ABSTRACT

Amebiasis is an important cause of morbidity and mortality worldwide, and caused by infection with the protozoan parasite Entamoeba histolytica. Metronidazole is currently the first-line drug despite adverse effects and concerns on the emergence of drug resistance. Fumagillin, a fungal metabolite from Aspergillus fumigatus, and its structurally related natural and synthetic compounds have been previously explored as potential anti-angiogenesis inhibitors for cancers, anti-microbial, and anti-obese compounds. Although fumagillin was used for human amebiasis in clinical trials in 1950s, the mode of action of fumagillin remains elusive until now. In this report, we showed that fumagillin covalently binds to methionine aminopeptidase 2 (MetAP2) and non-covalently but abundantly binds to patatin family phospholipase A (PLA). Susceptibility against fumagillin of the amebic strains in which expression of E. histolytica MetAP2 (EhMetAP2) gene was silenced increased compared to control strain. Conversely, overexpression of EhMetAP2 mutants that harbors amino acid substitutions responsible for resistance to ovalicin, a fumagillin analog, in human MetAP2, also resulted in decrease in fumagillin susceptibility. In contrast, neither gene silencing nor overexpression of E. histolytica PLA (EhPLA) affected fumagillin susceptibility. These data suggest that EhPLA is not essential and not the target of fumagillin for its amebicidal activity. Taken together, our data have demonstrated that EhMetAP2 is the primary target for amebicidal activity of fumagillin, and EhMetAP2 represents a rational explorable target for the development of alternative therapeutic agents against amebiasis.

INTRODUCTION

Entamoeba histolytica causes human amoebiasis, which is the second leading cause of deaths among protozoan parasites in low- and middle-income countries. Approximately 50 million people, 0.6% of the global population, are infected and 10,000 infected are killed each year (1, 2). Metronidazole is the first-line drug of choice against amebic dysentery and liver abscesses. Metronidazole targets anaerobic energy metabolism, more specifically pyruvate: ferredoxin oxidoreductase, which is absent in humans. However, metronidazole therapy is sometimes associated with severe adverse effects such as neurotoxicity, optic and peripheral neuropathy, and encephalopathy, as well as mild adverse effects including headache, dizziness, abdominal pain, vomiting, fever, and depression (3). Therefore, new drugs with less adverse effects, particularly with novel mechanisms of action and structures are always needed.
Fumagillin, a secreted natural fungal metabolite, was first isolated from Aspergillus fumigatus (4). Fumagillin was previously utilized for the treatment of amebiasis patients early in the 1950s (5). In 1990s, fumagillin-related compounds, including TNP-470, were shown to possess angiogenesis inhibitory activity, thus were explored for chemotherapy of metastasized solid tumors until its derivatives with acceptable toxicity profiles reached clinical trials as anti-cancer agents (6, 7). Recently, fumagillin derivatives, including beloranib (8) and ZGN-1061, have been explored in human clinical trials in patients with obesity, including Prader-Willi syndrome, a genetic neurodevelopmental disorder, and type 2 diabetes (8).
The molecular target of fumagillin in humans was demonstrated to be methionine aminopeptidase 2 (MetAP2) by chemical validation. MetAP2 was found to be covalently and specifically bound to fumagillin and fumagillin derivatives from human cell lysates (9, 10). MetAP2 is engaged with the cotranslational removal of the initiator methionine residue from a nascent polypeptide, and this process is a prerequisite for the post-translational modifications at the amino terminus such as myristoylation and acetylation (11). The crystal structure of human MetAP2 and fumagillin demonstrated that a covalent bond is formed between a reactive epoxide of fumagillin and the highly conserved histidine residue at the 231 amino acid (a. a.) position located in the active site of human MetAP2 (12). However, in contrast to humans, the target of fumagillin in E. histolytica needs to be chemically and genetically demonstrated.
In this report, we demonstrated by the affinity pull-down approach using biotinylated fumagillin that fumagillin binds to MetAP2 and patatin family phospholipase A, PLA. Gene silencing and overexpression of EhMetAP2 or EhPLA in E. histolytica showed that EhMetAP2, but not EhPLA, is associated with growth inhibition of the parasite by fumagillin and thus the major target of fumagillin in E. histolytica. These data are consistent with the fact that all amino acid residues implicated for the interaction of human MetAP2 with fumagillin are well conserved in E. histolytica MetAP2. Taken together, our chemical and genetic validation of EhMetAP2 as the authentic target of fumagillin should further facilitate derivatization of fumagillin to improve efficacy and safety for the development of new drugs against amebiasis.

RESULTS

Isolation of EhMetAP2 and phospholipase A as the target of fumagillin using biotinylated fumagillin

To investigate the target of fumagillin in E. histolytica, affinity pull-down experiments using biotinylated fumagillin were conducted (Fig. 1; see Materials and Methods for organic synthesis of biotinylated fumagillin). The biotin moiety was incorporated into the sidechain of fumagillin at the C-4 position. We presumed that the biotin moiety unlikely interferes with binding to the target, based on the fact that potent fumagillin analogs such as TNP-470, which have a substitution at this position, retain their inhibitory activity (9, 10). Biotinylated fumagillin showed amebicidal activity with an IC50 value of 1.15 ± 0.03 µM, indicating that biotinylated fumagillin retains lower but reasonable inhibitory activity. For affinity isolation of fumagillin targets, we used the ameba line that expressed HA-tagged EhMetAP2 because we presumed that MetAP2 could be a potential binding protein of fumagillin. E. histolytica possesses only a single MetAP2 gene (EHI_126880) but lacks MetAP1 (AmoebaDB: http://amoebadb.org/amoeba/app, version 62), while the human has single genes each encoding MetAP1 and MetAP2 (13). EhMetAP2 shows 46% or 23% a. a. identity to human MetAP2 and MetAP1, respectively. The biotinylated fumagillin was mixed and incubated with lysates from HA-EhMetAP2 expressing amoebas (for validation of expression of HA-tagged wild-type EhMetAP2, see the next section, Fig. 2.). The biotinylated fumagillin-bound proteins were enriched on avidin-conjugated beads and the proteins were separated by SDS-PAGE under reducing conditions. The proteins isolated with biotinylated fumagillin were visualized by silver staining (Fig. 1). Three bands, at approximately 66, 52, and 44 kDa, were exclusively detected by silver staining from the sample isolated with biotinylated fumagillin, but not from the sample with the control biotin linker and DMSO solvent. Detection of biotinylated fumagillin on the membranes with Avidin-HRP identified only 52 and 44 kDA bands but not 66, kDa band (Fig. S1). Immunoblot analysis of the samples with anti-HA antibody indicated that HA-EhMetAP2 was also detected as a 52 kDa band, which was enriched in the sample isolated with biotinylated fumagillin, compared to the sample isolated with the control biotin (Fig. S1A). These data are consistent with HA-EhMetAP2 was pulled down by biotinylated fumagillin (Fig. S1B). These results were consistent with the notion that 52 kDa HA-tagged EhMetAP2 and 44 kDa protein, which most likely corresponds to endogenous EhMetAP2, covalently bound to biotinylated fumagillin, whereas 66 kDa band of unknown identity was only reversibly associated with biotinylated fumagillin.
Fig 1
Fig 1 Isolation of fumagillin binding proteins in E. histolytica. The samples were prepared from lysates of HA-MetAP2 expressing strain, using biotinylated fumagillin. Control samples were also prepared in parallel using biotin-linker or DMSO only. The pull-down experiment was performed as described in Materials and Methods. Affinity purified samples were subjected to SDS-PAGE and silver stained. Approximately 10 µL of samples (20 µg equivalent) were loaded in each lane.
Fig 2
Fig 2 Comparison of E. histolytica MetAP2 and human MetAP1 and 2, and confirmation of expression of HA-EhMetAP2 wild type and mutants. (A) Amino acid alignment of E. histolytica MetAP2, human MetAP1, and MetAP2, created using ClustalOmega. The positions containing identical a. a. are marked with asterisks and those with conserved a. a. changes are marked with dots or colons. Three a. a. residues discussed in details in the text are marked with red arrows and labeled. (B) Immunoblot analysis of exogenously expressed EhMetAP2 wild type and mutants. Lysates from HA-MetAP2 wild type, HA-EhMetAPA297T, and HA-EhMetAPY379C expressing strains were subjected to SDS-PAGE and immunoblot analysis by anti-HA antibody. An arrow indicates 55 kDa bands corresponding to HA-MetAP2 wild type, HA-EhMetAPA297T, or HA-EhMetAPY379C. Rab11B was used as an internal loading control.
The affinity purified proteins with biotinylated fumagillin were analyzed by LC-MS/MS. A total of 174 proteins were identified, including 152 proteins identified from the sample isolated with biotinylated fumagillin, and 122 proteins identified from the biotin-liker control (Table S1). Ten most abundantly identified proteins with the highest quantitative values (QVs) are listed in Table 1. Top two hits, EhMetAP2 (EHI_126880) and phospholipase of the patatin family (EHI_200740), were detected exclusively from the biotinylated fumagillin sample but not from the control biotin-linker sample. EHI_200740, which is composed of 625 a. a. with the predicted molecular mass of 70.2 kDa, shows homology with patatin family phospholipases from Dictyostelium discoideum (XP_636632, 33% identity, e-value 2e-43) and Anaerolineales bacterium (MCC6187438, 35% identity, e-value 1e-40). Patatin from plant tissues was reported to possess phospholipase A2 and A1 activities (14). We therefore tentatively designated EHI_200740 as EhPLA. The QVs of these two proteins were similar (EhMetAP2: 37.157, EhPLA: 33.995) and significantly higher than that of other proteins (Table 1). Although more than 100 proteins were detected by pull-down experiments with biotinylated fumagillin, very small number of proteins with greater than twofold enrichment and the QV of >5 were obtained with biotinylated fumagillin compared to biotin-linker control (only two proteins: 40S ribosomal protein S7 and 60S ribosomal protein L27) (Table 1), suggesting interaction of fumagillin to EhMetAP2 and EhPLA is specific and other detected proteins should be regarded as background. Taken together, these data demonstrate that biotinylated fumagillin covalently binds to HA-EhMetAP2 and intrinsic EhMetAP2 (52 and 44 kDa, respectively), while it non-covalently binds to intrinsic EhPLA (66 kDa).
TABLE 1
TABLE 1 The list of proteins affinity-purified with biotinylated fumagillin (top10)
Protein nameEHI numberSizeBiotinylated fumagillin (QV)Biotin-linker (QV)Fold enrichmenta
Methionine aminopeptidase 2EHI_12688046 kDa37.1570inf
Phospholipase patatin family proteinEHI_20074070 kDa33.9950inf
Grainin 1EHI_16730024 kDa19.76442.1720.46
Cluster of 60S ribosomal protein L4 putativeEHI_03544047 kDa12.64912.2431.03
60S ribosomal protein L4 putativeEHI_03544047 kDa11.85912.2430.96
ActinEHI_10729042 kDa10.27710.8830.94
Cluster of Elongation factor 1-alphaEHI_05240048 kDa10.2779.52261.07
Aldehyde-alcohol dehydrogenaseEHI_15049096 kDa10.2776.80191.51
Elongation factor 1-alphaEHI_05240048 kDa9.48689.52260.99
PeroxiredoxinEHI_12231027 kDa9.48686.80191.39
a
Normalized relative ratio coprecipitated with biotin-fumagillin/biotin linker.

