The tva(A) Gene from Brachyspira hyodysenteriae Confers Decreased Susceptibility to Pleuromutilins and Streptogramin A in Escherichia coli
ABSTRACT
INTRODUCTION
Expression of tva(A) in E. coli and S. aureus.
Primer name | PCR specifications | Nucleotide sequence (5′→3′)a | Target |
---|---|---|---|
tva(A)-Kpn-I-F | Construction of pAGS2 plasmid by cloning the tva(A) gene with its native promoter into the promoterless shuttle vector pBUS1-HCb | CTTCGGTACCTTCCTTCACCTATGTACAGTCA | tva(A) |
tva(A)-XhoI-R | ACATCCTCGAGCTGATTCTCACATTGAAATAC | ||
Pcap-tva(A)-F1 | Construction of pAGS2-Pcap plasmid by replacement of the native promoter with Pcap promoterc | ATTATATATAATGGAAAACAAGAAAGGAAAATAGGAGGTTAATATATGTTTATAAAATTCAATAAAG | pAGS2 |
Pcap-tva(A)-R1 | TCCATTATATATAATCCCCTGTATATTTTGCAAACTCTGGTACCACGCGTTGC | ||
tva(A)-RT-F1 | Expression of tva(A) gene by RT-PCRd | GTTTCTTTTTCTTATGATAGTTCTG | tva(A) |
tva(A)-RT-R1 | TACCTGTTATAAGTTTAGCTAGCG |

Antimicrobial susceptibility testing.
Strain or plasmid | Characteristics | Reference or source | MIC (μg/ml) (most common [variation])a | ||||
---|---|---|---|---|---|---|---|
Pleuromutilinsb | Streptogramin A/Bc | ||||||
TIA (0.063–8) | VAL (0.031–4) | VIR M1 (0.5–256) | PIIA (0.125–64) | PIA (0.125–64 or 512) | |||
S. aureus | |||||||
RN4220 | NCTC8325-4 derivative, antibiotic susceptible; sau1 hsdR (rK− mK+), plasmid free | 7 | 0.5 (0.5) | 0.125 (0.125) | 2 (1–2) | 1 (1) | 8 (8) |
RN4220/pBUS1-HC | RN4220 containing cloning vector pBUS1-HC | 9 | 0.5 (0.25–0.5) | 0.125 (0.063–0.125) | 2 (1–2) | 1 (1) | 8 (8) |
RN4220/pAGS2 | RN4220 containing the tva(A) gene under control of its native promoter | This study | 1 (0.5–1) | 0.125 (0.125) | 4 (4) | 2 (2–4) | 8 (8) |
RN4220/pAGS2-Pcap | RN4220 containing the tva(A) gene under control of the Pcap promoter | This study | 0.25 (0.25–0.5) | 0.063 (0.063–0.125) | 2 (1–2) | 1 (1–2) | 8 (8) |
E. coli | |||||||
AG100A | K-12 strain (ΔacrAB::Tn903 Kanr); increased susceptibility to antibiotics, plasmid free | 6 | 0.5 (0.25–0.5) | 0.5 (0.25–0.5) | 2 (2) | 2 (1–2) | 256 (256) |
AG100A/pBUS1-HC | AG100A containing cloning vector pBUS1-HC | This study | 0.25 (0.125–0.25) | 0.25 (0.25) | 2 (0.5–2) | 2 (0.5–2) | 256 (256) |
AG100A/pAGS2 | AG100A containing the tva(A) gene under control of its native promoter | This study | 2 (2) | 1 (0.5–1) | 8 (8–16) | 16 (16) | 256 (256) |
AG100A/pAGS2-Pcap | AG100A containing the tva(A) gene under control of the Pcap promoter | This study | 1 (0.5–1) | 0.5 (0.5) | 4 (4–8) | 8 (4–8) | 256 (256) |
B. hyodysenteriae | |||||||
BH718 | Pleuromutilin-resistant strain containing tva(A) and A2058T mutation in 23S rRNA | 8 | 8 | 1 | >256 (>256) | >64 (>64) | >64 (>64) |
CCUG 46668T | Pleuromutilin-susceptible strain without tva(A) and A2058T mutation in 23S rRNA | CCUGd | ≤0.063 | ≤0.031 | 0.5 (0.5–2) | 0.5 (0.5–1) | 8 (8–16) |
ACKNOWLEDGMENTS
Supplemental Material
- Download
- 16.02 KB
REFERENCES
Information & Contributors
Information
Published In

Copyright
History
Keywords
Contributors
Metrics & Citations
Metrics
Note:
- For recently published articles, the TOTAL download count will appear as zero until a new month starts.
- There is a 3- to 4-day delay in article usage, so article usage will not appear immediately after publication.
- Citation counts come from the Crossref Cited by service.
Citations
If you have the appropriate software installed, you can download article citation data to the citation manager of your choice. For an editable text file, please select Medlars format which will download as a .txt file. Simply select your manager software from the list below and click Download.