Combination of Multiplex PCRs for Staphylococcal Cassette Chromosome mec Type Assignment: Rapid Identification System for mec, ccr, and Major Differences in Junkyard Regions
ABSTRACT
Staphylococcal cassette chromosome mec (SCCmec) typing, in combination with genotyping of the Staphylococcus aureus chromosome, has become essential for defining methicillin-resistant S. aureus (MRSA) clones in epidemiological studies. We have developed a convenient system for SCCmec type assignment. The system consists of six multiplex PCRs (M-PCRs) for identifying the ccr gene complex (ccr), the mec gene complex (mec), and specific structures in the junkyard (J) regions: M-PCR with primer set 1 (M-PCR 1) identified five types of ccr genes; M-PCR 2 identified class A to class C mec; M-PCRs 3 and 4 identified specific open reading frames in the J1 regions of type I and IV and of type II, III, and V SCCmec elements, respectively; M-PCR 5 identified the transposons Tn554 and ΨTn554 integrated into the J2 regions of type II and III SCCmec elements; and M-PCR 6 identified plasmids pT181 and pUB110 integrated into J3 regions. The system was validated with 99 MRSA strains carrying SCCmec elements of different types. The SCCmec types of 93 out of the 99 MRSA strains could be assigned. The SCCmec type assignments were identical to those made with a PCR system that uses numerous primer pairs to identify genes or gene alleles. Our system of six M-PCRs is thus a convenient and reliable method for typing SCCmec elements.
Methicillin-resistant Staphylococcus aureus (MRSA) strains have become prevalent in health care facilities and in the community worldwide (3, 4). MRSA strains produce penicillin binding protein 2′ or 2a, which is poorly acylated by β-lactam antibiotics (5, 22, 25). The mecA gene, encoding PBP2a, is carried on a peculiar type of mobile genetic element inserted into the staphylococcal chromosome, designated staphylococcal cassette chromosome mec (SCCmec) elements (12, 14, 24).
SCCmec elements typically share four characteristics: first, they carry the mec gene complex (mec) consisting of the methicillin resistance determinant mecA and its regulatory genes and insertion sequences; second, they carry the ccr gene complex (ccr) consisting of ccr genes that are responsible for the mobility of the element and its surrounding sequences; third, they have characteristic directly repeated nucleotide sequences and inverted complementary sequences at both ends; and last, they integrate into the 3′ end of an open reading frame (ORF), orfX.
Despite these similarities, the structures of SCCmec elements are rather divergent. Allotypic differences that are used for SCCmec type definitions have been identified in both ccr and mec. Five types of ccr and four classes of mec have been reported. ccr types 1 to 4 carry the ccrA and ccrB genes, which share approximately 80% identity with each other, and the type 5 ccr carries the ccrC gene (10, 11, 17, 19). Four classes of the mec gene complexes have been identified among methicillin-resistant staphylococcal strains of various species: class A mec, consisting of IS431mec-mecA-mecR1-mecI; class B mec, consisting of IS431mec-mecA-ΔmecR1-IS1272; class C mec, consisting of IS431mec-mecA-ΔmecR1-IS431; and class D mec, consisting of IS431mec-mecA-ΔmecR1 with no insertion sequences downstream of ΔmecR1 identified by PCR as of yet (13). In S. aureus strains, mec classes A, B, and C have been identified. Insertion sequences have sometimes been found to be integrated in or around the class A mec. A class A mec carrying IS431 downstream of mecI was found in Staphylococcus haemolyticus (13). Recently, Shore et al. identified MRSA strains carrying class A mec with an insertion of IS1182 in and around the mecI gene and designated them classes A3 and A4 (23).
The SCCmec element type has been defined by the combination of ccr type and mec class. In MRSA strains, six types of SCCmec elements, that is, six combinations of ccr and mec, have been reported (Table 1). These six SCCmec elements have been further classified by differences in regions other than ccr and mec, which are designated junkyard (J) regions. The J regions comprise three parts: J1 (the region between ccr and the right-flanking chromosomal region), J2 (the region between mec and ccr), and J3 (the region between orfX and mec). The J regions are not always specific to each SCCmec type, but certain J regions are commonly shared among certain types of SCCmec elements. Of the three regions, we regard J1 as being the most fundamental, because we presume that it reflects the original form of SCC into which a mec gene complex integrated. Moreover, several different J1 regions have been identified in type II and type IV SCCmec elements (7, 15, 17, 20, 23). The presence or absence of integrated plasmids encoding drug resistance genes in the J3 regions of SCCmec elements can also be used as markers to classify SCCmec elements further in epidemiological studies (1, 19).
In this study, we describe a convenient and reliable method for SCCmec typing based on a set of multiplex PCRs (M-PCRs). In this system, M-PCRs 1 and 2 are used for SCCmec type assignment; M-PCR 3 or M-PCR 4 is used for J1 region difference-based subtyping, and M-PCRs 5 and 6 are used for the identification of integrated copies of transposons (Tn554 or ΨTn554) and plasmids (pUB110 or pT181).
MATERIALS AND METHODS
Bacterial strains.
