Rethinking Remdesivir: Synthesis, Antiviral Activity, and Pharmacokinetics of Oral Lipid Prodrugs

We synthesized the hexadecyloxypropyl-, octadecyloxyethyl-, and 1-O-octadecyl-2-O-benzyl-sn-glyceryl esters of RVn 5′-monophosphate. Compounds 5a to 5c were synthesized as shown in Fig. 2. Analyses by nuclear magnetic resonance (NMR), electrospray ionization (ESI) mass spectrometry, and high-performance liquid chromatography (HPLC) were consistent with each structure and demonstrated purities of >95%.

One of the disadvantages of remdesivir is its in vivo and ex vivo instability in plasma. In vivo, it has been reported to persist for less than 2 h after intravenous infusion in rhesus monkeys (13, 16, 19) and in COVID-19 patients (20). Ex vivo, remdesivir is not stable in human plasma, with a reported half-life (t_1/2) of 69 min (26). We tested the ex vivo stability of 1-O-octadecyl-2-O-benzyl-glycero-3-phosphate RVn (ODBG-P-RVn) in human plasma with either K₂EDTA or sodium heparin (NaHep) as anticoagulant. ODBG-P-RVn was added to human plasma and incubated at 37°C for 24 h. ODBG-P-RVn levels were measured at the indicated times by liquid chromatography-tandem mass spectrometry (LC-MS/MS) (Fig. 3). ODBG-P-RVn has a t_1/2 in human plasma of >24 h versus 69 min for remdesivir.

To determine if lipid RVn monophosphate prodrugs inhibit SARS-CoV-2 RNA replication, we performed antiviral assays using a clinical isolate of SARS-CoV-2 (2019-nCoV/USA-WA1/2020) in multiple cell lines: African green monkey kidney cells (Vero E6), human PSC-derived lung (PSC-lung) cells, human lung epithelial cell line Calu-3, human colonic epithelial cell line Caco-2, and human hepatocyte cell line Huh7.5. Each cell line was treated with the above-indicated compounds for 30 min prior to infection and incubated for 48 h postinfection. Intracellular viral RNA was measured by quantitative reverse transcription-PCR (qRT-PCR). In all cell lines, there was a dose-dependent inhibition of viral RNA by ODBG-P-RVn, ODE-P-RVn, octadecyloxyethyl phosphate RVn (HDP-P-RVn), remdesivir (RDV), and remdesivir nucleoside (RVn) (Fig. 4A). In Vero E6 cells, the average half-maximal effective concentration (EC₅₀) and average 90% effective concentration (EC₉₀) of ODBG-P-RVn were 0.14 μM and 0.16 μM, respectively (Fig. 4B and Table 1). The EC₅₀ of ODBG-P-RVn in Vero E6 cells was significantly lower than that of RDV (Table 1). ODE-P-RVn and HDP-P-RVn were also potently antiviral, with EC₅₀ values of 0.3 μM and 0.63 μM, respectively, in Vero E6 cells (Fig. 4B and Table 1). The EC₅₀s of ODBG-P-RVn and ODE-P-RVn were less than 0.35 μM in PSC-lung and Calu-3 cells, both models of human lung infection (Fig. 4B; Table 1). The antiviral activities of ODBG-P-RVn and ODE-P-RVn were significantly better than RVn in PSC-lung cells (Table 1). ODBG-P-RVn, ODE-P-RVn, and HDP-P-RVn demonstrated strong antiviral activity in Huh7.5 cells with EC₅₀s of less than 0.2 μM that were not significantly different from that of RDV or RVn (Fig. 4B and Table 1). In the Caco-2 cell line, the EC₅₀ of ODBG-P-RVn was 0.3 μM, which was significantly lower than that of RVn but similar to that of RDV (Fig. 4B and Table 1). In the same cell line, the EC₅₀ of ODE-P-RVn was 0.77 μM, which was significantly higher than that of RDV (Fig. 4B and Table 1).