Overexpression of EhMetAP2 mutant confers the resistance to fumagillin in E. histolytica

The identification of EhMetAP2 and EhPLA indicates that the target of fumagillin can be one or both of the two proteins. First, we investigated if EhMetAP2 is the target of fumagillin in a genetic approach. To genetically validate if the target of fumagillin is MetAP2 in E. histolytica, we created three ameba lines that overexpressed HA-tagged wild-type EhMetAP2, or one of two mutants, EhMetAP2A297T or EhMetAP2Y379C. These EhMetAP2 mutants correspond to human MetAP2A362T and MetAP2Y444C mutants, respectively (Fig. 2A). These mutation in human MetAP2 were identified by screening of human MetAP2 mutations that can rescue the Saccharomyces cerevisiae MetAP1 and MetAP2 double knockout strain in the presence of fumagillin derivative, ovalicin (ovalicin-resistant human MetAP2) (13). Expression of HA-tagged wild-type EhMetAP2, EhMetAP2A297T, or EhMetAP2Y379C in trophozoites under the tetracycline inducible system was validated by immunoblot analysis with anti-HA monoclonal antibody, showing a single band with an apparent molecular mass of 55 kDa (Fig. 2B). These data indicate that HA-EhMetAP2 wild type and mutants, with the expected molecular mass of 46 kDa plus 3 kDa, the latter of which corresponds to the 3 HA tag, shows an apparent molecular mass slightly larger than the predicted size. Expression of HA-EhMetAP2 wild type and mutants were robust and the levels of expression of EhMetAP2 were apparently comparable among the lines (Fig. 2B). Almost all transformant cells apparently expressed the HA-EhMetAP2 proteins (Fig. S2). Subcellular localization of HA-EhMetAP2 wild type and mutants examined by indirect immunofluorescence assay (IFA) with anti-HA antibody was mostly cytosolic (Fig. S2). We compared the IC50 values, the concentrations that show 50% growth inhibition of the parasite against the ameba lines, of fumagillin. The IC50 values of fumagillin against E. histolytica wild-type reference strain HM-1:IMSS cl6 was 69.0 ± 1.3 nM, which was slightly different from the mock-transfected control for tetracyclin-inducible expression (94.3 ± 7.9) (Table 2), which was about 70- to 90-fold lower than that of metronidazole (6.5 ± 0.3 µM) (15). An ameba line that expressed HA-EhMetAPY379C showed a 3.6-fold higher IC50 value compared to the mock transformant (P-value < 0.002) (Table 2). An amoeba line that overexpressed HA-tagged wild-type EhMetAP2 showed approximately twofold increase in the IC50 value (statistically not significant, P > 0.05). In contrast, expression of HA-EhMetAP2A297T conferred only marginal resistance to fumagillin (not statistically significant, P-value > 0.05) (Table 2). This is in contrast to the previous report on human MetAP2 (13), and suggesting this a. a. residue may not be involved in the interaction with fumagillin.
TABLE 2
TABLE 2 IC50 values of fumagillin against EhMetAP2- or EhPLA-overexpressing strains
Expression systemProtein overexpressedIC50 values (nM)P value against mockd
NANone69.0 ± 1.3NAa
ConstitutiveMockb49.1 ± 3.7NA
PLA48.6 ± 2.50.9
Tetracycline-inducibleMockc94.3 ± 7.9NA
EhMetAP201.2 ± 58.20.05
EhMetAP-A297T147.0 ± 44.10.09
EhMetAP-Y379C342.0 ± 33.40.002
a
Not applicable.
b
The constitutive expression plasmid, pEhEx-HA, was used to create mock control.
c
The inducible expression plasmid, pEhTex-HA, was used to create mock control.
d
Values in bold are statically significant (P < 0.05) by Fisher's exact test.

Overexpression of EhPLA does not affect the sensitivity to fumagillin

Overexpression of fumagillin target EhMetAP2 mutants conferred fumagillin resistance to E. histolytica (Table 2). To verify whether EhPLA is involved in fumagillin target or regulation of EhMetAP2 enzymatic activity, N-terminally HA-epitope tagged EhPLA-overexpressing transformant strain was established. The expression of HA-EhPLA in amoeba lysate was confirmed by immunoblot using anti-HA antibody (a 80 kDa band in Fig. 3A). The subcellular localization of HA-EhPLA, examined by IFA with anti-HA antibody, indicated that HA-EhPLA was strongly associated with the plasma membrane and weakly dispersed throughout the cytoplasm (Fig. 3B). Contrary to expectations, HA-EhPLA overexpressing strain did not affect fumagillin sensitivity compared to the control strain (The IC50 values of mock control and HA-EhPLA were 49.1 ± 3.7 and 48.6 ± 2.5 nM, respectively; P-value > 0.05) (Fig. 3C; Table 2).
Fig 3
Fig 3 Expression of HA-EhPLA expressing strain and its fumagillin sensitivity. (A) Immunoblot analysis of HA- EhPLA. The expression of HA-EhPLA was confirmed by immunoblot using anti-HA antibody. One major 80 kDa band (EhPLA, 70 kDa and HA tag, 3 kDa) and a minor 60 kDa band were detected. Anti-CS antibody was used to ensure the equality of sample loading. (B) Localization of EhPLA examined by IFA. Fluorescence and differential interference contrast (DIC) images are shown. HA-EhPLA was detected by anti-HA antibody. (C) Growth inhibition of HA-EhPLA-expressing or mock strain by fumagillin. The percentage of live amebae after cultivation with fumagillin at various concentrations for 48 hours, as estimated by WST-1 assay, is shown. IC50 values calculated from this plot are shown in Table 2.