Twelve MRSA strains were used as standard strains for SCCmec typing (Table 1). In addition, 99 MRSA strains were used to validate the multiplex PCR, including 78 strains isolated in the United States, Canada, Ireland, England, and Egypt from 1960 through 1993 (including 8 strains with no record of their origin) provided by B. N. Kreiswirth (note that these strains were included in the study by Pfaller et al. [21]); 10 strains isolated in France in 1996, provided by J. Etienne; and 11 strains isolated in the United States and Australia, as reported previously by Okuma et al. (18).
Nomenclature of SCCmec elements.
In this paper, we use our proposed nomenclature for SCCmec elements (2). As shown in Table 1, the SCCmec element type (defined by the combination of ccr and mec allotypes) is indicated with roman numerals, while the SCCmec element subtype (defined by differences in the junkyard regions) is indicated with Arabic numbers separated by a period, where each number indicates the structure of the J regions (J1, J2, and J3, respectively) according to the chronological priority of the description. It should be noted that the description of the J regions has been modified from our original proposal according to the suggestion of Kunyan Zhang (Calgary University, Canada).
M-PCRs.
Chromosomal DNA was extracted from MRSA strains by using the small-scale phenol extraction method and was used as a template (8).
The primer pairs used for PCR experiments are listed in Table 2. M-PCR 1 for ccr type assignment contained two primers to identify mecA and eight primers used for the identification of five ccr genes: four primers including a common forward primer (common to ccrB1-3) and three reverse primers specific for ccrA1, ccrA2, and ccrA3 for identifying ccr1-3 based on the differences in ccrA genes; two primers for identifying ccr4; and two primers for identifying ccr5. M-PCR 2 for mec class assignment contained four primers to identify the gene lineages of mecA-mecI (class A mec), mecA-IS1272 (class B mec), and mecA-IS431(class C mec). M-PCR 3 contained five primer pairs: one pair for identifying specific ORF in the J1 region of type I SCCmec elements and four pairs for identifying specific ORFs in the J1 regions of four subtypes of type IV SCCmec elements. M-PCR 4 contained six primer pairs: four pairs for identifying specific ORFs in J1 regions of four subtypes of type II SCCmec elements, one pair for identifying specific ORFs in the J1 region of type III SCCmec elements, and one pair for identifying specific ORFs in the J1 region of type V SCCmec elements. M-PCR 5 contained three primers: one primer specific to the J2 regions of type II and type III SCCmec elements and two primers specific to ermA and cadB, respectively, to identify the J2 regions of type II or type III SCCmec elements. M-PCR 6 contained three primers: one primer specific for mecA and two primers specific for ant(4′) in plasmid pUB110 and tetK in plasmid pT181, respectively, to identify integrated plasmids in the J3 regions.
For M-PCR 1, reaction mixtures contained 10 ng chromosomal DNA, oligonucleotide primers (0.1 μM), 200μ M each deoxynucleotide triphosphates, Ex Taq buffer, and 2.5 U Ex Taq polymerase (Takara Bio Inc., Kyoto, Japan) in a final volume of 50 μl. The concentration of MgCl2 was 3.2 mM. A Takara PCR thermal cycler was used for amplification with an initial denaturation step (94°C, 2 min); 30 cycles of denaturation (94°C, 2 min), annealing (57°C, 1 min), and extension (72°C, 2 min); and a final elongation step at 72°C for 2 min. For M-PCRs 2 to 5, the reaction mixtures were the same as those for M-PCR 1 except that the concentration of MgCl2 was 2 mM and the annealing temperature was raised to 60°C for 1 min to avoid the generation of nonspecific DNA fragments. For M-PCR 6, we performed long-range PCR using the Expand High Fidelity PCR system according to the manufacturer's recommendations (Roche Diagnostics Co., Indianapolis, IN). Briefly, reactions were performed using a final reaction mixture volume of 50μ l, which contained 10 ng template DNA, oligonucleotide primers (0.3 μM), 200 μl each deoxynucleotide triphosphate, 1× Expand High Fidelity buffer, 1.5 mM MgCl2, and 2.6 U Expand High Fidelity PCR system enzyme mix. The PCR consisted of a denaturation step (94°C, 2 min); 10 cycles of denaturation (94°C, 15 s), annealing (50°C, 30 s), and extension (68°C, 8 min); 20 cycles of denaturation (94°C, 15 s), annealing (50°C, 30 s), and extension (68°C, 12 min); and a final elongation step (72°C, 7 min).
PCR-based identification and determination of part of the nucleotide sequence of the type II.4 SCCmec element.
DNA fragments encompassing the entire SCCmec element of strain RN7170 were amplified by long-range PCR using the Expand High Fidelity PCR system under the same conditions as those used for M-PCR 6. The primer sets used for amplifying the DNA fragments are given in Table 2. The amplicon sizes estimated by agarose gel electrophoresis are as follows: the region from orfX to mecA, amplified with primers cR1 and mA3, was 11 kb; the region from mecA to ermA in Tn554, amplified with primers mA2 and ermA1, was 11 kb; the region from ermA in Tn554 to ccr, amplified with primers ermA3 and 2AJ1, was 12 kb; and the region from ccr to the right-flanking chromosomal region, amplified with primers cβ and cL4, was 15 kb. The locations of the primers are indicated in Fig. 1. PCR products were purified with the QIAquick PCR purification kit (QIAGEN, Hilden, Germany), and nucleotide sequences of the DNA fragments from ccr to the right-flanking chromosomal region were determined by primer walking.
Nucleotide sequence accession number.