We next measured the cytotoxicity of each compound by incubating each of these cell lines with serial dilutions of each compound from 1.23 μM to 100 μM for 48 h (Fig. 4C). The average 50% cytotoxic concentrations (CC₅₀) for all compounds were greater than 60 μM in all cell lines except for RDV, which had a CC₅₀s of 32.7 μM in PSC-lung cells and 15.2 μM in Huh7.5 cells, a human hepatocyte cell line (Fig. 4C and Table 1). The selectivity index of ODBG-P-RV ranged from 295 to 699 in the five cell types tested (Table 1). The ranges of antiviral activity and cytotoxicity of ODBG-P-RVn (EC₅₀, 0.14 μM to 0.30 μM; CC₅₀, 61.5 μM o 98.2 μM) were more consistent across cell types than those for RDV (EC₅₀, 0.06 μM to 1.13 μM; CC₅₀ 15.2 μM to >100 μM) (Fig. 5A to C and Table 1). Collectively, these data demonstrate that lipid RVn monophosphate prodrugs are potent antivirals against SARS-CoV-2 in vitro with low toxicity and excellent selectivity indexes.

To determine if ODBG-P-RVn inhibits other human coronaviruses, we performed antiviral assays in the human lung fibroblast cell line MRC-5 using a clinical isolate of human coronavirus 229E. MRC-5 cells were infected with 229E for 2 h followed by incubation in the presence of various concentrations of RDV, ODBG-P-RVn, or vehicle for 72 h postinfection. Both ODBG-P-RVn and RDV demonstrated a dose-dependent inhibition of the cytopathic effect (CPE). The EC₅₀ values of ODBG-P-RVn and RDV were 0.15 μM and 0.04 μM, respectively, and the EC₉₀s were 0.54 μM and 0.26 μM, respectively (Fig. 6A). The CC₅₀s for ODBG-P-RVn and RDV were greater than 50 μM in MRC-5 cells (Fig. 6B). Together with the antiviral data for SARS-CoV-2, this demonstrates that ODBG-P-RVn has antiviral activity against two genetically distinct human-pathogenic coronaviruses.

ODBG-P-RVn administered to Syrian hamsters by oral gavage every 12 h for 7 days was well tolerated, and no adverse clinical signs were noted. Peak plasma levels of ODBG-P-RVn were noted at 1 h and fell by 50% in approximately 5 h (Fig. 7A). Plasma curves were generally similar at days 1 and 7, except at 16.9 mg/kg body weight, the 7-day values were slightly higher than the levels at day 1. At 12 h, ODBG-P-RVn levels were higher than the EC₉₀ for ODBG-P-RVn in all cell lines studied, including Vero E6 cells and PSC-lung cells on both days 1 and 7 (Fig. 7A). Levels of RVn, the nucleoside metabolite of ODBG-P-RVn, peaked at 3 h after administration and declined thereafter (Fig. 7B). Plasma levels of RVn were less than the EC₉₀ for RVn in both PSC-lung cells and Vero E6 cells (Fig. 7B). The observed low levels of RVn suggest that antiviral activity attributable to this metabolite will be minimal and are also consistent with finding of ODBG-P-RVn ex vivo stability in human plasma (Fig. 3). Collectively, these results suggest that ODBG-P-RVn will be effective in suppressing viral replication in a variety of tissue types in vivo.

All reagents were of commercial quality and used without further purification unless indicated otherwise. Chromatographic purification was performed using the flash method with silica gel 60 (EMD Chemicals, Inc.; 230 to 400 mesh). ¹H, ¹³C, and ³¹P nuclear magnetic resonance (NMR) spectra were recorded on either a Varian VX-500 or a Varian HG-400 spectrometer and are reported in units of parts per million relative to internal tetramethylsilane at 0.00 ppm. Electrospray ionization mass spectra (ESI-MS) were recorded on a Finnigan LCQDECA mass spectrometer at the small-molecule facility in the Department of Chemistry at University of California, San Diego. Purity of the target compounds was characterized by high-performance liquid chromatography (HPLC) using a Beckman Coulter System Gold chromatography system. The analytical column was Phenomenex Synergi Polar-RP (4.6 by 150 mm) equipped with a SecurityGuard protection column. Mobile phase A was 95% water-5% methanol, and mobile phase B was 95% methanol-5% water. At a flow rate of 0.8 ml/min, gradient elution was as follows: 10% B (0 to 3 min), 10% to 95% B (3 to 20 min), 95% B (20 to 25 min), and 95% to 10% B (25 to 34 min). Compounds were detected by UV light absorption at 274 nm. Purity of compounds was also assessed by thin-layer chromatography (TLC) using Analtech silica gel-GF (250 μm) plates and the following solvent system: CHCl₃-methanol [MeOH]-concentrated NH₄OH-H₂O (70:30:3:3 [vol/vol/vol/vol]). TLC results were visualized with UV light, Phospray (Supelco, Bellefonte, PA, USA), and charring at 400°C.