Fumagillin sensitivity increased by EhMetAP2 gene silencing

To further validate the premise that EhMetAP2 is the target of fumagillin, the ameba strain in which EhMetAP2 was silenced by antisense small RNA-mediated transcriptional gene silencing was examined. The specific gene-silencing of EhMetAP2 gene was confirmed by reverse transcriptase-polymerase chain reaction (RT-PCR) using cDNA (Fig. 4A). The expression level of EhMetAP2 gene was decreased by approximately 50% in EhMetAP2 gene-silenced strain (Fig. 4A). EhMetAP2 gene-silenced strain showed growth defect in normal BI-S-33 medium (doubling time of EhMetAP2 gene-silenced and mock strains, 48.6 ± 1.1 hours and 24.9 ± 3.2 hours, respectively: P-value = 0.0002). Due to chemical instability of fumagillin, the IC50 values of fumagillin against EhMetAP2 gene-silenced and mock control strains varied among three sets of experiments; however, the trend was always consistent. EhMetAP2 gene-silenced strain was more susceptible than the mock strain in all five trials (Fig. 4B). The IC50 values of fumagillin against EhMetAP2 gene-silenced and mock control strains in the first three experiments were 60.8 ± 14.5 and 89.0 ± 11.9 nM, respectively (P-value = 0.2) (Table 3). In the fourth and fifth sets, EhMetAP2 gene-silenced strain showed a lower IC50 value (29.5 ± 3.5 nM) than mock control (50.5 ± 2.1 nM) with statistical significance (P-value = 0.015) (Fig. S3).
Fig 4
Fig 4 Validation of gene silencing of EhMetAP2 and EhPLA genes and fumagillin sensitivity of the gene-silenced strains. (A) RT-PCR of EhMetAP2 and EhPLA gene-silenced strains. cDNA was synthesized from mRNA of gene silenced and control strains. RT-PCR was conducted for EhMetAP2 and EhPLA genes as well as RNA pol II (EHI_056690) gene as the internal control. PCR products were analyzed by agarose gel electrophoresis. Note approximately 50% of expression was suppressed in EhMetAP2gs strain, while in EhPLAgs strain, EhPLA expression was completely abolished. (B) Growth inhibition of EhMetAP2gs, EhPLAgs, and mock strains by fumagillin. The percentage of live amebae after cultivation with fumagillin at various concentrations for 48 hours, as estimated by WST-1 assay, is shown. IC50 values calculated from this plot are shown in Table 3. The representative plot, among triplicate experiments, was shown.
TABLE 3
TABLE 3 IC50 values of fumagillin against MetAP2- or PLA-gene-silenced strains
Gene silencedIC50 values (nM)P value against mockc
Mocka89.0 ± 11.9NAb
EhMetAP260.8 ± 14.50.2
EhPLA90.9 ± 6.80.9
a
Empty pSAP plasmid was used to create mock control.
b
Not applicable.
c
Values in bold are statically significant (P < 0.05) by Fisher's exact test.

Fumagillin inhibits EhMetAP2 enzymatic activity

Recombinant EhMetAP2 wild-type [glutathione S-transferase (GST)-EhMetAP2] proteins were expressed in the protease-deficient S. cerevisiae BY2777 strain and purified as a fusion protein with GST (16) (Fig. S4A). GST-EhMetAP2 was expressed as a 72 kDa fusion protein and purified at a ~95% purity based on the densitometric scanning of bands stained with Coomassie Brilliant Blue after SDS-PAGE (Fig. S4B). The GST-EhMetAP2 enzymatic assay was carried out as previously described (17) with some modification. The optimum pH for the GST-EhMetAP2 activity against the fluorogenic substrate L-methionine 4-methylcoumaryl-7-amide (Met-MCA) was pH 7.5 (Fig. S4C). The activity of GST-EhMetAP2 was reduced by 25% in the absence of MnCl2, or by more than 60% by the removal of MgCl2 or metal chelation with 10 mM ethylenediaminetetraacetic acid (EDTA), indicating the metal ions are required (Fig. S4D). The enzymatic turnover number Kcat and Michaelis-Menten kinetics Km values of GST-EhMetAP2 for Met-MCA were 0.82 ± 0.07 per minute and 0.77 ± 0.04 mM, respectively. The inhibitory constant (Ki) values, whose fumagillin concentration that decreased Vmax to 50% against GST-EhMetAP2, was 60 ± 33 nM (Fig. S4E).

EhPLA is neither an essential gene in E. histolytica nor the target of fumagillin for the amebicidal effect

In order to verify whether EhPLA is also the target of fumagillin and to examine the possibility that EhPLA may be an accessory factor of EhMetAP2 in E. histolytica, the ameba strain in which EhPLA gene was silenced, was created like EhMetAP2 gene-silenced strain described above. The expression of EhPLA gene was completely repressed in EhPLA gene-silenced strain (Fig. 4A). The expression of RNA polymerase II gene was not affected in either EhMetAP2 or EhPLA gene-silenced strain (Fig. 4A). The fumagillin sensitivity was not reduced in EhPLA gene-silenced strain, when compared to mock control strain, unlike in EhMetAP2 gene-silenced strain as shown above (Table 3). The IC50 values of EhPLA gene-silenced and mock control strains were 90.9 ± 6.8 and 89.0 ± 11.9 nM, respectively (P-value = 0.9) (Table 3; Fig. 4B).
Next, reciprocal immunoprecipitation assay of HA-MetAP2 with anti-HA antibody was conducted to confirm that EhPLA is not an effector of EhMetAP2. Mass spectrometric analysis of the immunoprecipitated sample showed that EhPLA was not detected as an HA-MetAP2 binding protein (Table S2). Taken together, these data indicate that EhPLA gene is not necessary for optimal growth under in vitro culture conditions, and thus, unlikely the target of fumagillin to be attributable for its amebicidal activity.

DISCUSSION

Redescription of fumagillin as a potent amebicidal compound that specifically targets EhMetAP2

In this study, we confirmed that fumagillin exhibits very potent amebicidal activity (the IC50 value: 49–94 nM) (Tables 2 and 3; Fig. S3). These values were influenced by the genetic background of E. histolytica strain and instability of fumagillin within solvent; however, fumagillin showed potency with ~130-fold lower IC50 than that of metronidazole (6.5 µM) and ~10-fold lower IC50 than auranofin (0.5 µM) (18) for the latter of which Phase I clinical trials to evaluate safety have been conducted (19). Fumagillin was previously utilized for the treatment of amebiasis patients early in the 1950s (5) and approved for the treatment of microsporidiosis in immunocompromised patients in France (20). Fumagillin was also shown to be efficacious against Plasmodium falciparum (21), Cryptosporidium parvum (17), and Trichomonas vaginalis (22). In 1990s, fumagillin-related compounds, including TNP-470, were shown to possess angiogenesis inhibitory activity, thus was explored for chemotherapy of metastasized solid tumors until its derivatives with low adverse effects reached clinical trials as anti-cancer agents (6, 7). Recently, fumagillin derivatives including beloranib (8) and ZGN-1061 (ZGN-1258) (23) have been explored in human clinical trials in patients with obesity, Prader-Willi syndrome, or type 2 diabetes (24). These studies indicate that those fumagillin derivatives are generally well tolerated with some adverse events of venous thromboembolism (25). Important safety issues that need to be precluded necessitate the in-depth understanding of the mechanism of action of the compound in both the human and pathogens.
In this study, we have demonstrated that the target of fumagillin in the important human enteric parasite E. histolytica is EhMetAP2 by both biochemical and reverse genetic approaches. Fumagillin binds to EhMetAP2 in an irreversible manner (Fig. S1), its amebicidal effect depends upon the amount of the target protein (Table 3), and enzyme inhibiting kinetics against GST-EhMetAP2 protein (Ki values; 60 ± 33 nM) (Fig. S4) showed the comparable to IC50 value in vitro (69 ± 1.3 nM) (Table 2). The substrates of human MetAP2 were previously identified to be glyceraldehyde-3-phosphate dehydrogenase (GAPDH), nitric oxide synthase (eNOS), and cyclophilin A (26, 27). In this study, although the substrates of EhMetAP2 have not been identified, several surface proteins are predicted to be myristoylated (28), and can be potentially the candidates of EhMetAP2 substrates. In-depth structural understanding of EhMetAP2 and fumagillin in progress should further provide downstream strategy for more efficacious and safer drugs without adverse effects.
We have shown using biotinylated-fumagillin that fumagillin covalently binds to MetAP2 in E. histolytica (Fig. S1). Biotinylated fumagillin retained amebicidal activity with the IC50 value of 20 times higher than that of non-modified fumagillin. It should be noted that the IC50 of biotinylated fumagillin was still five times lower than that of metronidazole (15). It was also reported for human MetAP2 that biotinylated fumagillin bound to its target with 10-fold less affinity than TNP-470, a fumagillin derivative, but it retained potency (10). This premise was based on the previous observation in other organisms in the human, yeasts, Plasmodium falciparum, and Giardia intestinalis (10, 14, 21, 29, 30). It was shown that His231 in the active site of human, MetAP2 is irreversibly bound with the reactive epoxide on the cyclohexane ring of fumagillin (9, 12). This histidine is positioned in the metal center, and conserved in all known MetAPs including EhMetAP2 (Fig. 2A). Thus, we presume by analogy that this histidine is engaged in the covalent bond formation with the spiroepoxide on fumagillin.

