGGTTGATCCTGCCAGTAll18S rRNA55∼60018
BhRDrGAGCTTTTTAACTGCAACAACGAll18S rRNA55∼60018
ST1 FAGTCCTCTGGTGAGGTGTGTST118S rRNA58433Present study
ST2 FAGTAAAGTCCCGTAGGGATGST218S rRNA50459Present study
ST3 FGTCTTGTAGACTGCATST318S rRNA55427Present study
ST4 FaCCAAKAGACTTCGGTCTST418S rRNA50399Present study
a
ST4_F is a degenerate primer, and K denotes the presence of G or T.
We used the primer pair RD5 and BhRDr (Table 1) in the first step of a nested PCR protocol to provide template DNAs for each of the subsequent ST-specific PCRs (ST1, ST2, ST3, and ST4) (12). PCR conditions were initially optimized on DNAs extracted from pure cultures of Blastocystis from seven of the nine STs that have been detected in human populations (ST1, ST2, ST3, ST4, ST6, ST7, and ST8) to determine specificity and potential background amplification from nontarget STs. For the second step of the nested PCR, 2 μl of a fresh 1/50 dilution of the initial PCR product generated with the primer pair RD5 and BhRDr was used as the template DNA in a second PCR using the appropriate ST-specific forward primer and BhRDr. Each 50-μl PCR mixture contained 1× Biomix (Bioline) and 0.5 pmol of primer BhRDr and the relevant ST-specific forward primer (or RD5 in the first step of the assay). We tested each individual sample for the presence of each of the four STs in separate PCRs, with three technical replicates of each reaction. Cycling conditions consisted of an initial denaturation step at 94°C for 5 min, followed by 35 cycles at 94°C for 30 s, a variable annealing temperature depending on the primer combination for 30 s (Table 1), and an extension step at 72°C for 40 s, followed by a final extension step at 72°C for 5 min. All PCR products were cleaned (QIAquick PCR purification kit; Qiagen) prior to commercial sequencing (Source Bioscience, Ireland). Full details of all primer sequences used in this study, annealing temperatures, and product sizes are outlined in Table 1.

Analysis of mixed Blastocystis ST template PCRs generated with primer pair RD5 and BhRDr.

DNA from pure cultures of Blastocystis ST1, ST2, ST3, and ST4 were quantified by using the Qubit DNA quantification method (Molecular Probes). Equal concentrations (10 ng/μl) of each ST template were mixed to mimic any possible double infection (ST1 and ST2, ST1 and ST3, ST1 and ST4, ST2 and ST3, ST2 and ST4, and ST3 and ST4) (n = 6) and used as the DNA template for PCRs using the primers RD5 and BhRDr, as outlined above. Three technical replicates of each coinfection combination reaction were performed, and all products were cleaned prior to Sanger sequencing. Following analysis of these PCR products (see Results), we evaluated the efficiency of ST1 detection by the nested PCR assay in cases where ST1 was present at a much lower concentration than another ST (e.g., ST2, ST3, and ST4) in the starting template in the first step of our assay. To assess this, we mixed ST1 at 10−1, 10−2, and 10−3 ratios with each of the other STs, separately, and used these as starting template DNAs in PCRs using the primers RD5 and BhRDr. We then performed the second step of the PCR assay by diluting these products 1/50 and adding 2 μl to the second PCR mixture (the second step of the PCR assay) with the ST1-specific primer and BhRDr, as outlined above.

Comparative analysis with available subtyping primers.

During the development of the novel primer sets outlined in this study, a study investigating the molecular epidemiology and possible transmission of Blastocystis from pigs to humans was reported, which had developed primers for specific detection of Blastocystis ST1, ST2, ST3, and ST5 based on single-step PCR (21). To evaluate the efficiency of our nested PCR assay relative to that of these newly available primer sets, we performed a comparative PCR analysis using the primer sets for ST1, ST2, and ST3 on our 50 fecal DNA samples, in accordance with the PCR conditions outlined in that study (21).
Although it has already been demonstrated that the widely used STS primers are not appropriate for ST analysis in human studies (17), we also tested these primers on all our DNA samples for comparative purposes. PCR was performed as described in that study (see also Table 1).

RESULTS

Nested PCR analysis.