Remdesivir (GS-5734) and remdesivir nucleoside (GS-441524) were purchased from AA Blocks (San Diego, CA) and Mason-Chem (Palo Alto, CA), respectively. 1-O-Octadecyl-2-O-benzyl-sn-glycerol was obtained from Bachem (Torrance, CA).

N,N-Dicyclohexylcarbodiimide (DCC; 619 mg, 3 mmol) was added to a mixture of compound 2a (300 mg, 0.91 mmol, prepared as described by Warren et al. [19]), HDP phosphate (compound 4a; 414 mg, 1.10 mmol, prepared as described by Kim et al. [42]), and 4-dimethylaminopyridine (DMAP; 122 mg, 1.0 mmol) in 25 ml of dry pyridine, and then the mixture was heated to 90°C and stirred for 24 h. Pyridine was then evaporated, and the residue was purified by flash column chromatography on silica gel 60. Gradient elution (CH₂Cl₂-methanol, 10% to 20%) afforded 423 mg (67% yield) of 2′,3′-isopropylidene derivative of compound 5a. ¹H NMR: (500 MHz, chloroform-d) δ 8.42 (s, 1H), 7.98 (s, 1H), 7.70 (s, 2H), 6.22 (d, J = 6.0 Hz, 1H), 5.68 (d, J = 6.2 Hz, 1H), 5.15 (d, J = 1.0 Hz, 1H), 4.70 (dd, J = 3.8, 0.9 Hz, 1H), 4.48 to 4.42 (m, 1H), 4.26 (ddd, J = 11.2, 8.5, 2.6 Hz, 1H), 4.15 (ddd, J = 11.1, 8.5, 2.6 Hz, 1H), 4.02 (dt, J = 8.5, 6.3 Hz, 2H), 3.49 (t, J = 6.1 Hz, 2H), 3.40 (t, J = 6.1 Hz, 2H), 1.95 (p, J = 6.2 Hz, 2H), 1.54 (tt, J = 7.4, 6.1 Hz, 2H), 1.31 (s, 3H), 1.32 to 1.24 (m, 26H), 0.94 to 0.85 (m, 3H); ESI MS, 691.6 [M − H]⁻.

Concentrated HCl (0.1 ml) in tetrahydrofuran (THF) was added to a stirred solution of 2′,3′-isopropylidene-5a (100 mg, 0.14 mmol) in THF (10 ml) at room temperature. The mixture was stirred for 3 h, and then sodium bicarbonate (50 mg) and water (2 ml) were added. After stirring an additional 15 min, the solvents were evaporated, and cold water (10 ml) was added to the residue. The solid product was collected by vacuum filtration and dried under vacuum to yield compound 5a (79 mg, 87% yield) as an off-white solid. ¹H NMR: (500 MHz, CDCl₃-methanol-d₄) δ ppm ¹H NMR (500 MHz, chloroform-d) δ 8.42 (s, 1H), 7.98 (s, 1H), 7.70 (s, 1H), 6.22 (d, J = 6.0 Hz, 1H), 5.70 (d, J = 6.0 Hz, 1H), 5.12 (d, J = 4.2 Hz, 1H), 4.55 (ddd, J = 5.5, 2.7, 0.9 Hz, 1H), 4.40 (dtd, J = 6.8, 2.6, 0.8 Hz, 1H), 4.33 to 4.27 (m, 2H), 4.25 (ddd, J = 11.1, 8.4, 2.6 Hz, 1H), 4.16 (ddd, J = 11.3, 8.5, 2.6 Hz, 1H), 4.02 (dt, J = 8.5, 6.3 Hz, 2H), 3.49 (t, J = 6.1 Hz, 2H), 3.40 (t, J = 6.1 Hz, 2H), 1.95 (p, J = 6.2 Hz, 2H), 1.59 to 1.50 (m, 1H), 1.34 to 1.24 (m, 23H), 0.94 to 0.85 (m, 3H); ESI MS, 652.39 [M − H]⁻; purity by HPLC, 99.7%.