Dose response between EhMetAP2 and fumagillin sensitivity in E. histolytica

The sensitivity to fumagillin was clearly dependent on the amount of EhMetAP2 expressed in the trophozoites. Gene silencing of EhMetAP2 increased the fumagillin sensitivity (Table 3; Fig. 4B; Fig. S3). In contrast, overexpression of EhMetAP2 conferred only marginal (statistically insignificant) decrease in fumagillin susceptibility. Furthermore, expression of EhMetAP2Y379C, which is equivalent to HsMetAP2Y444C, which was discovered by virtue of ovalicin resistance (13), increased fumagillin resistance by 3.6-fold (Table 2). Curiously, HsMetAP2Y444C did not confer resistance to fumagillin in the yeast system (13). The Y444 residue is conserved in all MetAP2s but absent in MetAP1 (Fig. 2A), and involved in contact with the side chain of fumagillin (12). In human MetAP2, A362, also conserved among MetAP2s but not MetAP1 (Fig. 2A), is located in the β sheet partially forming the metal binding site, adjacent to E364, which is involved in metal coordination (12, 31). In contrast to HsMetAP2Y444C, HsMetAP2A362T conferred resistance to both fumagillin and ovalicin (13). Our result showing lack of significant fumagillin resistance by EhMetAP2A297T overexpression (Table 2) may indicate the structural difference of the metal-binding pocket. The observation may indicate that the structure of the fumagillin-binding pocket of EhMetAP2 might be different from that of human MetAP2, and suggest the possibility of developing highly selective fumagillin analogues against amebiasis.

Patatin family PLA is a potential fumagillin target in E. histolytica, but unlikely responsible for amebicidal effect

We identified PLA as an unprecedent target of fumagillin-binding protein from the amebic lysate (Fig. 3). The quantitative values of EhMetAP2 and EhPLA by mass spectrometry were comparable (Table 1), suggesting that the number of EhPLA molecules bound to fumagillin was as high as EhMetAP2; alternatively, interaction of biotinylated fumagillin and EhPLA is as strong as that to EhMetAP2. Although EhPLA bound to and concentrated with biotinylated fumagillin was abundant and the identification EhPLA as a fumagillin binding protein was unequivocal, PLA is not covalently bound to fumagillin. Although the Entamoeba genome encodes five additional phospholipases of patatin family (EHI_073330, EHI_167000, EHI_060610, EHI_153390, and EHI_068060), none of these patatin family phospholipases were identified from biotinylated fumagillin affinity experiments (Table 1), ensuring the specific interaction between EhPLA and biotinylated fumagillin. As MetAP2 is the only protein that was identified by affinity pulldown with biotinylated fumagillin from the human cell lysate (9, 10), the identification of EhPLA with biotinylated fumagillin indicates Entamoeba-specific interaction.
However, EhPLA does not seem to be involved in amebicidal effects of fumagillin. Neither overexpression nor gene silencing of EhPLA did not affect growth of trophozoites in the regular BI-S-33 medium, suggesting EhPLA is not essential in vitro. Furthermore, neither overexpression nor gene silencing of EhPLA affected sensitivity against fumagillin (Fig. 3 and 4; Table 3). Further analysis is needed to better understand whether fumagillin directly or indirectly binds to EhPLA, or if directly, how EhPLA interacts with the acyl chain of fumagillin. Patatin is originally identified as potato storage protein, and displays lipid acyl hydrolase, acyl transferase activities (32), and both PLA2 and PLA1 activities (14). Proteins encoding patatin-like domains are ubiquitously conserved among eukaryotes and prokaryotes (33). The biological roles of patatin family phospholipases are broad. In animal cells, cytosolic PLA2 cleaves an sn-2 ester bond of phospholipids to release, typically, arachidonic acid and lysophospholipids, which act on second messengers for various downstream cellular responses (34). In addition, human patatin family phospholipases are known to be involved in diverse lipid metabolism, such as lipolysis, lipogenesis, and immune regulation (35). In contrast, plant patatin phospholipases possess lipid acyl hydrolase activity of patatin and are important for the rapid degradation of cell membranes for signaling and defense against virus infection (36, 37). Apicomplexan parasites Plasmodium species cannot synthesize fatty acids and cholesterol de novo, and thus scavenge phospholipids from the erythrocyte membranes and human serum (38, 39). One of the patatin family phospholipases in Plasmodium has been shown to be involved in differentiation, called gametogenesis, which takes place in the mosquito midgut, and essential for malaria transmission (40). The specific substrates and products of EhPLA need to be clarified in future to understand the fate of fumagillin binding to EhPLA. One should also note that our demonstration of PLA as a stable and abundant binding protein for fumagillin in the ameba casts a slight doubt that MetAP2 is a single target of fumagillin in humans.

MATERIALS AND METHODS

Cells and reagents

Trophozoites of E. histolytica strains HM-1:IMSS cl6 (41) and G3 (42) were axenically maintained in BI-S-33 medium (BIS) at 35.5°C as previously described (41). The anti-HA (clone 16B12) monoclonal antibodies were purchased from Covance (Princeton, NJ, USA). The production of rabbit polyclonal antibodies against EhCS1 and Rab11B were previously described (40, 41).

General experimental procedures of the synthesis of chemical products

Optical rotations were measured with a JASCO DIP-1000 polarimeter. IR spectra were recorded on a Bruker ALPHA instrument. All NMR spectral data were recorded on a JEOL JNM-ECS400 spectrometer for 1H (400 MHz) and 13C (100 MHz). 1H NMR chemical shifts (referenced to residual CD3OD observed at δ H 3.31) were assigned using a combination of data from COSY and HMQC experiments. Similarly, 13C NMR chemical shifts (referenced to CD3OD observed at δ C 49.0) were assigned based on HMBC and HMQC experiments. HRESIMS spectra were obtained on a Waters LCT Premier XE time-of-flight (TOF) mass spectrometer. Chromatographic analyses were performed using an HPLC system consisting of a pump (model PU-2080, JASCO) and a UV detector (model UV-2075, JASCO). All chemicals and solvents used in this study were the best grade available and obtained from a commercial source (Nacalai Tesque). All moisture-sensitive reactions were performed under an atmosphere of argon or nitrogen, and the starting materials were azeotropically dried with toluene before use. Reactions were monitored by thin-layer chromatography (TLC), and TLC plates were visualized by both UV detection and phosphomolybdic acid solution. Silica Gel 60N (Irregular, 63–212 μm) were used for open column chromatography unless otherwise noted.

Plasmid construction

The full-length protein coding region of EhMetAP2 gene (EHI_126880) was amplified by PCR with following primers 5′-CTTATCCATATGATGTTCCAGATTATCCCGGG ATGCAAGCTACGGGAAA-3′ and 5′-TTAAGTTTAAAAAAGAAGAGTTCAACTCGAGTTAATAATCAAAACTTCTTGAAAG-3′ and inserted into SmaI and XhoI sites of pEhTex-HA to express EhMetAP2 protein fused with the three tandem hemagglutinin (HA) repeats at the amino terminus under the inducible tetracycline-dependent promoter (43). In-Fusion HD Cloning Kit (Clontech Laboratories, CA, USA) was used to construct the plasmid pEhTex-HA-EhMetAP2.
Plasmids that contain the protein-coding region of mutated EhMetAP2, EhMetAP2A297T and EhMetAP2Y379C were created using pEhTex-HA-EhMetAP2 with PCR-based site directed mutagenesis using Prime STAR Mutagenesis Basal Kit (Takara Bio).
A plasmid to establish E. histolytica lines that express EhPLA (EHI_200740) fusion protein containing HA-tagged at the amino terminus was constructed as follows. The full-length protein coding region of EhPLA gene was amplified by PCR with following primers: 5′-TCGAGACCGAGGAGAGGGTTAGGGATAG-3′ and 5′-GAACCCGGGATGAATATAAACCAACAACAAGAC-3′, where the restriction enzyme sites are underlined. PCR-amplified fragments were digested by XmaI and XhoI, and ligated into pEhEx-HA (44) that were predigested with the two enzymes to construct the plasmid. To construct plasmids for gene silencing of EhMetAP2 and EhPLA genes, initial 420 bp fragments of the EhMetAP2 and EhPLA coding region were PCR amplified with the following primers: 5′-GAAAGGCCTATGCAAGCTACGGGAAAACCAC-3′ and 5′- GAAGAGCTCTTCACATTCTTCTCTAACTTTTCTC-3′ (EhMetAP2); 5′- GAAAGGCCTATGAATATAAACCAACAACAAGAC −3′ and 5′- GAAGAGCTCTGGATATTTAGCAATAACTC −3′ (EhPLA). These PCR fragments were digested by StuI and SacI, and ligated into StuI- and SacI-double digested psAP2-Gunma (45, 46). These plasmids were designated as psAP2-MetAP2 and psAP2-PLA.