The results of our initial optimization on pure cultures of Blastocystis STs showed that our novel primers were highly specific for the targeted ST (i.e., no nontarget STs were amplified). We detected nonspecific amplification for two of our human fecal samples using the ST1 specific primer. In both of these cases, these primers amplified an ST4 sequence (which was the ST detected in the original analysis). Additional attempts to optimize PCR conditions and annealing temperatures did not eliminate nonspecific products for these two samples. Although no other cases of nonspecific amplification were detected for any other samples or primer sets, we recommend that all PCR products be sequenced.
The results of the ST-specific nested PCRs on fecal samples from healthy individuals are provided in Table 2. In our previous analysis, we did not detect any evidence of mixed infection based on chromatogram analysis of Sanger-sequenced PCR products (12). Using the newly developed primers, we detected mixed infections in 11/50 (∼22%) individuals analyzed in our data set. The most common types of mixed infection were ST1 and ST2 (n = 4), followed by ST1 and ST3 (n = 3), ST1 and ST4 (n = 2), one infection by ST3 and ST4, and, finally, a single case of triple infection by ST1, ST2, and ST3 (Table 2). ST1 was detected in 10/11 mixed infections, making it the most common ST found in mixed infections. Interestingly, ST1 occurred primarily as a mixed infection, whereas ST3 and ST4 occurred primarily as single infections (Fig. 1). Based on this new analysis, the relative prevalence of each ST in the population of hosts has changed since our initial analysis; for example, ST1 is present in almost twice as many hosts as was originally reported (Fig. 2A and B). One possible issue that we also considered and that we wished to rule out was that the presence of ST1 was due to potential contamination. In addition to including negative controls, three technical replicates of all PCRs conducted on separate days yielded the same results, and sequence variation in ST-specific PCR products established that contamination was not an issue.
TABLE 2
TABLE 2 Results of nested PCR assays using novel primer sets for Blastocystis ST-specific detection
SampleOriginal subtype detectedbResult of ST-specific nested PCRaType of infection
ST1ST2ST3ST4
EM10ST3  + Single
EM100ST2++  Double
EM101ST1+   Single
EM103ST3  + Single
EM104ST4  ++Double
EM105ST4   +Single
EM12ST3  + Single
EM13ST3  + Single
EM14ST4   +Single
EM17ST2 +  Single
EM18ST1+   Single
EM19ST2 +  Single
EM21ST3  + Single
EM23ST3  + Single
EM24ST1+  +Double
EM25ST4   +Single
EM27ST3  + Single
EM30ST3  + Single
EM36ST2+++ Triple
EM37ST1+   Single
EM39ST3+ + Double
EM40ST3  + Single
EM41ST2 +  Single
EM42ST4   +Single
EM45ST3  + Single
EM47ST4   +Single
EM5ST3  + Single
EM51ST4   +Single
EM53ST4   +Single
EM54ST3  + Single
EM56ST3  + Single
EM57ST3  + Single
EM58ST3  + Single
EM59ST3  + Single
EM6ST3  + Single
EM63ST2++  Double
EM65ST1+   Single
EM68ST2++  Double
EM7ST4   +Single
EM72ST2++  Double
EM73ST2 +  Single
EM75ST3+ + Double
EM76ST3+ + Double
EM79ST3  + Single
EM82ST4   +Single
EM85ST2 +  Single
EM86ST2 +  Single
EM93ST1+  +Double
EM96ST3  + Single
EM99ST3  + Single
a
+ denotes the presence of that ST, with the additional ST(s) detected being highlighted in boldface type.
b
Based on RD5 and BhRDr PCR and sequence analysis (see also reference 12).
FIG 1
FIG 1 Overview of the numbers and distribution of each Blastocystis ST in single versus mixed infections.
FIG 2
FIG 2 Overview of the relative Blastocystis subtype distribution in the entire data set based on data obtained in the original analysis (A) and in our revised analysis using our novel primer sets (B) (see also Table 2).

Mixed-ST template PCR analysis.