N,N-Dicyclohexylcarbodiimide (DCC; 0.3 g, 1.4 mmol) was added to a mixture of compound 2a (0.23 g, 0.7 mmol), ODE phosphate (compound 4b; 0.27 g, 0.68 mmol), and 4-dimethylaminopyridine (DMAP; 0.07 g, 0.6 mmol) in 10 ml of dry pyridine, and then the mixture was heated to 90°C and stirred for 3 days. Pyridine was then evaporated, and the residue was purified by flash column chromatography on silica gel 60. Gradient elution (CH₂Cl₂-methanol, 10% to 20%) afforded 0.22 g (45% yield) of 2′,3′-isopropylidene-5b. Concentrated HCl (0.3 ml) was added slowly to a stirred solution of 2′,3′-isopropylidene-5b (0.2 g, 0.28 mmol) in tetrahydrofuran (2 ml) at 0°C. The mixture was allowed to warm to room temperature overnight and then was diluted with water (2 ml) and adjusted to pH 8 by adding saturated sodium bicarbonate. The product was extracted with chloroform (3 × 30 ml), and the organic layer was concentrated under reduced pressure. The residue was purified by flash chromatography on silica gel. Elution with 20% MeOH-CH₂Cl₂ gave 0.10 g (55% yield) of compound 5b. ¹H NMR: (400 MHz, CDCl₃-methanol-d₄) δ ppm 7.89 (s, 1 H), 6.94 (d, J = 4.65 Hz, 1H), 6.89 (d, J = 4.65 Hz, 1H), 4.40 (d, J = 4.65 Hz, 2H), 4.21 to 4.28 (m, 1H), 4.12 to 4.20 (m, 1H), 4.04 to 4.12 (m, 1H), 3.91 (d, J = 4.89 Hz, 2H), 3.46 to 3.57 (m, 2H), 3.42 (td, J = 6.85, 1.96 Hz, 2H), 3.34 (dt, J = 3.18, 1.59 Hz, 2H), 1.53 (d, J = 6.85 Hz, 2H), 1.20 to 1.37 (m, 30H), 0.89 (t, J = 6.97 Hz, 3H); ESI MS, 666.43 [M − H]⁻; purity by HPLC, 98.4%.