The nucleotide sequence of the region containing J1 and the ccr gene complex of the type II.4 SCCmec of strain RN7170 has been deposited in the DDBJ/EMBL/GenBank database under accession no. AB261975.
RESULTS AND DISCUSSION
Development of two M-PCRs for ccr and mec components of SCCmec elements.
M-PCR 1 was developed to identify ccrC and ccr4 in addition to three ccr types that could be identified with previous systems (10). M-PCR 1 successfully amplified DNA fragments corresponding in size to each ccr gene as follows: type 1 ccr, 695 bp; type 2 ccr, 937 bp; type 3 ccr, 1,791 bp; type 4 ccr, 1,287 bp; and type 5 ccr, 518 bp (Table 2 and Fig. 2A). The 286-bp amplification product appearing in each lane represents mecA, the most essential gene in SCCmec, which is used as an internal amplification control. Two DNA fragments of 518 bp and 1,791 bp were amplified with chromosomal DNA of strain 85/2082, indicating that it carried both type 3 ccr and ccrC, consistent with the fact that this strain carries two SCC elements, a type III SCCmec (type 3 ccr) and an SCCmercury (ccrC) (Table 1).
M-PCR 2, developed for assigning the mec class, contained primer pairs for identifying mecA-mecI (class A), mecA-IS1272 (class B), and mecA-IS431 (class C), and it can replace the three reactions used in traditional methods. The sizes of the amplified DNA fragments matched the sizes expected for each class of mec: 1,963 or 1,797 bp for mecA-mecI (class A), 2,827 bp for mecA-IS1272 (class B), and 804 bp for mecA-IS431 (class C) (Table 2 and Fig. 2B). The size of the amplified DNA fragment obtained with strain 85/2082 was shorter than that obtained with strain N315, in agreement with the fact that mecR1 of 85/2082 has a 166-bp deletion relative to that in N315 (10). This case seems to be exceptional, because we successfully amplified DNA fragments of sizes similar to those of N315 in 49 of 49 class A mec strains tested.
Development of two M-PCRs for J1 regions of SCCmec elements.
M-PCRs 3 and 4 were developed to identify specific ORFs in the J1 region of each SCCmec element: M-PCR 3 for type I and type IV SCCmec elements carrying class B mec and M-PCR 4 for type II and type III SCCmec elements carrying class A mec and type V SCCmec elements carrying class C mec.
With M-PCR 3, the J1 regions of all five SCCmec type I or IV elements (type I.1, type IV.1, type IV.2, type IV.3, and type IV.4) (Table 1) were identified with primer pairs specific for each subtype. The sizes of the amplified DNA fragments matched those predicted for the J1 regions of the five SCCmec elements (type I.1, 154 bp; type IV.1, 458 bp; type IV.2, 726 bp; type IV.3, 259 bp; type IV.4, 1,242 bp) (Fig. 2C and Table 2).
In this study, we identified a new subtype of type II SCCmec elements carried by RN7170. By amplifying entire SCCmec region and determining the nucleotide sequence of the J1 region of the element, we designated it type II.4 SCCmec. Interestingly, the J1 region carried by type IIB, IIC, IID, and IIE SCCmec elements was the same as that of the type IV.2 SCCmec element (23). Therefore, we considered these SCCmec elements to be type II.3, type II elements carrying the third identified J1 region (although it was identified previously in the type IV.2 SCCmec). With M-PCR 4, the J1 regions of six SCCmec types, type II, III, or V (type II.1, type II.2, type II.3, type II.4, type III.1, and type V.1) (Table 1), were identified with primer pairs specific for each type. The sizes of the amplified DNA fragments matched those predicted for the J1 regions of all six SCCmec types (type II.1, 287 bp; type II.2, 1,518 bp; type II.3, 726 bp; type II.4, 2,003 bp; type III.1, 503 bp; type V.1, 1,159 bp) (Fig. 2D and Table 2).
Development of two M-PCRs to identify resistance plasmids/transposons integrated into SCCmec elements (J2 and J3 regions).
M-PCR 5 was developed to identify transposon Tn554 or ΨTn554 integrated into type II and type III SCCmec elements by targeting ORFs located in the J2 region flanking these elements and resistance determinants carried by the transposons (ermA by Tn554 and cadB by ΨTn554). As expected, M-PCR 5 amplified DNA fragments of 2,756 bp (Fig. 2E, lanes 1 and 2), corresponding to CN030-ermA, and 1,540 bp (lane 3), corresponding to CZ021-cadB.
M-PCR 6 was developed to identify differences in the J3 region based on the presence or absence of resistance plasmids pUB110 and pT181 by amplifying the J3 regions mecA-ant(4′)-1 for pUB110 and mecA-tetK for pT181. As expected, the DNA fragments amplified by M-PCR 6 were 4,952 bp (Fig. 2E, lane 4) for mecA-ant(4′)-1 and 7,406 bp (Fig. 2E, lane 5) for mecA-tetK. It should be noted that with M-PCR 6, plasmids pUB110 and pT181 could be detected if they were located downstream of mecA but could not be detected if they were located distant from mecA. In contrast, in the M-PCR developed previously by Oliveira and Lencastre (20), these plasmids were identified with primer sets specific for each plasmid, regardless of their relative position to mecA, leaving the possibility that these plasmids are located outside the SCCmec element.