Given the high prevalence of ST1 in mixed infections and the lack of any evidence indicating mixed infection in our initial study (12), we tested if certain STs are preferentially amplified by using the primer pair RD5 and BhRDr. We found that even at equal starting concentrations, ST2, ST3, and ST4 were preferentially amplified over ST1 in each of the technical replicates, with no evidence of mixed templates in the sequence chromatogram analysis. Conversely, chromatogram analysis of the other ST combinations showed evidence of mixed traces (see Fig. S1 in the supplemental material). Note that we used DNA from ST1 allele 4 (http://www.pubmlst.org/blastocystis) (25) to assess amplification bias, as this ST1 allele variant accounts for >98% of ST1 alleles detected in human studies to date. Whether the primer pair RD5 and BhRDr preferentially amplifies other STs over additional ST1 alleles (aside from allele 4) is unknown. Crucially, however, our nested PCR assay was highly sensitive for the detection of ST1, even at starting DNA concentration ratios of 10−3 with other STs.

Comparative analysis of subtype primers for mixed-subtype analysis.

We compared the data generated by using the novel nested PCR assay to those generated when we employed two previously reported primer sets that are available for ST-specific analysis (20, 21) on the same samples, and the results are provided in Table S2 in the supplemental material. Using the primers reported by Wang and colleagues (21), we detected only a single Blastocystis subtype per individual sample; the STs detected by using these primers were the same as the STs that had been identified in the original analysis (Table 2; see also Table S2 in the supplemental material). We also tested the STS primers reported by Yoshikawa and colleagues (20), and as reported previously (17), they failed to generate PCR products in a number of instances. In particular, none of the samples that were positive for ST3 and ST4 in the initial analysis or in our current mixed-infection analysis gave a positive PCR product by the STS primers (see Table S2 in the supplemental material). No evidence of mixed infection was detected by using the STS primers.