N,N-Dicyclohexylcarbodiimide (DCC; 310 mg, 1.5 mmol) was added to a mixture of compound 2a (300 mg, 0.91 mmol), ODBG phosphate (compound 4c; 515 mg, 1.0 mmol), and 4-dimethylaminopyridine (DMAP; 122 mg, 1.0 mmol) in 25 ml of dry pyridine, and then the mixture was heated to 90°C and stirred for 24 h. Pyridine was then evaporated, and the residue was purified by flash column chromatography on silica gel 60. Gradient elution (CH₂Cl₂-methanol, 10% to 20%) afforded 210 mg (28% yield) of compound 2′,3′-isopropylidene-5c; ESI MS, 826.58 [M−H]⁻. Concentrated HCl (0.1 ml) in tetrahydrofuran (THF) was added to a stirred solution of 2′,3′-isopropylidene-5c (210 mg, 0.25 mmol) in THF (10 ml) at room temperature. The mixture was stirred for 3 h, and then sodium bicarbonate (50 mg) and water (2 ml) were added. After stirring an additional 15 min, the solvents were evaporated, and cold water (10 ml) was added to the residue. The solid product was collected by vacuum filtration and dried under vacuum to yield compound 5c (71 mg, 36% yield) as an off-white solid. ¹H NMR: (500 MHz, DMSO-d₆) δ 7.89 (s, 1H), 7.79 (s, 1H), 7.33 to 7.24 (m, 4H), 7.22 (ddd, J = 8.7, 5.3, 2.5 Hz, 1H), 6.88 (d, J = 4.5 Hz, 1H), 6.80 (d, J = 4.6 Hz, 1H), 6.14 (d, J = 5.2 Hz, 1H), 5.91 (s, 1H), 4.55 (q, J = 12.1, 12.1, 12.1 Hz, 3H), 4.10 (dt, J = 6.7, 4.3, 4.3 Hz, 1H), 3.93 (t, J = 5.9, 5.9 Hz, 1H), 3.79 (dddd, J = 28.2, 12.1, 7.9, 4.4 Hz, 2H), 3.62 (tdd, J = 10.9, 10.9, 8.2, 5.1 Hz, 4H), 3.43 (dd, J = 10.6, 3.5 Hz, 2H), 1.43 (p, J = 6.6, 6.6, 6.6, 6.6 Hz, 2H), 1.21 (d, J = 8.3 Hz, 30H), 0.83 (t, J = 7.0, 7.0 Hz, 3H); ESI MS, 786.48 [M−H]⁻; purity by HPLC, 97.6%.

Vero E6, Caco-2, and Calu-3 cell lines were obtained from ATCC. Huh7.5 cells were obtained from Apath LLC. Calu-3 and Caco-2 cells were propagated in minimal essential medium (MEM) (Corning) with 10% fetal bovine serum (FBS) and penicillin-streptomycin (Gibco). Vero E6 and Huh7.5 cells were propagated in Dulbecco’s minimal essential medium (DMEM; Corning) with 10% FBS and penicillin-streptomycin (Gibco). For human PSC-lung cell generation, human lung organoids were generated as previously described (43). H9 embryonic stem cells (WiCell) were cultured under feeder-free conditions upon Matrigel (Corning number 354230)-coated plates in mTeSR medium (STEMCELL Technologies number 85850). Medium was changed daily, and stem cells were passaged using enzyme-free dissociation reagent ReLeSR (STEMCELL Technologies number 05872). Cultures were maintained in an undifferentiated state, in a 5% CO₂ incubator at 37°C. For proximal lung organoid generation, human PSCs were dissociated into single cells and then seeded on Matrigel-coated plates (BD Biosciences) at a density of 5.3 × 10⁴ cells/cm² in definitive endoderm (DE) induction medium (RPMI 1640 medium, 2% B27 supplement, 1% HEPES, 1% GlutaMAX, 50 U/ml penicillin-streptomycin) supplemented with 100 ng/ml human activin A (R&D Systems), 5 μM CHIR99021 (Stemgent), and 10 μM ROCK inhibitor, Y-27632 (R&D Systems) on day 1. On days 2 and 3, cells were cultured in DE induction medium with only 100 ng/ml human activin A. Anterior foregut endoderm (AFE) was generated by supplementing serum-free basal medium (3 parts Iscove’s modified Dulbecco’s medium [IMDM] to 1 part F12, B27 plus N2 supplements, 50 U/ml penicillin-streptomycin, 0.25% bovine serum albumin [BSA], 0.05 mg/ml l-ascorbic acid, and 0.4 mM monothioglycerol) with 10 μM SB431542 (R&D Systems) and 2 μM dorsomorphin (Stemgent) on days 4 to 6. On day 7, AFE medium was changed to lung progenitor cell (LPC) induction medium, containing serum-free basal medium supplemented with 10 ng/ml human recombinant BMP4 (R&D Systems), 0.1 μM all-trans retinoic acid (Sigma-Aldrich), and 3 μM CHIR99021. Medium was changed every other day for 9 to 11 days. To generate three-dimensional (3D) human proximal lung organoids, we modified a previously published protocol (44). LPCs were dissociated in Accutase for 10 min and resuspended in Matrigel in a 12-well, 0.4-μm-pore-size Transwell (Corning) culture insert at 5.0 × 10⁴ cells/200 μl of Matrigel. Cells were cultured in proximal lung organoid maturation medium using serum-free basal medium supplemented with 250 ng/ml basic fibroblast growth factor (FGF2), 100 ng/ml recombinant human fibroblast growth factor 10 (rhFGF10), 50 nM dexamethasone (Dex), 100 μM 8-bromoadenosine 3′,5′-cyclic monophosphate sodium salt (Br-cAMP), 100 μM 3-isobutyl-1-methylxanthine (IBMX), and 10 μM ROCK inhibitor (Y-27632). Proximal lung organoid medium was changed every other day for 3 weeks. Human PSC-derived lung organoids were dissociated into single cells and seeded at 20,000 cells per well of a Matrigel-coated 96-well plate 1 day before transfection. Transwells containing the proximal organoids in Matrigel were incubated in 2 U/ml dispase for 30 min at 37°C. Cold phosphate-buffered saline (PBS) was added to the mixture and then centrifuged at 400 × g for 5 min. Supernatant was carefully removed and resuspended in 2 to 3 ml of TrypLE Express (Gibco number 12605010) for 20 min at 37°C. The reaction was quenched with 2% FBS in DMEM/F12 and then centrifuged at 400 × g for 5 min. The supernatant was aspirated, and the cell pellet was resuspended in 1 ml of quenching medium supplemented with 10 μM ROCK inhibitor (Y-27632). A cell count was performed, and the respective volumes of cells were transferred into a reagent reservoir trough, resuspended in proximal lung organoid maturation medium, and plated via multichannel pipette into 96-well plates at 100 μl per well as monolayers.