Validation of six multiplex PCRs.
We evaluated our system of six M-PCRs by examining a total of 99 MRSA strains. The results obtained with the M-PCRs were identical to those obtained by traditional methods, which mostly used a set of two primers to identify each gene or different allotypes (7, 10, 18).
M-PCR 1 amplified a single DNA fragment belonging to one of five ccr types from the chromosomal DNAs of 83 of the 99 MRSA strains. In 10 strains, two DNA fragments were amplified, signifying that these strains carry two ccrs, while in 6 strains, no DNA fragments were amplified (Table 3). Among the 10 strains that carried two ccrs, 8 carried a type 3 ccr and ccrC and 2 carried a type 1 ccr and ccrC. Since ccrC is present in SCC elements carrying the mercury resistance operon (SCCmercury) or the capsule gene cluster (SCCcap1) (2, 16), we conducted an M-PCR experiment to identify the mercury resistance operon and J region in SCCmercury by using four primers (merA2, merG, mN21, and mN22) listed in Table 2. DNA fragments indicating the carriage of the mercury resistance operon were amplified from the chromosomal DNAs of all 10 strains, and DNA fragments indicating the carriage of the J region of SCCmercury were amplified from the chromosomal DNAs of 9 of them, signifying that these 9 strains carried SCCmercury. We tentatively regarded the remaining strain as a type 1 ccr strain, presuming that ccrC might be carried by other unknown mobile genetic elements, since no SCCmec element carrying the combination of ccrC (type 5 ccr) and class A mec or class B mec has been identified yet.
With M-PCR 2, the mec gene complexes of 95 of 99 tested strains were judged to belong to either class A or class B mec, and those of 4 strains were unclassifiable (Table 3).
As such, SCCmec elements carried by 93 of the 99 tested strains were classified into one of the six known types of SCCmec elements (Table 3).
With M-PCRs 3 and 4, these SCCmec elements could be further classified based on differences in the J1 region. Overall, we were able to classify the J1 regions of SCCmec elements carried by 92 of 93 strains that had an identified SCCmec type (Table 3). Interestingly, no DNA fragment from the chromosomal DNAs of the six untypeable strains was amplified by M-PCR 3 and M-PCR 4, suggesting that these strains might carry new SCCmec elements.
We used M-PCR 5 to establish the presence or absence of Tn554 and ΨTn554 in the J2 regions of type II and type III SCCmec elements. Tn554 was identified in 36 of 37 type II SCCmec elements and 1 of 12 type III SCCmec elements.Ψ Tn554 was identified in 11 of 12 type III SCCmec elements (Table 3). One type III SCCmec strain carried Tn554 instead ofΨ Tn554 at the J2 region, as previously reported (9).
We used M-PCR 6 to determine the presence or absence of plasmids pUB110 and pT181. Plasmid pUB110 was carried by 1 of 17 type I SCCmec elements, 35 of 37 type II SCCmec elements, 10 of 27 type IV SCCmec elements, and 3 of the 6 untypeable strains. Remarkably, all 10 tested gentamicin-susceptible MRSA strains (isolated in France in 1996) carried a type IV.3 SCCmec with an integrated plasmid pUB110. No type III SCCmec harbored pUB110 downstream of mecA. In contrast, 8 of 12 type III SCCmec elements harbored plasmid pT181, which was not identified in type I, type II, and type IV SCCmec elements.
Atypical and unclassifiable SCCmec elements.
We were not able to identify the ccr gene of six mecA-positive strains with M-PCR 1. Two of them carried class A mec, the J2 region of the type II SCCmec element, and the integrated plasmid pUB110, indicating that the gene lineage pUB110-IS431-mecA-mecR1-mecI-Tn554, which is usually located in the type II SCCmec element, was carried by these two strains. Further studies to determine the nucleotide sequences of the region between Tn554 and the right-flanking chromosomal region will clarify whether these strains carry a deleted type II SCCmec or a novel region with new ccr genes. Three of them carried the mecR1 gene, whereas the mecI gene was not detected by PCR testing for the respective genes (18). One strain carried neither mecR1 nor mecI. The structures of those elements will be the subject of further investigation.
Comparison to previously reported M-PCRs.
Our M-PCRs do not conflict with two previously reported M-PCRs based primarily on the identification of junkyard regions (20, 26). The M-PCR described previously by Oliveira and Lencastre (20) has the advantage that it identifies multiple loci simultaneously (e.g., the mecA gene, the mecI gene, the J1 region of type I and type II SCCmec elements, ccrC, the dcs [downstream constant sequence] region, pT181, and pUB110). The M-PCR described previously by Zhang et al. (26) has the advantage that it identifies the J1 region of eight SCCmec elements simultaneously. M-PCRs 3 to 6, which were developed to identify specific ORFs in J regions, are based on the same concept as that of the two previously reported M-PCRs.
We first used the pls (plasmin-sensitive protein) gene to identify the J1 region of the type I.1 SCCmec, but that approach was changed since only 12 of 17 strains were positive for this gene (6). In addition, the pls gene was identified with the chromosomal DNA from a type III SCCmec strain, suggesting that it could not be a specific marker for the J1 region of type I SCCmec elements. Oliveira and Lencastre and Zhang et al. also designed primers specific to the J1 region of the type I SCCmec in regions other than the pls gene. The J region of 16 of 17 type I SCCmec strains was classified as subtype 1 with both the primers described previously by Oliveira et al. and our primers.