DISCUSSION

The controversial role of Blastocystis in human disease and its widespread prevalence in both human and nonhuman hosts have led to increasing research into this enigmatic organism (26, 27). Even though it is widely established that different Blastocystis STs can colonize the human gut, the level of diversity of Blastocystis spp. within individuals is apparently low (4, 13, 16). Single infections with only one specific Blastocystis ST are typically reported, and in a recent analysis of Blastocystis species distribution in human populations, mixed infections were reported in less than half of the studies (43%, or 24 out of 55 studies) surveyed, with the overall prevalence of mixed infections being reported to be 6% (4).
Although it is not currently known why mixed infections are seemingly rare, a number of possible explanations can be considered. The most likely reason is that the methods used to generate data have been insufficient to address the issue of mixed-ST infections (16, 19). To redress this issue, we developed a set of novel primers and a nested PCR assay to specifically assess the incidence of Blastocystis mixed infections. Our novel ST-specific PCR protocol detected mixed infections in 11/50 (22%) cases, all of which had been overlooked in our previous analysis using state-of-the-art methods (12). These individuals were all healthy adults living in an industrialized country, with no history of gastrointestinal disease or symptoms indicative of blastocystosis (13). We observed 10 double infections and 1 triple infection; of the 11 coinfections, ST1 was detected in 10 cases, ST2 and ST3 were detected in 5 cases each, and ST4 was detected in 3 cases. Given the particularly high prevalence of ST1 revealed in mixed infections, we investigated the possibility that other common STs (i.e., ST2, ST3, and ST4) were preferentially amplified over ST1 (thereby resulting in ST1 being overlooked previously in many instances). Although we found this to be the case, and this result helps to explain why we failed to detect ST1 in mixed infections in the initial study, it is worth noting that an alternative explanation in some cases may be that ST1 is present at lower cell densities in vivo than other STs. Nonetheless, ST1 is twice as prevalent as previously reported for this data set and interestingly occurs more frequently in mixed infections than in single infections.
This is in stark contrast to ST3, the most prevalent ST in the entire data set (detected in 40% of hosts), which occurs primarily as a single infection. One intriguing scenario that our data may be reflecting is that ST1 is circulating in the population and host environment and is present in certain hosts as a transient colonizer (unfortunately, we do not have longitudinal samples for the individuals analyzed here that might help to assess this). Another possibility is that highly prevalent STs that occur more often in single infections than in mixed infections (such as ST3 in this specific population) may simply be better competitors in the intestinal environment; for example, once an ST3 strain becomes successfully established, it may outcompete other potential colonizers. Alternatively, specific in vivo factors that vary between individuals, such as diet or a specific microbiota that may be necessary to support multiple and/or specific Blastocystis subtypes, are absent within a given host. In this regard, the higher incidence of ST1 in mixed than in single infections may indicate that ST1 benefits from or relies on the presence of other STs for successful colonization. It is also worth considering that a low or high level of diversity of Blastocystis within a host may simply reflect the immune status of that host, exemplified by the possibility that any potentially colonizing strains or specific strains may be eliminated by a strong host response, or conversely, a low immune response (tolerance) to Blastocystis may allow multiple STs to co-colonize. Finally, host exposure to specific STs only is also relevant. However, in most human prevalence studies, hosts are typically limited to a relatively narrow geographical region with many different STs reported as single infections in the data set, which would indicate that different STs are present in the host environment and make it likely that the individuals in question are exposed to multiple subtypes. Therefore, a relevant extension of this study would be to investigate the factors that govern Blastocystis colonization and the specific factors that determine which ST ends up successfully colonizing the intestinal tract. Future work focusing on in vitro competition experiments between different STs could help shed light on this issue and address the relative importance of ecological interactions, such as competition between different ST isolates of Blastocystis, and successful host colonization.
Comparative analysis revealed that none of the existing primer sets tested were as sensitive as our nested PCR assay in detecting mixed infections. Although there have been no additional studies that have used the ST-specific primers since the report by Wang and colleagues (21), these primers failed to detect mixed infections in any of our samples in the current study. That PCR assay does not include a nested step, which may result in this assay amplifying the predominant ST in cases of mixed infection, as we alluded to above.
As outlined in a recent study, the STS primers were designed based on sequence data generated from randomly amplified polymorphic DNA, and target genes, as well as their copy numbers, remain unknown (17). Although these STS primers have been used extensively for ST-specific detection (4), our results verify recent reports that they may not be suitable for surveying Blastocystis isolates in certain populations (17). None of the samples that were positive for ST3 or ST4 in our original analysis or in our current mixed-infection analysis gave a positive PCR product with the STS primers designed to target these STs. This is not too surprising given that a recent analysis found that they did not amplify any ST4_42 alleles, which was the only ST4 allele detected in our data set (12), and gave sporadic positive PCR results for ST3 isolates, including alleles 34 and 36, which were the two ST3 alleles detected in our original analysis (12).
In conclusion, the application of our novel PCR assay highlights variation in the within-host Blastocystis diversity in a human population. Even though most individuals appear to host only a single Blastocystis ST, many individuals host multiple Blastocystis STs, indicating that the prevalence of Blastocystis mixed-ST infections is much greater than previously thought. Based on the data generated in our initial analysis (where we failed to detect any mixed infections) and our comparative analysis of data obtained with existing ST-specific primers (especially the STS primers that have been widely used [28, 29]) presented here, it is highly likely that the incidence of mixed-ST infections has been greatly underreported to date, owing to methodological limitations. The application of this ST-specific nested PCR assay to other cohorts of human samples, including those from specific disease groups, will enable further—and more detailed—studies of the biological significance of mixed infections. Moreover, the data presented here will facilitate further experimental work to better understand potential competitive or cooperative interactions between different STs and also other components of the gut microbiota, including bacteria. This will be necessary to determine the underlying factors responsible for the observed variation in patterns of Blastocystis colonization in human and animal populations and identify possible sources of Blastocystis transmission to humans.

ACKNOWLEDGMENTS

Pauline D. Scanlan is funded by a Marie Curie Intra-European Fellowship grant. Christen Rune Stensvold's research is partly funded by Marie Curie Career Integration grant number 321614.
Pauline D. Scanlan is grateful to Paul O'Toole for kindly providing access to Eldermet samples. We thank Graham Clark for providing culture material.

Supplemental Material

File (zam999116312so1.pdf)
ASM does not own the copyrights to Supplemental Material that may be linked to, or accessed through, an article. The authors have granted ASM a non-exclusive, world-wide license to publish the Supplemental Material files. Please contact the corresponding author directly for reuse.