SARS-CoV-2 isolate USA-WA1/2020 (BEI Resources) was propagated and infectious units were quantified by plaque assay by using Vero E6 (ATCC) cells. Approximately 12,000 cells from each cell line were seeded per well in a 96-well plate. Vero E6 and Huh7.5 cells were seeded approximately 24 h prior to treatment/infection. Calu-3 and Caco-2 cells were seeded approximately 48 h prior to treatment/infection. Human PSC-lung cell infections and cytotoxicity experiments were performed when cells reached 100% confluence. Compounds or controls were added at the concentrations indicated in the figures and text 30 min prior to infection, followed by the addition of SARS-CoV-2 at a multiplicity of infection equal to 0.01. After incubation for 48 h at 37°C and 5% CO₂, cells were washed twice with PBS and lysed in 200 μl TRIzol (Thermo Fisher). All work with SARS-CoV-2 was conducted under biosafety level 3 conditions at the University of California San Diego with approval from the Institutional Biosafety Committee.

Human coronavirus 229E (ATCC) was propagated and infectious units were quantified by 50% tissue culture infective dose (TCID₅₀) using MRC-5 cells. For antiviral testing, approximately 10⁴ MRC-5 cells were seeded per well in Eagle’s minimal essential medium (EMEM) (10% fetal calf serum [FCS]) at 37°C in a 96-well plate overnight. Medium from each well was removed, and cells were infected with 100 TCID₅₀ virus in 100 μl medium for 2 h. Cells were washed one time with medium, and then compounds or controls were added at the concentrations indicated in the text and figures. After 3 days, CPE was observed under a microscope and quantified using a 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide (MTT) cell proliferation assay kit (Abcam) and read on an ELx800 universal microplate reader (BioTek Instruments, Inc.). The percent inhibition was calculated as (A_tv − A_cv)/(A_cd − A_cv) × 100, where A_tv indicates the absorbance of the test compounds with virus-infected cells, and A_cv and A_cd indicate the absorbance of the virus control and the absorbance of the cell control, respectively. The average half-maximal effective concentration (EC₅₀) was defined as the concentration which achieved 50% inhibition of virus-induced cytopathic effects.