Establishment of E. histolytica transformants

To establish overexpressing E. histolytica strains, the trophozoites of HM-1:IMSS cl6 were transfected with pEhExHA-MetAP2, pEhExHA-PLA, or pEhExHA by lipofection as previously described (45). To establish E. histolytica gene-silenced strains, the trophozoites of G3 strain were transfected with psAP2-MetAP2, psAP2-PLA, or psAP2-Gunma by lipofection. G3 strain was previously created by Prof. David Mirelman’s group by introducing a plasmid that contains the upstream region of amebapore A gene promoter (47), and was previously used in a number of our studies (48, 49) in which gene of interest were specifically silenced by introducing the modified plasmid that we created, psAP2-Gunma and its derivatives (47, 50), and contain a fragment of the first ~420 bp of the target genes. Geneticin was added at a concentration of 1 µg/mL at 24 hours after transfection, and the geneticin concentrations were gradually increased until it reached 6–10 µg/mL in next 2 to 3 weeks. To induce expression of HA-tagged EhMetAP2 wild type and mutants, the transformants were cultured in the presence of 10 µg/mL tetracycline for 18 hours.

Immunoblot analysis

Approximately 105 trophozoites were harvested in the exponential growth phase, washed twice with phosphate buffered saline (PBS) pH 7.4, and resuspended in 50 µL of lysis buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1% Triton X-100) containing 50 µg/mL of E-64, and Complete mini protease inhibitor cocktail (Roche). Approximately 20 µg of the total cell lysates were separated on 12% SDS-polyacrylamide gels and subsequently electro transferred onto nitrocellulose membranes. The membranes were incubated with 5% non-fat dried milk in TBS-T (50 mM Tri-HCl, pH8.0, 150 mM NaCl, and 0.05% Tween-20) for 30 minutes. The proteins were reacted with anti-HA mouse IgG (with the dilution of 1:1,000), rabbit antiserum against CS1 (1:1,000) or Rab11B (1:500) at 4°C overnight. After the reaction with the primary antibodies, the membranes were washed with TBS-T three times. The membranes were further reacted with HRP-conjugated anti-mouse (anti-HA) or anti-rabbit (anti-CS1, anti-Rab11B) IgG antiserum (1:6,000 or 1:8,000, respectively) at room temperature for 1 hour. After washing with TBS-T three times, the specific proteins were visualized with chemiluminescence detection using Immobilon Western Chemiluminescent HRP Substrate (Millipore Corporation, MA, USA) according to the manufacturer’s protocol.

Determination of the 50% inhibitory concentrations of fumagillin resistance assay

Approximately 5 × 103 E. histolytica trophozoites were incubated in 280 µL of BI-S-33 medium containing a serial dilution of fumagillin, metronidazole, or only dimethyl sulfoxide (DMSO) in a well on a 96-well plate at 35.5°C for 48 hours. The concentrations of fumagillin and metronidazole ranged 10–640 nM and 0.5–32 µM, respectively. After incubation, BI-S-33 medium was removed and 100 µL of WST-1 working solution (a mixture of WST-1 and OPTI-MEM with the ratio of 1:9 in volume). After the plate was incubated at 37°C for 30 minutes, the absorbance at 450 nm was measured.

Synthesis of biotinylated fumagillin

To identify the target of fumagillin, biotinylated fumagillin was synthesized as follows (Fig. 5).
Fig 5
Fig 5 Structures of fumagillin (1), biotinylated fumagillin (2) and biotin-linker (3).
N-(3-aminopropyl)-1-{5-[(3aS,4S,6aR)-2-oxohexahydro-1H-thieno(3,4-d)imidazol-4-yl]pentanamido}-3,6,9,12-tetraoxapentadecan-15-amide (biotin-linker, 3): to a solution of known azide (51) (30.0 mg, 0.048 mmol) in EtOH (2 mL) was added 20% Pd(OH)2/C (50% water content, 10 mg). The reaction mixture vigorously stirred under a hydrogen atmosphere at room temperature for 3 hours. The reaction mixture was filtered, and the filtrate was concentrated to give the crude amine 3 (29.0 mg), which was used for the next reaction without further purification.
(3R,4S,5S,6R)−5-methoxy-4-[(2R,3R)−2-methyl-3-(3-methylbut-2-en-1-yl)oxiran-2-yl]−1-oxaspiro(2.5)octan-6-yl (28E,30E,32E,34E)−5,21,27-trioxo-1-[(3aS,4S,6aR)−2-oxohexahydro-1H-thieno(3,4-d)imidazol-4-yl]−9,12,15,18-tetraoxa-6,22,26-triazahexatriaconta-28,30,32,34-tetraen-36-oate (biotinylated fumagillin, 2): to a stirred solution of the fumagillin dicyclohexylamine salt (60% purity, SINOVA, #SL-09704, 8.0 mg, equivalent to 0.0075 mmol) and a part of amine 3 (10.3 mg) in DMF (0.1 mL) cooled at 0°C were added DIPEA (one drop) and HATU (7.1 mg, 0.019 mmol). After stirring at room temperature for 1 hour, the reaction mixture was diluted with 10% aqueous citric acid (1 mL) and extracted with CH2Cl2 (10 mL × 3). The combined organic layers were washed with saturated aqueous NaHCO3 (10 mL) and brine (10 mL), dried over anhydrous Na2SO4, and concentrated. The residue was purified by HPLC [Cosmosil 5C18-MS-II (20 × 250 mm); flow rate 5 mL/minute; detection at 300 nm; solvent 72% MeOH] to give biotinylated fumagillin (2) (5.3 mg, t R = 36.7min, 0.0054 mmol, 72% yield converted from the purity) as a colorless oil; (α)D 25 +11 (c 0.44, MeOH); IR (neat) 3291, 3078, 2928, 2872, 1699, 1652, 1622, 1543, 1456, 1353, 1326, 1301, 1235, 1171, 1127 cm-1; 1H NMR (400 MHz, CD3OD, Fig. S5) δ 7.38 (dd, J = 15.4, 11.3 Hz, 1H), 7.22 (dd, J = 15.0, 10.9 Hz, 1H), 6.82–6.67 (m, 2H), 6.63–6.55 (m, 2H), 6.11 (d, J = 15.0Hz, 1H), 6.04 (d, J = 15.4 Hz, 1H), 5.71 (m, 1H), 5.25 (m, 1H), 4.49 (dd, J = 8.0, 4.8Hz, 1H), 4.30 (dd, J = 8.0, 4.4 Hz, 1H), 3.73 (dd, J = 11.3, 3.0 Hz, 1H), 3.73 (t, J = 6.3Hz, 2H), 3.65–3.59 (m, 12H), 3.53 (t, J = 5.4 Hz, 2H), 3.42 (s, 3H), 3.35 (t, J = 5.4 Hz, 2H), 3.30 (m, 1H), 3.24 (t, J = 6.9 Hz, 2H), 3.22 (m, 1H), 2.99 (d, J = 4.5Hz, 1H), 2.92 (dd, J = 12.9, 4.8 Hz, 1H), 2.72–2.68 (m, 2H), 2.59 (d, J = 4.5 Hz, 1H), 2.45 (t, J = 6.1 Hz, 2H), 2.33 (m, 1H), 2.22 (m, 1H), 2.22 (t, J = 7.5 Hz, 2H), 2.15 (ddd, J = 13.6, 8.4 4.5 Hz, 1H), 1.98 (d, J = 11.3 Hz, 1H), 1.96–1.83 (m, 2H), 1.78–1.54 (m, 6H), 1.76 (brs, 3H), 1.68 (brs, 3H), 1.48–1.39 (m, 2H), 1.21 (s, 3H), 1.09 (ddd, J = 13.6, 3.2, 2.4 Hz, 1H); 13C{1H} NMR (100 MHz, CD3OD, Fig. S4) δ 176.1, 174.1, 168.5, 167.8, 166.1, 145.7, 141.3, 141.0, 139.4, 136.0, 135.5, 134.2, 126.8, 123.2, 119.8, 80.8, 71.6 (3C), 71.5, 71.5, 71.4, 71.3, 70.6, 68.3, 68.0, 63.4, 62.4, 61.6, 60.6, 60.5, 57.0, 56.9, 51.7, 41.1, 40.4, 38.0, 37.9, 37.8, 36.7, 30.3, 30.2, 29.8, 29.5, 28.3, 26.9, 26.6, 25.9, 18.1, 14.2; HRMS (ESI-TOF) m/z 1010.5165 [M + Na]+ (calculated for C50H77N5O13SNa 1010.5136).