The identification of the J1 region of the type III SCCmec element was a bit confusing because we first reported the nucleotide sequence of the type III SCCmec element carried by strain 85/2082 as being the longest one, but this turned out to be a composite of SCCmercury and a type III SCCmec element (as indicated in Fig. 1, the length of the type III SCCmec element is different from that originally reported). Both Oliveira and Lencastre and Zhang et al. happened to design primers on the nucleotide sequence of SCCmercury for the identification of type III SCCmec elements. Therefore, the identification of locus E and locus F in the M-PCR described previously by Oliveira and Lencastre and the identification of the locus used by Zhang et al. indicate the likely presence of SCCmercury and are not specific for type III SCCmec elements.
The identification of the J1 regions of type IV SCCmec elements is similar with our and primers and those described previously by Zhang et al., except for a primer pair used for the identification of a type IV.3 SCCmec element designed by Zhang et al. on a locus outside the type IV.3 SCCmec, designated IE25923.
Prospects for assignment of SCCmec elements.
The typing system designed here is not final and should be developed further, since it could not identify every known difference. For example, some differences in the J3 regions of the type IV SCCmec element, such as the carriage of Tn4001 in the type IV SCCmec of strain 81/108, the different J3 region structures in type IVE and type IVF SCCmec elements reported previously by Shore et al. (23), and the presence of dcs in the type III SCCmec element reported previously by Chongtrakool et al. (2), were not identified with our system. Although the structure of the J1 region is rather specific to each type and correlates well with the SCCmec type, we want to emphasize that the identification of the J region did not correlate exactly with the type of SCCmec element. The type II.3 MRSA strain isolated in Ireland is a good example: if only the multiplex PCR identifying the J1 region had been conducted, it would have been classified as type IV.2.
It is not easy to conduct six M-PCRs for every case. We suggest that M-PCRs 1 and 2, for identifying ccr and mec, should be conducted first to assign types of SCCmec elements, and they might be enough in most of the cases for epidemiological purposes. In cases where further typing is required, we suggest to proceed with identification of the J1 region structure with M-PCR 3 or 4 or with M-PCRs developed by Zhang et al., since the structure of J1 region might reflect the structure of an SCC in which the mec gene complex was integrated. The remaining two M-PCRs, M-PCR 5 and M-PCR 6, should be conducted, if necessary, for additional typing.
Although it might be difficult to determine all SCCmec types carried by staphylococci, the determination of as many unknown SCCmec types as possible would be of help for epidemiological studies as well as for inferring the origins of MRSA strains. Further discussion is needed in order to form a consensus among staphylococcal researchers regarding how to define SCCmec element types and how to assign SCCmec elements to cope with the ever-increasing diversity of SCCmec elements.
FIG. 1.
FIG. 2.
TABLE 1.
| Reported SCCmec type | Name of SCCmec type used in this studya | Combination of ccr and mec | Specific features used for discrimination of J regions | GenBank accession no. or reference | Strain used as standard | ||||
|---|---|---|---|---|---|---|---|---|---|
| J1 region | J2 region | J3 region | |||||||
| I | I.1.1.1 | 1A | E007 in J1 of type I SCCmec | NTb | pUB110 (−) | AB033763 | NCTC10442 | ||
| IA | (I.1.1.2) | 1A | Locus A in J1 of type I SCCmec | NT | pUB110 (+) | 19 | |||
| IIa | II.1.1.1 | 2A | kdp operon (kdpB) in J1 region of type II.1 SCCmec | Tn554 and its flanking region | pUB110 (+) | D86934 | N315 | ||
| II variant | (II.1.n.2) | 2A | Locus B in J1 region of type II.1 SCCmec | NDc | pUB110 (−) | 1 | |||
| IIb | II.2.1.2 | 2A | S01 in J1 region of type II.2 SCCmec | Tn554 and its flanking region | pUB110 (−) | AB127982 | JCSC3063 | ||
| IIA | II.3.1.1 | 2A | Same as that of type IV.2 SCCmec of 8/6-3P | Tn554 and its flanking region | pUB110 (+) | 23 | BK351d | ||
| IIB | (II.3) | 2A | Same as that of type IV.2 SCCmec of 8/6-3P | Tn554 negative | pUB110 (+) | AJ810123 | |||
| IIC | (II.3) | 2A | Same as that of type IV.2 SCCmec of 8/6-3P | Tn554 positive, short J2 region | pUB110 (+) | 23 | |||
| IID | (II.3) | 2A | Same as that of type IV.2 SCCmec of 8/6-3P | Tn554 and its flanking region | pUB110 (−) | 23 | |||
| IIE | (II.3) | 2A | Same as that of type IV.2 SCCmec of 8/6-3P | Tn554 positive, short J2 region | pUB110 (−) | AJ810120 | |||
| II.4.1.1 | 2A | RN06 in J1 region of type II.4 SCCmec | Tn554 and its flanking region | pUB110 (+) | AB261975 | RN7170 | |||
| III | III.1.1.1 | 3A | Z004 in J1 region of type III.1 SCCmec | ΨTn554 and its flanking region | pT181 (+) | AB037671 | 85/2082 | ||
| IIIA | (III.1.1.2) | 3A | ΨTn554 and its flanking region | pT181 (−) | AF422651 -AF422696 | ||||
| IVa | IV.1.1.1 | 2B | CQ002 in J1 region of type IV.1 SCCmec | NT | pUB110 (−) | AB063172 | CA05 | ||
| IVb | IV.2.1.1 | 2B | M001 in J1 region of type IV.2 SCCmec | NT | pUB110 (−) | AB063173 | 8/6-3P | ||
| IVc | IV.3.1.1 | 2B | CR008 in J1 region of type IV.3 SCCmec | NT | pUB110 (−) | AB096217 | 81/108 | ||
| IVE | (IV.3.1.4) | 2B | Same as that of 81/108 | NT | pUB110 (−) | AJ810121 | |||
| IVF | (IV.2.1.4) | 2B | Same as that of 8/6-3P | NT | pUB110 (−) | 23 | |||
| IVd | IV.4.1.1 | 2B | CD002 in J1 region of type IV.4 SCCmec | NT | pUB110 (−) | AB097677 | JCSC4469 | ||
| IVA | (IV.n.n.2) | 2B | ND | ND | pUB110 (+) | 1 | |||
| IVg | (IV.5) | 2B | J1 region specific to IVg | NT | pUB110 (−) | DQ106887 | |||
| V | V.1 | 5C | V024 in J1 region of type V SCCmec | NT | NT | AB121219 | WIS | ||
| IV | V1 | 4B | ND | NT | NT | AF411935 | HDE288 | ||
a
Types of SCCmec elements that are not used in this study are given in parentheses.