RNA was purified from TRIzol lysates using Direct-zol RNA microprep kits (Zymo Research) according to manufacturer’s recommendations that included DNase treatment. RNA was converted to cDNA using the iScript cDNA synthesis kit (Bio-Rad), and qPCR was performed using iTaq universal SYBR green supermix (Bio-Rad) and an ABI 7300 real-time PCR system. cDNA was amplified using the following primers: RPLP0 F, GTGTTCGACAATGGCAGCAT; RPLP0 R, GACACCCTCCAGGAAGCGA; SARS-CoV-2 spike F, CCTACTAAATTAAATGATCTCTGCTTTACT; SARS-CoV-2 spike R, CAAGCTATAACGCAGCCTGTA. Relative expression of SARS-CoV-2 spike RNA was calculated by the comparative threshold cycle (ΔΔC_T) method by first normalizing to the housekeeping gene RPLP0 and then comparing to SARS-CoV-2-infected Vero E6 cells that were untreated (reference control). Curves were fit using the nonlinear regression minus log(inhibitor) versus response (four parameter) model using Prism 9. To calculate effective concentrations (EC₅₀ and EC₉₀ values), qRT-PCR values were normalized to percent inhibition and curves were fit using the nonlinear regression minus log(agonist) versus response (four parameter) model with the bottom and top constrained to 0 and 100, respectively, using Prism 9.

Cell types were seeded as per SARS-CoV-2 infection studies in opaque-walled 96-well cell culture plates or as per 229E infection studies in clear 96-well cell culture plates and incubated overnight. Compounds or controls were added at the concentrations indicated in the text and figures. For SARS-CoV-2-related studies, cells were incubated for 48.5 h at 37°C and 5% CO₂; then, equal volumes of CellTiter-Glo reagent (catalog number G7570; Promega, Madison, WI) were added and mixed, and luminescence was recorded on a Veritas microplate luminometer (Turner BioSystems) according to the manufacturer’s recommendations. For 229E-related studies, cells were incubated for 72 h at 37°C and 5% CO₂; then, supernatants were removed and 50 μl of serum-free medium and 50 μl of MTT reagent (Abcam ab211091) were added to each well and incubated for 3 h at 37°C. Absorbance was measured on an ELx800 universal microplate reader (BioTek Instruments, Inc.) according to the manufacturer’s recommendations. Percent viability was calculated compared to that of untreated controls, and CC₅₀ values were calculated using Prism 9.

Pooled mixed-gender human plasma samples were obtained from BioIVT (Westbury, NY). ODBG-P-RVn was incubated in human plasma with K₂EDTA or sodium heparin as the anticoagulant at a final concentration of 2.00 μg/ml. After incubation at 37°C, duplicate samples of the test article incubations were taken at 0 (preincubation), 0.5, 1, 2, 4, 8, and 24 h and immediately frozen at −70°C. The extracts were prepared by a solid-phase extraction using a Waters Sep Pak tC₁₈ 25 mg SPE plate and analyzed as described below.