REFERENCES

1.
Parfrey LW, Walters WA, Knight R. 2011. Microbial eukaryotes in the human microbiome: ecology, evolution, and future directions. Front Microbiol 2:153.
2.
Rajilic-Stojanovic M, de Vos WM. 2014. The first 1000 cultured species of the human gastrointestinal microbiota. FEMS Microbiol Rev 38:996–1047.
3.
Silberman JD, Sogin ML, Leipe DD, Clark CG. 1996. Human parasite finds taxonomic home. Nature 380:398.
4.
Alfellani MA, Stensvold CR, Vidal-Lapiedra A, Onuoha ES, Fagbenro-Beyioku AF, Clark CG. 2013. Variable geographic distribution of Blastocystis subtypes and its potential implications. Acta Trop 126:11–18.
5.
Alfellani MA, Taner-Mulla D, Jacob AS, Imeede CA, Yoshikawa H, Stensvold CR, Clark CG. 2013. Genetic diversity of Blastocystis in livestock and zoo animals. Protist 164:497–509.
6.
Scanlan PD, Marchesi JR. 2008. Micro-eukaryotic diversity of the human distal gut microbiota: qualitative assessment using culture-dependent and -independent analysis of faeces. ISME J 2:1183–1193.
7.
Poirier P, Wawrzyniak I, Albert A, El Alaoui H, Delbac F, Livrelli V. 2011. Development and evaluation of a real-time PCR assay for detection and quantification of Blastocystis parasites in human stool samples: prospective study of patients with hematological malignancies. J Clin Microbiol 49:975–983.
8.
Scanlan PD. 2012. Blastocystis: past pitfalls and future perspectives. Trends Parasitol 28:327–334.
9.
Stensvold CR. 2013. Blastocystis: genetic diversity and molecular methods for diagnosis and epidemiology. Trop Parasitol 3:26–34.
10.
El Safadi D, Gaayeb L, Meloni D, Cian A, Poirier P, Wawrzyniak I, Delbac F, Dabboussi F, Delhaes L, Seck M, Hamze M, Riveau G, Viscogliosi E. 2014. Children of Senegal River Basin show the highest prevalence of Blastocystis sp. ever observed worldwide. BMC Infect Dis 14:164.
11.
Bart A, Wentink-Bonnema EM, Gilis H, Verhaar N, Wassenaar CJ, van Vugt M, Goorhuis A, van Gool T. 2013. Diagnosis and subtype analysis of Blastocystis sp. in 442 patients in a hospital setting in the Netherlands. BMC Infect Dis 13:389.
12.
Scanlan PD, Stensvold CR, Rajilic-Stojanovic M, Heilig HG, De Vos WM, O'Toole PW, Cotter PD. 2014. The microbial eukaryote Blastocystis is a prevalent and diverse member of the healthy human gut microbiota. FEMS Microbiol Ecol 90:326–330.
13.
Tan KS, Mirza H, Teo JD, Wu B, Macary PA. 2010. Current views on the clinical relevance of Blastocystis spp. Curr Infect Dis Rep 12:28–35.
14.
Scanlan PD, Stensvold CR. 2013. Blastocystis: getting to grips with our guileful guest. Trends Parasitol 29:523–529.
15.
Andersen LO, Vedel Nielsen H, Stensvold CR. 2013. Waiting for the human intestinal eukaryotome. ISME J 7:1253–1255.
16.
Tan KS. 2008. New insights on classification, identification, and clinical relevance of Blastocystis spp. Clin Microbiol Rev 21:639–665.
17.
Stensvold CR. 2013. Comparison of sequencing (barcode region) and sequence-tagged-site PCR for Blastocystis subtyping. J Clin Microbiol 51:190–194.
18.
Scicluna SM, Tawari B, Clark CG. 2006. DNA barcoding of Blastocystis. Protist 157:77–85.
19.
Meloni D, Poirier P, Mantini C, Noel C, Gantois N, Wawrzyniak I, Delbac F, Chabe M, Delhaes L, Dei-Cas E, Fiori PL, El Alaoui H, Viscogliosi E. 2012. Mixed human intra- and inter-subtype infections with the parasite Blastocystis sp. Parasitol Int 61:719–722.
20.
Yoshikawa H, Wu Z, Kimata I, Iseki M, Ali IK, Hossain MB, Zaman V, Haque R, Takahashi Y. 2004. Polymerase chain reaction-based genotype classification among human Blastocystis hominis populations isolated from different countries. Parasitol Res 92:22–29.
21.
Wang W, Owen H, Traub RJ, Cuttell L, Inpankaew T, Bielefeldt-Ohmann H. 2014. Molecular epidemiology of Blastocystis in pigs and their in-contact humans in Southeast Queensland, Australia, and Cambodia. Vet Parasitol 203:264–269.
22.
Claesson MJ, Jeffery IB, Conde S, Power SE, O'Connor EM, Cusack S, Harris HM, Coakley M, Lakshminarayanan B, O'Sullivan O, Fitzgerald GF, Deane J, O'Connor M, Harnedy N, O'Connor K, O'Mahony D, van Sinderen D, Wallace M, Brennan L, Stanton C, Marchesi JR, Fitzgerald AP, Shanahan F, Hill C, Ross RP, O'Toole PW. 2012. Gut microbiota composition correlates with diet and health in the elderly. Nature 488:178–184.
23.
Andersen LO, Roser D, Nejsum P, Nielsen HV, Stensvold CR. 2013. Is supplementary bead beating for DNA extraction from nematode eggs by use of the NucliSENS easyMag protocol necessary? J Clin Microbiol 51:1345–1347.
24.
Hall T. 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp Ser 41:95–98.
25.
Stensvold CR, Alfellani M, Clark CG. 2012. Levels of genetic diversity vary dramatically between Blastocystis subtypes. Infect Genet Evol 12:263–273.
26.
Clark CG, van der Giezen M, Alfellani MA, Stensvold CR. 2013. Recent developments in Blastocystis research. Adv Parasitol 82:1–32.
27.
Roberts T, Stark D, Harkness J, Ellis J. 2014. Update on the pathogenic potential and treatment options for Blastocystis sp. Gut Pathog 6:17.
28.
Lee IL, Tan TC, Tan PC, Nanthiney DR, Biraj MK, Surendra KM, Suresh KG. 2012. Predominance of Blastocystis sp. subtype 4 in rural communities, Nepal. Parasitol Res 110:1553–1562.
29.
Moosavi A, Haghighi A, Mojarad EN, Zayeri F, Alebouyeh M, Khazan H, Kazemi B, Zali MR. 2012. Genetic variability of Blastocystis sp. isolated from symptomatic and asymptomatic individuals in Iran. Parasitol Res 111:2311–2315.