b
NT, not tested in this study.
c
ND, not described in the paper.
d
BK351, isolated in Ireland, was provided by B. N. Kreiswirth.
TABLE 2.
| Primer for PCR | Nucleotide sequence (5′→3′) | Constructed on: | Location of primer | Gene(s) or gene allele(s) detected (primer pair) | Expected size of product (bp) | ||||
|---|---|---|---|---|---|---|---|---|---|
| Start position(s) in reference | Stop position(s) in reference | Reference SCCmec or SCC sequence(s)a | |||||||
| M-PCR 1 (for amplification of ccr gene complex type with mecA) | |||||||||
| mA1 | TGCTATCCACCCTCAAACAGG | mecA | 45813 | 45833 | Type II.1 | mecA (mA1-mA2) | 286 | ||
| mA2 | AACGTTGTAACCACCCCAAGA | mecA | 46098 | 46078 | Type II.1 | ||||
| α1 | AACCTATATCATCAATCAGTACGT | ccrA1 | 24845 | 24868 | Type I.1 | ccrA1-ccrB (α1-βc) | 695 | ||
| α2 | TAAAGGCATCAATGCACAAACACT | ccrA2 | 26325 | 26348 | Type II.1 | ccrA2-ccrB (α2-βc) | 937 | ||
| α3 | AGCTCAAAAGCAAGCAATAGAAT | ccrA3 | 5486 | 5508 | Type III.1 | ccrA3-ccrB (α3-βc) | 1,791 | ||
| βc | ATTGCCTTGATAATAGCCITCT | ccrB1, ccrB2, ccrB3 | 25539, 27261, 7276 | 25518, 27240, 7255 | Type I.1, II.1, III.1 | ||||
| α4.2 | GTATCAATGCACCAGAACTT | ccrA4 | 8745 | 8764 | Type VI | ccrA4-ccrB4 (α4.2-β4.2) | 1,287 | ||
| β4.2 | TTGCGACTCTCTTGGCGTTT | ccrB4 | 10031 | 10012 | Type VI | ||||
| γR | CCTTTATAGACTGGATTATTCAAAATAT | ccrC | 60319, 16838 | 60346, 16811 | SCCmercury, type V | ccrC (γR-γF) | 518 | ||
| γF | CGTCTATTACAAGATGTTAAGGATAAT | ccrC | 60836, 16321 | 60810, 16347 | SCCmercury, type V | ||||
| M-PCR 2 (for amplification of mec gene complex class | |||||||||
| mI6 | CATAACTTCCCATTCTGCAGATG | mecI | 42866 | 42888 | Type II.1 | mecA-mecI (mA7-mI6) | 1,963 | ||
| IS7 | ATGCTTAATGATAGCATCCGAATG | IS1272 | 28624 | 28647 | Type I.1 | mecA-IS1272 upstream of mecA (mA7-IS7) | 2,827 | ||
| IS2(iS-2) | TGAGGTTATTCAGATATTTCGATGT | IS431 | 8772 | 8748 | Type V | mecA-IS431 upstream of mecA (mA7-IS2 [iS-2]) | 804 | ||
| mA7 | ATATACCAAACCCGACAACTACA | mecA | 44830, 31450, 7969 | 44808, 31428, 7991 | Type I.1, II.1, V | ||||
| M-PCR 3 (for amplification of ORFs in J1 region of type I and type IV SCCmec) | |||||||||
| 1a3 | TTTAGGAGGTAATCTCCTTGATG | E007 | 5278 | 5300 | Type I.1 | E007 in type I.1 SCCmec (1a3-la4) | 154 | ||
| 1a4 | TTTTGCGTTTGCATCTCTACC | E007 | 5431 | 5411 | Type I.1 | ||||
| 4al | TTTGAATGCCCTCCATGAATAAAAT | CQ002 | 4726 | 4750 | Type IV.1 | CQ02 in type IV.1 (IVa) SCCmec (4al-4a3) | 458 | ||
| 4a3 | AGAAAAGATAGAAGTTCGAAAGA | CQ002 | 5183 | 5161 | Type IV.1 | ||||
| 4b3 | AACCAACAGTGGTTACAGCTT | M001 | 2457 | 2477 | Type IV.2 | M001 in type IV.2 (IVb) SCCmec (4b3-4b4) | 726 | ||
| 4b4 | CGGATTTTAGACTCATCACCAT | M001 | 3182 | 3161 | Type IV.2 | ||||
| 4c4 | AGGAAATCGATGTCATTATAA | CR008 | 8260 | 8240 | Type IV.3 | CR008 in type IV.3 (IVc) SCCmec (4c4-4c5) | 259 | ||
| 4c5 | ATCCATTTCTCAGGAGTTAG | CR008 | 8002 | 8021 | Type IV.3 | ||||
| 4d3 | AATTCACCCGTACCTGAGAA | CD002 | 2390 | 2409 | Type IV.4 | CD002 in type IV.4 (IVd) SCCmec (4d3-4d4) | 1,242 | ||