Purification and identification of binding proteins of biotinylated fumagillin

Approximately 6 × 106 trophozoites of the HA-EhMetAP2 expressing amoeba strain were cultured on a 10 cm diameter dish in BIS medium under the anaerobic conditions using Anaerocult (Merck, Darmstadt, Germany). The amoebae were detached from the dishes by adding cold PBS and incubated on ice for 10 minutes. The cells were collected by centrifugation, lysed with 800 µL of lysis buffer, and used in immunoblot analysis. After the insoluble debris was removed by centrifugation at 16,000 × g at 4°C for 5 minutes, the lysate (“total lysate”) was mixed and incubated with approximately 50 µL of Pierce NewtrAvidin agarose beads (50% slurry) (Thermo Fisher Scientific, Waltham, MA) 4°C for 1 hour to reduce non-specific binding in immunoprecipitation. After centrifugation at 3,000 × g at 4°C for 5 minutes, the supernatant was transferred to a new 1.5 mL tube and 1.74 µM biotinylated fumagillin or biotin-linker was added to the tube, and the mixture was incubated at 4°C for 2 hours. The concentration of biotinylated fumagillin was 8.6-fold higher than the concentration of IC50 value of HA-EhMetAP2 cells. Approximately 50 µL of NewtrAvidin agarose beads was added to and incubated with the soluble fraction at 4°C for 2 hours. The soluble unbound fraction was collected after centrifugation at 3,000 × g at 4°C for 3 minutes (“unbound fraction”). The agarose beads collected by centrifugation were washed three times with 1 mL of lysis buffer and eluted with 50 µL of 2 × SDS sample buffer [0.25 M Tris-Hcl(pH 6.8), 8% SDS, 8% 2-mercaptoethanol, and 40% glycerol, 0.004% bromophenol blue] by incubating the tube in boiling water for 5 minutes. Each sample was separated using SDS-PAGE, and visualized by silver staining. The in-gel trypsin digestion of proteins, liquid chromatography, and time-of-flight tandem mass spectrometry (LC-ToF MS/MS) were performed at Mass Spectrometry and Proteomics Facility in Biological Chemistry, School of Medicine of Johns Hopkins University. Proteins were digested with trypsin, labeled using the eight-plex iTRAQ isobaric mass tags (ABSciex) and analyzed by tandem mass spectrometry on an LTRQ Vwlos Orbitrap interfaced with an Eksigent 2D NanoLC (52).

Immunofluorescence assay

Approximately 5 × 103 E. histolytica trophozoites were incubated in 50 µL BI-S-33 medium in 8 mm round wells on a slide glass at 35.5°C for 15 minutes. Cells were fixed with 3.7% paraformaldehyde and subsequently permeabilized with 0.2% saponin in PBS containing 1% bovine serum albumin for 10 minutes each at room temperature. The cells were reacted with anti-HA mouse IgG (with the dilution of 1:1,000). After washing with PBS three times, the cells were reacted with Alexa Fluor-488 anti-mouse IgG secondary antibody (1:1,000). The samples were observed using Carl Zeiss LSM780 Meta laser-scanning confocal microscope. The resultant images were further analyzed using Zen software (Carl Zeiss, Oberkochen, Germany).

Immunoprecipitation of HA-PLA

Approximately 6 × 106 trophozoites of the HA-EhMetAP2 expressing amoeba strain were cultured on a 10 cm diameter dish in BIS medium under the anaerobic conditions using Anaerocult (Merck, Darmstadt, Germany). The amoebae were detached from the dishes by adding cold PBS and incubated on ice for 10 minutes. After centrifugation at 800 × g at 4°C for 3 minutes to collect the cells, the supernatant was removed and the amoebae were resuspended in 500 µL of 8 mg/mL dithiobis (succinimidyl propionate) (DSP) solution (Thermo Fisher, MA, USA). The mixture was incubated on the rotator (10 rpm) at 4°C for 30 minutes. To quench the reaction, 50 µL of 1 M Tris-HCl, pH 7.5 was added and the mixture was further incubated as above for 10 minutes. After the amoebae were treated with DSP, they were washed with PBS. The cells were lysed with 800 µL of lysis buffer, and the insoluble debris was removed by centrifugation at 16,000 × g at 4°C for 5 minutes, the lysate (“total lysate”) was mixed and incubated with approximately 50 µL of Protein G Sepharose beads (GE Healthcare, IL, USA) (80% slurry) 4°C for 1 hour to reduce non-specific binding in immunoprecipitation. After centrifugation at 3,000 × g at 4°C for 5 minutes, the supernatant was transferred to a new 1.5 mL tube containing approximately 50 µL (80% slurry) of anti-HA monoclonal antibody produced in mouse, clone HA-7, purified immunoglobulin conjugated to agarose beads (Sigma Aldrich). The tubes were incubated at 4°C for 3.5 hours. The soluble unbound fraction was collected after centrifugation at 3,000 × g at 4°C for 3 minutes (“unbound fraction”). The agarose beads collected by centrifugation were washed three times with 1 mL of lysis buffer and eluted with 50 µL of 2 × SDS sample buffer [0.25 M Tris-Hcl (pH 6.8), 8% SDS, 8% 2-mercaptoethanol, 40% glycerol, and 0.004% bromophenol blue] by incubating the tube in boiling water for 5 minutes. Each sample was separated using SDS-PAGE, and visualized by silver staining. The in-gel trypsin digestion of proteins, liquid chromatography, and time-of-flight tandem mass spectrometry (LC-ToF MS/MS) were performed at Mass Spectrometry and Proteomics Facility in Biological Chemistry, School of Medicine of Johns Hopkins University as described above.

Expression and purification of recombinant EhMetAP2 in yeast system

A synthetic gene coding for EhMetAP2 with Saccharomyces cerevisiae codon was synthesized (Eurofin genomics) and inserted into EcoR1-Xho1 sites of the yeast expression vector pYEX4T-1 (Clontech) to express N-terminus GST-fusion protein. The plasmid was introduced into protease deficient S. cerevisiae BY2777 (MATa prb1-1122 prc1-407 pep4-3 ura3-52 leu2 trp1) (16), which was provided by the National Bio-Resource Project (NBRP) of the MEXT, Japan, and selected with leucine minus minimal medium at 30°C. Expression of GST-EhMetAP2 was induced by the addition of 5 µM CuSO4 for 18 hours at 30°C. Two hundred milliliters of culture cell pellet was broken by the glass beads with 5 mL lysis buffer (50 mM Tris, pH 6.8, 150 mM NaCl, 0.1 mM MnCl2, 0.1 mM MgCl2, 1 mM PMSF). Cell lysate obtained after the 13,000 × g centrifugation for 10 minutes was incubated with 500 µL glutathione 4B-Sepharose resin to immobilize the GST-EhMetAP2 protein for 18 hours at 4°C (53). After the resins were extensively washed with lysis buffer, the GST-EhMetAP2 protein was eluted by 200 µL elution buffer [100 mM reduced glutathione (GSH), 50 mM Tris, pH 8.0, 0.1 mM MnCl2, 0.1 mM MgCl2]. GST-EhMetAP2 was concentrated with Microcon-10 kDa (Millipore) with 2 mL of elution buffer to remove the excess GSH in the eluted sample. Purified GST-EhMetAP2 protein was mixed with final 10% glycerol, and stored under −80°C.

Methionine aminopeptidase enzyme assay

The aminopeptidase activity was assayed fluorometrically based on hydrolysis of L-methionine 4-methycoumaryl-7-amide (Met-MCA; Peptide Institute, Inc., Japan) in a 96-well microplate format (17). In brief, 4 pmol of GST-EhMetAP2 protein was reacted with 0.25–2.0 mM Met-MCA (Code 3149-v: Peptide Institute, Inc, Japan) containing 50 mM Tris-HCl (pH 7.5), 1 mM MgCl2, 1 mM MnCl2, 0.01% Triton X-100 in 20 µL reaction, corresponding to the final concentration of EhMetAP was 200 nM. The fluorescence release of 7-AMC was measured after 120 minutes incubation at 37°C at an excitation wavelength of 370 nm and an emission wavelength of 465 nm with a DTX880 Multimode Detector (Beckman Coulter, Brea, CA, USA) (54). The Michaelis constant (Km) was determined by the end point assay. In the fumagillin inhibition assay, varying concentration of substrate Met-MCA and recombinant MetAP was pre-incubated with 10–30 nM fumagillin at 4°C for 2 hours. The data were plotted in double-reciprocal plot to examine the mode of inhibition and to calculate the inhibitory constant (Ki). Kinetic data were estimated using GraphPad Prism version 6 (GraphPad Software, San Diego, USA). Experiments were repeated three times with triplicate replicates per experiment and kinetic values were represented as the means ± SD for independent three assays.

ACKNOWLEDGMENTS

We thank Dr. David Mirelman, Weisman Institute, Israel, for the G3 strain and pSAP-2 plasmid. S. cerevisiae BY2777 strain was obtained from the National Bio-Resource Project (NBRP) of the Ministry of Education, Culture, Sports, Science and Technology (MEXT).
We thank Eiko Nakasone and Yuko Umeki for the technical assistance.
This work was supported by Japan Society for Promotion of Sciences (JSPS) KAKENHI (Grant Numbers JP21H02723, JP21K19372, JP21KK135, JPJSCCB20190010 to T.N.; JP21K15426, JP23K14510 to N.W.; JP22K07050 to Y.S.N.), from the Japan Agency for Medical Research and Development (AMED) (JP23fk0108680, JP233fa627001, JP23jm0110022 to T.N.; JP23fk0108683 and JP23fk0108680 to Y.S.N.).