Information & Contributors

Information

Published In

cover image Applied and Environmental Microbiology
Applied and Environmental Microbiology
Volume 81Number 1215 June 2015
Pages: 4071 - 4076
Editor: M. W. Griffiths
PubMed: 25841010

History

Received: 16 February 2015
Accepted: 31 March 2015
Published online: 21 May 2015

Permissions

Request permissions for this article.

Contributors

Authors

Pauline D. Scanlan
Teagasc Food Research Centre, Moorepark, Fermoy, Cork, Ireland
Alimentary Pharmabiotic Centre, Biosciences Institute, University College Cork, Cork, Ireland
Laboratory of Parasitology, Department of Microbiology and Infection Control, Statens Serum Institut, Copenhagen, Denmark
Paul D. Cotter
Teagasc Food Research Centre, Moorepark, Fermoy, Cork, Ireland
Alimentary Pharmabiotic Centre, Biosciences Institute, University College Cork, Cork, Ireland

Editor

M. W. Griffiths
Editor

Notes

Address correspondence to Pauline D. Scanlan, [email protected].

Metrics & Citations

Metrics

Note:

  • For recently published articles, the TOTAL download count will appear as zero until a new month starts.
  • There is a 3- to 4-day delay in article usage, so article usage will not appear immediately after publication.
  • Citation counts come from the Crossref Cited by service.

Citations

If you have the appropriate software installed, you can download article citation data to the citation manager of your choice. For an editable text file, please select Medlars format which will download as a .txt file. Simply select your manager software from the list below and click Download.

View Options

Figures and Media

Figures

Media

Tables

Share

Share

Share the article link

Share with email

Email a colleague

Share on social media

American Society for Microbiology ("ASM") is committed to maintaining your confidence and trust with respect to the information we collect from you on websites owned and operated by ASM ("ASM Web Sites") and other sources. This Privacy Policy sets forth the information we collect about you, how we use this information and the choices you have about how we use such information.
FIND OUT MORE about the privacy policy