| 4d4 | AGAATGTGGTTATAAGATAGCTA | CD002 | 3631 | 3609 | Type IV.4 | ||||
| M-PCR 4 (for amplification of ORFs in J1 region of type II, type III, and type V SCCmec) | |||||||||
| kdpB1 | GATTACTTCAGAACCAGGTCAT | kdpB | 12436 | 12415 | Type II.1 | kdpB in type II.1 (IIa) SCCmec (kdpB1-kdpB2) | 287 | ||
| kdpB2 | TAAACTGTGTCACACGATCCAT | kdpB | 12150 | 12171 | Type II.1 | ||||
| 2b3 | GCTCTAAAAGTTGGATATGCG | S01 | 1497 | 1517 | Type II.2 | SA01 in type II.2 (IIb) SCCmec (2b3-2b4) | 1,518 | ||
| 2b4 | TGGATTGAATCGACTAGAATCG | S01 | 3014 | 2993 | Type II.2 | ||||
| 4b3 | AACCAACAGTGGTTACAGCTT | IIE3, M001 | 2457, 2156 | 2477, 2176 | Type IV.2, II.3 (IIE) | IIE03 in type II.3 (IIE) SCCmec or M001 in type IV.2 (IVb) SCCmec (4b3-4b4) | 726 | ||
| 4b4 | CGGATTTTAGACTCATCACCAT | IIE3, M001 | 3182, 2881 | 3161, 2860 | Type IV.2, type II.3 (IIE) | ||||
| II4-3 | GTACCGCTGAATATTGATAGTGAT | RN06 | 11848 | 11871 | Type II.4 | RN06 in type II.4 SCCmec (II4-3-II4-1) | 2,003 | ||
| II4-1 | ACTCTAATCCTAATCACCGAAC | RN06 | 13850 | 13829 | Type II.4 | ||||
| 3a1 | ATGGCTTCAGCATCAATGAG | Z004 | 3333 | 3352 | Type III.1 | Z004 in type III.1 SCCmec (3a1-3a2) | 503 | ||
| 3a2 | ATATCCTTCAAGCGCGTTTC | Z004 | 3835 | 3816 | Type III.1 | ||||
| 5a1 | ACCTACAGCCATTGCATTATG | V024 | 26564 | 26584 | Type V | V024 in type V SCCmec (5a1-a2) | 1,159 | ||
| 5a2 | TGTATACATTTCGCCACTAGCT | V024 | 27722 | 27701 | Type V | ||||
| M-PCR 5 (for amplification of gene alleles located in J2 region of SCCmec elements) | |||||||||
| ermA1 | TGAAACAATTTGTAACTATTGA | ermA | 35078 | 35099 | Type II.1 | ermA-CN030 or CZ021 in J2 region of type II.1 (IIa) or type III.1 SCCmec (ermA1-mN5) | 2,756 | ||
| cad4 | ATTGCGATTCTTTCCGATATGG | cadB | 16107 | 16128 | Type III.1 | cadB-CN030 or CZ021 in J2 region of type II.1 (IIa) or type III.1 SCCmec (cad4-mN5) | 1,540 | ||
| mN5 | TTGCTTCGGGACTTACCTCTAGT | CN030, CZ021 | 37833, 17646 | 37811, 17624 | Type II.1, type III.1 | ||||
| M-PCR 6 (for amplification of gene alleles located in J3 region of SCCmec elements) | |||||||||
| ant1 | CAGACCAATCAACATGGCACC | ant(4)′ | 50764 | 50744 | Type II.1 | mecA-ant(4′) in pUB110 (mA1-ant1) | 4,952 | ||
| pT181-2 | AGGTTTATTGTCACTACAATTGA | tetK | 32869 | 32847 | Type III.1 | mecA-tetK in pT181 (mA1-pT181-2) | 7,406 | ||
| mA1 | TGCTATCCACCCTCAAACAGG | mecA | 45813, 25464 | 45833, 25484 | Type II.1, type III.1 | ||||
| Primer sets for PCR used for identification of genes or gene alleles | |||||||||
| 1a1 | ATTCCATATGAAACTAAACGCGT | pls | 11864 | 11841 | Type I.1 | pls (CE010) in type I SCCmec (1a1-1a2) | 1,065 | ||
| 1a2 | TAGTGAACCAAATAATGTGCCATT | pls | 10800 | 10823 | Type I.1 | ||||
| merA2 | TCTTCACAGCCTGTGCATGTCATGCCT | merA | 39874 | 39900 | SCCmercury | mer operon (merA2-merG) | 1,546 | ||
| merG | TGATACCGCGAATGAATCAAAGGT | CZ046 | 41419 | 41396 | SCCmercury | ||||
| mN21 | TCATCTTTAACTACGATGGTGT | CZ055 | 47848 | 47869 | SCCmercury | J region in SCCmercury (mN21-mN22) | 577 | ||
| mN22 | ACTACAGCCATCTTCAGATAGA | CZ056 | 48424 | 48403 | SCCmercury | ||||