Hamster plasma samples (10 μl) containing ODBG-P-RVn and K₂EDTA as the anticoagulant were added to polypropylene tubes containing water (100 μl), internal standard solution (10 μl of 1,000 ng/ml of ODE-P-RVn in acetonitrile [ACN]-dimethylformamide [DMF], 1:1 [vol/vol]), and 10 μl of ACN-DMF (1:1 [vol/vol]). The solutions were mixed and then acidified with phosphoric acid (85% [wt/vol water], 1:19 [vol/vol]; 10 μl) and mixed; then, the solutions were diluted with 200 μl of isopropyl alcohol, mixed, and then diluted with 500 μl of water and mixed. The samples were extracted with a Sep-Pak tC₁₈ 96-well solid-phase extraction plate (25 mg; Waters, Milford, MA). Extraction occurred under positive pressure conditions using nitrogen. Samples were washed serially with 1 ml of water-acetonitrile-formic acid (475:25:0.5 [vol/vol/vol]) and 0.4 ml of water-acetonitrile-formic acid (350:150:0.5 [vol/vol/vol]) before being serially eluted with 100 μl and 150 μl of water and acetonitrile-isopropyl alcohol (1:1 [vol/vol])-formic acid-ammonium formate-citric acid solution, 2% [wt/vol] (15:85:0.1:0.1:0.1 [vol/vol/vol/wt/vol]). The citric acid solution was prepared as water-citric acid monohydrate (20:0.4 [vol/wt]). After elution, 100 μl of water was added to each sample. The ODBG-P-RVn extracts were analyzed using an Agilent 1200 HPLC system (Agilent, Santa Clara, CA) coupled to an API5500 mass analyzer (SCIEX, Foster City, CA). Analytes were chromatographically separated using a Dacapo DX-C₁₈ MF column (100 by 2 mm, 2.5 μm; Imtakt USA, Portland, OR) using a mobile phase system consisting of mobile phase A (water-formic acid-[water-ammonium formate-citric acid; 25:5:0.5 {vol/wt/wt}], 1,000:1:1 [vol/vol/vol]) and mobile phase B (acetonitrile-isopropyl alcohol-formic acid-[water-ammonium formate-citric acid; 25:5:0.5 {vol/wt/wt}], 800:200:1:1 [vol/vol/vol/vol]). The total analytical run time was 4.5 min. The mobile phase was nebulized using heated nitrogen in a Turbo-V source/interface set to electrospray positive ionization mode. The ionized compounds were detected using multiple-reaction monitoring with transitions m/z 788.4 > 229 (V2043) and 668.4 > 467.2 (V2041). This method is applicable for measuring ODBG-P-RVn concentrations ranging from 6.25 to 3,000 ng/ml using 10.0 μl of plasma for extraction. The peak areas of ODBG-P-RVn and RVn were acquired using Analyst v. 1.6.2 (SCIEX, Framingham, MA). The calibration curve was obtained by fitting the peak area ratios of the analyte/internal standard (IS) and the standard concentrations to a linear equation with 1/x² weighting, using Analyst. The equation of the calibration curve was then used to interpolate the concentrations of the analyte in the samples using their peak area ratios. The peak areas used for the calculations were not rounded.

Hamster plasma samples (20 μl) containing GS-441524 and K₂EDTA as the anticoagulant were added to Eppendorf LoBind microcentrifuge tubes containing acetonitrile (300 μl) and water-acetonitrile (2:8 [vol/vol]; 60 μl). The solutions were mixed and centrifuged at 16,000 × g for 5 min. The supernatant (300 μl) was then filtered through an Ostro protein precipitation and phospholipid removal plate (25 mg; Waters, Milford, MA). Filtration occurred under positive pressure conditions using nitrogen. Collected filtered samples were capped, mixed, and stored at 10°C pending analysis. The GS-441524 extracts were analyzed using an Acquity ultraperformance liquid chromatography (UPLC) system (Waters) coupled to a G2-S quadrupole time of flight (QTOF) mass analyzer (Waters). Analytes were chromatographically separated using a Unison-UK Amino HT column (100 by 2 mm, 3 μm; Imtakt USA, Portland, OR) using a mobile phase system consisting of mobile phase A (0.008% ammonium hydroxide, 0.012% acetic acid in water [vol/vol/vol]) and mobile phase B (0.008% ammonium hydroxide, 0.012% acetic acid in acetonitrile [vol/vol/vol]). The total analytical run time was 12.5 min. The mobile phase was nebulized using heated nitrogen in a Z-spray source/interface set to electrospray positive ionization mode. The ionized compounds were detected using TOF MS scan monitoring in sensitivity mode scanning from 50.0 to 700 m/z. This method is applicable for measuring GS-441524 concentrations ranging from 1.00 to 1,000 ng/ml using 20.0 μl of plasma for extraction. The peak areas of GS-441524 were acquired using MassLynx V4.2 (Waters). The calibration curve was obtained by fitting the peak area ratios of the analyte and the standard concentrations to a linear equation with 1/x² weighting using MassLynx. The equation of the calibration curve was then used to interpolate the concentrations of the analyte in the samples using their peak areas. The peak areas used for the calculations were not rounded.