SUPPLEMENTAL MATERIAL

Supplemental file 1 - aac.00560-23-s0001.pdf
Fig. S1 to S5.
ASM does not own the copyrights to Supplemental Material that may be linked to, or accessed through, an article. The authors have granted ASM a non-exclusive, world-wide license to publish the Supplemental Material files. Please contact the corresponding author directly for reuse.

REFERENCES

1.
Stanley SL. 2003. Amoebiasis. Lancet 361:1025–1034.
2.
Fotedar R, Stark D, Beebe N, Marriott D, Ellis J, Harkness J. 2007. Laboratory diagnostic techniques for Entamoeba species. Clin Microbiol Rev 20:511–532.
3.
Hernández Ceruelos A, Romero-Quezada LC, Ruvalcaba Ledezma JC, López Contreras L. 2019. Therapeutic uses of metronidazole and its side effects: an update. Eur Rev Med Pharmacol Sci 23:397–401.
4.
Hanson FR, Eble TE. 1949. An antiphage agent isolated from Aspergillus sp. J Bacteriol 58:527–529.
5.
Killough JH, Magill GB, Smith RC. 1952. The treatment of amebiasis with fumagillin. Science 115:71–72.
6.
Ingber D, Fujita T, Kishimoto S, Sudo K, Kanamaru T, Brem H, Folkman J. 1990. Synthetic analogues of fumagillin that inhibit angiogenesis and suppress tumour growth. Nature 348:555–557.
7.
Heinrich T, Seenisamy J, Becker F, Blume B, Bomke J, Dietz M, Eckert U, Friese-Hamim M, Gunera J, Hansen K, Leuthner B, Musil D, Pfalzgraf J, Rohdich F, Siegl C, Spuck D, Wegener A, Zenke FT. 2019. Identification of methionine aminopeptidase-2 (MetAP-2) inhibitor M8891: a clinical compound for the treatment of cancer. J Med Chem 62:11119–11134.
8.
Hughes TE, Kim DD, Marjason J, Proietto J, Whitehead JP, Vath JE. 2013. Ascending dose-controlled trial of beloranib, a novel obesity treatment for safety, tolerability, and weight loss in obese women. Obesity (Silver Spring) 21:1782–1788.
9.
Griffith EC, Su Z, Turk BE, Chen S, Chang YH, Wu Z, Biemann K, Liu JO. 1997. Methionine aminopeptidase (type 2) is the common target for angiogenesis inhibitors AGM-1470 and ovalicin. Chem Biol 4:461–471.
10.
Sin N, Meng L, Wang MQW, Wen JJ, Bornmann WG, Crews CM. 1997. The anti-angiogenic agent fumagillin covalently binds and inhibits the methionine aminopeptidase, MetAP-2. Proc Natl Acad Sci U S A 94:6099–6103.
11.
Bradshaw RA, Yi E. 2002. Methionine aminopepticases and angiogenesis. Essays Biochem 38:65–78.
12.
Liu S, Widom J, Kemp CW, Crews CM, Clardy J. 1998. Structure of human methionine aminopeptidase-2 complexed with fumagillin. Science 282:1324–1327.
13.
Brdlik CM, Crews CM. 2004. A single amino acid residue defines the difference in ovalicin sensitivity between type I and II methionine aminopeptidases. J Biol Chem 279:9475–9480.
14.
Chen G, Greer MS, Weselake RJ. 2013. Plant phospholipase A: advances in molecular biology, biochemistry, and cellular function. Biomol Concepts 4:527–532.
15.
Penuliar GM, Nakada-Tsukui K, Nozaki T. 2015. Phenotypic and transcriptional profiling in Entamoeba histolytica reveal costs to fitness and adaptive responses associated with metronidazole resistance. Front Microbiol 6:354.
16.
Iizasa E, Mitsutomi M, Nagano Y. 2010. Direct binding of a plant LysM receptor-like kinase, LysM RLK1/CERK1, to chitin in vitro. J Biol Chem 285:2996–3004.
17.
Kang JM, Ju HL, Sohn WM, Na BK. 2012. Characterization of the biochemical properties of two methionine aminopeptidases of Cryptosporidium parvum. Parasitol Int 61:707–710.
18.
Debnath A, Parsonage D, Andrade RM, He C, Cobo ER, Hirata K, Chen S, García-Rivera G, Orozco E, Martínez MB, Gunatilleke SS, Barrios AM, Arkin MR, Poole LB, McKerrow JH, Reed SL. 2012. A high-throughput drug screen for Entamoeba histolytica identifies a new lead and target. Nat Med 18:956–960.
19.
Capparelli EV, Bricker-Ford R, Rogers MJ, McKerrow JH, Reed SL. 2017. Phase I clinical trial results of auranofin, a novel antiparasitic agent. Antimicrob Agents Chemother 61:e01947-16.
20.
Maillard A, Scemla A, Laffy B, Mahloul N, Molina JM. 2021. Safety and efficacy of fumagillin for the treatment of intestinal microsporidiosis. A French prospective cohort study. J Antimicrob Chemother 76:487–494.
21.
Chen X, Xie S, Bhat S, Kumar N, Shapiro TA, Liu JO. 2009. Fumagillin and fumarranol interact with P. falciparum methionine aminopeptidase 2 and inhibit malaria parasite growth in vitro and in vivo. Chem Biol 16:193–202.
22.
Lam AYF, Vuong D, Jex AR, Piggott AM, Lacey E, Emery-Corbin SJ. 2021. TriTOX: a novel trichomonas vaginalis assay platform for high-throughput screening of compound libraries. Int J Parasitol Drugs Drug Resist 15:68–80.
23.
Burkey BF, Hoglen NC, Inskeep P, Wyman M, Hughes TE, Vath JE. 2018. Preclinical efficacy and safety of the novel antidiabetic, antiobesity MetAP2 inhibitor ZGN-1061. J Pharmacol Exp Ther 365:301–313.
24.
Mahmoud R, Kimonis V, Butler MG. 2023. Clinical trials in prader-willi syndrome: a review. Int J Mol Sci 24:2150.
25.
McCandless SE, Yanovski JA, Miller J, Fu C, Bird LM, Salehi P, Chan CL, Stafford D, Abuzzahab MJ, Viskochil D, Barlow SE, Angulo M, Myers SE, Whitman BY, Styne D, Roof E, Dykens EM, Scheimann AO, Malloy J, Zhuang D, Taylor K, Hughes TE, Kim DD, Butler MG. 2017. Effects of MetAP2 inhibition on hyperphagia and body weight in prader–willi syndrome: a randomized, double-blind, placebo-controlled trial. Diabetes Obes Metab 19:1751–1761.
26.
Turk BE, Griffith EC, Wolf S, Biemann K, Chang YH, Liu JO. 1999. Selective inhibition of amino-terminal methionine processing by TNP-470 and ovalicin in endothelial cells. Chem Biol 6:823–833.
27.
Xiao Q, Zhang F, Nacev BA, Liu JO, Pei D. 2010. Protein N-terminal processing: substrate specificity of Escherichia coli and human methionine aminopeptidases. Biochemistry 49:5588–5599.
28.
Biller L, Matthiesen J, Kühne V, Lotter H, Handal G, Nozaki T, Saito-Nakano Y, Schümann M, Roeder T, Tannich E, Krause E, Bruchhaus I. 2014. The cell surface proteome of Entamoeba histolytica. Mol Cell Proteomics 13:132–144.
29.
Griffith EC, Su Z, Niwayama S, Ramsay CA, Chang YH, Liu JO. 1998. Molecular recognition of angiogenesis inhibitors fumagillin and ovalicin by methionine aminopeptidase 2. Proc Natl Acad Sci U S A 95:15183–15188.
30.
Padia J, Kulakova L, Galkin A, Herzberg O. 2020. Discovery and preclinical development of antigiardiasis fumagillol derivatives. Antimicrob Agents Chemother 64:e00582-20.
31.
Nonato MC, Widom J, Clardy J. 2006. Human methionine aminopeptidase type 2 in complex with l- and d-methionine. Bioorg Med Chem Lett 16:2580–2583.
32.
Andrews DL, Beames B, Summers MD, Park WD. 1988. Characterization of the lipid acyl hydrolase activity of the major potato (Solanum tuberosum) tuber protein, patatin, by cloning and abundant expression in a baculovirus vector. Biochem J 252:199–206.
33.
Wilson PA, Gardner SD, Lambie NM, Commans SA, Crowther DJ. 2006. Characterization of the human patatin-like phospholipase family. J Lipid Res 47:1940–1949.
34.
Kim RR, Chen Z, Mann TJ, Bastard K, F Scott K, Church WB. 2020. Structural and functional aspects of targeting the secreted human group IIA phospholipase A2. Molecules 25:4459.
35.
Qiao A, Liang J, Ke Y, Li C, Cui Y, Shen L, Zhang H, Cui A, Liu X, Liu C, Chen Y, Zhu Y, Guan Y, Fang F, Chang Y. 2011. Mouse patatin-like phospholipase domain-containing 3 influences systemic lipid and glucose homeostasis. Hepatology 54:509–521.
36.
Dhondt S, Geoffroy P, Stelmach BA, Legrand M, Heitz T. 2000. Soluble phospholipase A2 activity is induced before oxylipin accumulation in tobacco mosaic virus-infected tobacco leaves and is contributed by patatin-like enzymes. Plant J 23:431–440.
37.
La Camera S, Balagué C, Göbel C, Geoffroy P, Legrand M, Feussner I, Roby D, Heitz T. 2009. The arabidopsis patatin-like protein 2 (PLP2) plays an essential role in cell death execution and differentially affects biosynthesis of oxylipins and resistance to pathogens. Mol Plant Microbe Interact 22:469–481.
38.
Labaied M, Jayabalasingham B, Bano N, Cha SJ, Sandoval J, Guan G, Coppens I. 2011. Plasmodium salvages cholesterol internalized by LDL and synthesized de novo in the liver. Cell Microbiol 13:569–586.
39.
Mitamura T, Palacpac NMQ. 2003. Lipid metabolism in Plasmodium falciparum-infected erythrocytes: possible new targets for malaria chemotherapy. Microbes Infect 5:545–552.
40.
Singh P, Alaganan A, More KR, Lorthiois A, Thiberge S, Gorgette O, Guillotte Blisnick M, Guglielmini J, Aguilera SS, Touqui L, Singh S, Chitnis CE. 2019. Role of a patatin-like phospholipase in Plasmodium falciparum gametogenesis and malaria transmission. Proc Natl Acad Sci U S A 116:17498–17508.
41.
Diamond LS, Mattern CFT, Bartgis IL. 1972. Viruses of Entamoeba histolytica. I. Identification of transmissible virus-like agents. J Virol 9:326–341.
42.
Bracha R, Nuchamowitz Y, Mirelman D. 2003. Transcriptional silencing of an amoebapore gene in Entamoeba histolytica: molecular analysis and effect on pathogenicity. Eukaryot Cell 2:295–305.
43.
Makiuchi T, Santos HJ, Tachibana H, Nozaki T. 2017. Hetero-oligomer of dynamin-related proteins participates in the fission of highly divergent mitochondria from Entamoeba histolytica. Sci Rep 7:13439.
44.
Yousuf MA, Mi-ichi F, Nakada-Tsukui K, Nozaki T. 2010. Localization and targeting of an unusual pyridine nucleotide transhydrogenase in Entamoeba histolytica. Eukaryot Cell 9:926–933.
45.
Nozaki T, Asai T, Sanchez LB, Kobayashi S, Nakazawa M, Takeuchi T. 1999. Characterization of the gene encoding serine acetyltransferase, a regulated enzyme of cysteine biosynthesis protist parasites Entamoeba histolytica and Entamoeba dispar. regulation and possible function of the cysteine biosynthetic pathway in Entamoeba. J Biol Chem 274:32445–32452.
46.
Mitra BN, Saito-Nakano Y, Nakada-Tsukui K, Sato D, Nozaki T. 2007. Rab11B small GTPase regulates secretion of cysteine proteases in the enteric protozoan parasite Entamoeba histolytica. Cell Microbiol 9:2112–2125.
47.
Mi-ichi F, Makiuchi T, Furukawa A, Sato D, Nozaki T. 2011. Sulfate activation in mitosomes plays an important role in the proliferation of Entamoeba histolytica. PLoS Negl Trop Dis 5:e1263.
48.
Watanabe N, Nakada-Tsukui K, Nozaki T. 2020. Two isotypes of phosphatidylinositol 3-phosphate-binding sorting nexins play distinct roles in trogocytosis in Entamoeba histolytica. Cell Microbiol 22:e13144.
49.
Saito-Nakano Y, Wahyuni R, Nakada-Tsukui K, Tomii K, Nozaki T. 2021. Rab7D small GTPase is involved in phago-, trogocytosis and cytoskeletal reorganization in the enteric protozoan Entamoeba histolytica. Cell Microbiol 23:e13267.
50.
Penuliar GM, Furukawa A, Sato D, Nozaki T. 2011. Mechanism of trifluoromethionine resistance in Entamoeba histolytica. J Antimicrob Chemother 66:2045–2052.
51.
Peddibhotla S, Dang Y, Liu JO, Romo D. 2007. Simultaneous arming and structure/activity studies of natural products employing O-H insertions: an expedient and versatile strategy for natural products-based chemical genetics. J Am Chem Soc 129:12222–12231.
52.
Kammers K, Cole RN, Tiengwe C, Ruczinski I. 2015. Detecting significant changes in protein abundance. EuPA Open Proteom 7:11–19.
53.
Christoforidis S, Zerial M. 2000. Purification and identification of novel rab effectors using affinity chromatography. Methods 20:403–410.
54.
Kumar R, Tiwari K, Dubey VK. 2017. Methionine aminopeptidase 2 is a key regulator of apoptotic like cell death in Leishmania donovani. Sci Rep 7:1–10.

Information & Contributors

Information

Published In

cover image Antimicrobial Agents and Chemotherapy
Antimicrobial Agents and Chemotherapy
Volume 67Number 1115 November 2023
eLocator: e00560-23
Editor: Audrey Odom John, The Children's Hospital of Philadelphia, Philadelphia, Pennsylvania, USA
PubMed: 37874291

History

Received: 2 May 2023
Accepted: 27 August 2023
Published online: 24 October 2023

Keywords

  1. Entamoeba histolytica
  2. fumagillin
  3. methionine aminopeptidase 2
  4. patatin family

Contributors

Authors

Department of Biomedical Chemistry, Graduate School of Medicine, The University of Tokyo, Tokyo, Japan
Author Contributions: Conceptualization, Data curation, Formal analysis, Funding acquisition, Investigation, Methodology, Validation, Visualization, Writing – original draft, and Writing – review and editing.
Department of Parasitology and Antimicrobial Resistance Research Center, National Institute of Infectious Diseases, Tokyo, Japan
Author Contributions: Conceptualization, Data curation, Formal analysis, Funding acquisition, Investigation, Methodology, Validation, Visualization, Writing – original draft, and Writing – review and editing.
Naoaki Kurisawa
Department of Chemistry, Faculty of Science and Technology, Keio University, Kanagawa, Japan
Author Contributions: Formal analysis, Methodology, Resources, Validation, and Writing – review and editing.
Keisuke Otomo
Department of Chemistry, Faculty of Science and Technology, Keio University, Kanagawa, Japan
Author Contributions: Formal analysis, Methodology, Resources, Validation, and Writing – review and editing.
Kiyotake Suenaga
Department of Chemistry, Faculty of Science and Technology, Keio University, Kanagawa, Japan
Author Contributions: Formal analysis, Methodology, Resources, and Writing – review and editing.
Kentaro Nakano
Degree Programs in Biology, Graduate School of Science and Technology, University of Tsukuba, Ibaraki, Japan
Author Contributions: Formal analysis, Investigation, and Writing – review and editing.
Department of Biomedical Chemistry, Graduate School of Medicine, The University of Tokyo, Tokyo, Japan
Author Contributions: Conceptualization, Data curation, Funding acquisition, Investigation, Project administration, Supervision, Validation, Writing – original draft, and Writing – review and editing.

Editor

Audrey Odom John
Editor
The Children's Hospital of Philadelphia, Philadelphia, Pennsylvania, USA

Notes

Natsuki Watanabe and Yumiko Saito-Nakano contributed equally to this article. Author order was determined in order of increasing seniority.
The authors declare no conflict of interest.

Metrics & Citations

Metrics

Note:

  • For recently published articles, the TOTAL download count will appear as zero until a new month starts.
  • There is a 3- to 4-day delay in article usage, so article usage will not appear immediately after publication.
  • Citation counts come from the Crossref Cited by service.

Citations

If you have the appropriate software installed, you can download article citation data to the citation manager of your choice. For an editable text file, please select Medlars format which will download as a .txt file. Simply select your manager software from the list below and click Download.

View Options

Figures and Media

Figures

Media

Tables

Share

Share

Share the article link

Share with email

Email a colleague

Share on social media

American Society for Microbiology ("ASM") is committed to maintaining your confidence and trust with respect to the information we collect from you on websites owned and operated by ASM ("ASM Web Sites") and other sources. This Privacy Policy sets forth the information we collect about you, how we use this information and the choices you have about how we use such information.
FIND OUT MORE about the privacy policy