| Primer sets for amplification of type II.4 SCCmec carried by RN7170 | |||||||||
| cR1 | AAGAATTGAACCAACGCATGA | orfX | 57847 | 57827 | Type II.1 | orfX-mecA (cR1-mA3) | 11,756b | ||
| mA3 | AACGTTACAAGATATGAAGTGGTAAATGGTA | mecA | 46093 | 46123 | Type II.1 | ||||
| mA2 | AACGTTGTAACCACCCCAAG | mecA | 46098 | 46078 | Type II.1 | mecA-ermA (mA2-ermA1) | 11,020b | ||
| ermA1 | TGAAACAATTTGTAACTATTGA | ermA | 35078 | 35099 | Type II.1 | ||||
| ermA3 | TGGGTAAACCGTGAATATCGTGT | ermA | 35214 | 35192 | Type II.1 | ermA-ccr gene complex (ermA3-2AJ1) | 9,937b | ||
| 2AJ1 | ATTAGCCGATTTGGTAATTGAA | Noncoding region between RN01 and RN02 | 4270 | 4249 | Type II.4 | ||||
| βc | ATTGCCTTGATAATAGCCITCT | ccrB | 2287 | 2308 | Type II.4 | ccr gene complex chromosomal region flanking SCCmec (βc-cL4) | 15,000c | ||
| cL4 | CAGTCGCATCAAATGTCTCTAATG | Chromosomal region flanking to SCCmec | 3218 | 3241 | Type II.1 | ||||
a
Accession numbers deposited in DDBJ/EMBL/GenBank database used as reference sequences for SCCmec elements and SCCmercury are as follows: type I.1 SCCmec, AB033763; type II.1 SCCmec, D86934; type II.2 SCCmec, AB127982; type II.3 (type IIE) SCCmec, AJ810120; type II.4 SCCmec, AB261975; type III.1 SCCmec and SCCmercury, AB037671; type IV.1 SCCmec, AB063172; type IV.2 SCCmec, AB063173; type IV.3 SCCmec, AB096217; type IV.4 SCCmec, AB097677; type V SCCmec, AB121219; type VI SCCmec, AF411935.
b
The sizes of DNA fragments estimated from the nucleotide sequence of the type II.1 SCCmec element are given. The sizes of DNA fragments amplified from chromosomal DNA of RN7170 were judged to be the same as those from chromosomal DNA of N315 by agarose gel electrophoresis.
c
The combination of the primer pair βc and cL4 should amplify the DNA fragment of 24 kb from chromosomal DNA of N315.
TABLE 3.
| SCCmec type | Subtypea | PCR result | No. of strains | Origin(s)b | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| M-PCR 1 | M-PCR 2 mec type | M-PCR 3, 4 J1 region type | M-PCR 5 | M-PCR 6 | PCR identifying SCCmercurye | |||||||||||||||
| ccr type | ccrC | Tn554 | ΨTn554 | pUB110 | pT181 | |||||||||||||||
| I | 1.n.1 | 1 | − | B | 1 | NDc | ND | − | − | − | 13 | D, Eng, I, S, U, UN | ||||||||
| 1.n.1 | + | 1 | ND | ND | − | − | + (1) | 2 | Eng, E | |||||||||||
| 1.n.2 | − | 1 | ND | ND | + | − | − | 1 | US | |||||||||||
| N.n.1 | − | NTd | ND | ND | − | − | − | 1 | I | |||||||||||
| II | 1.1.1 | 2 | − | A | 1 | + | − | + | − | − | 32 | C, I, US, UN | ||||||||
| 1.n.2 | − | 1 | − | − | − | − | − | 1 | US | |||||||||||
| 1.1.2 | − | 1 | + | − | − | − | − | 1 | C | |||||||||||
| 3.1.1 | − | 3 | + | − | + | − | − | 1 | I | |||||||||||
| 4.1.1 | − | 4 | + | − | + | − | − | 2 | C, US | |||||||||||
| III | 1.1.1 | 3 | + | A | 1 | − | + | − | + | + | 8 | C, Eng, I, US, UN | ||||||||
| 1.1.2 | − | 1 | − | + | − | − | − | 3 | US, UN | |||||||||||
| 1.2.1 | − | 1 | + | − | − | − | − | 1 | US | |||||||||||
| IV | 1.n.1 | 2 | − | B | 1 | ND | ND | − | − | − | 9 | A, C, US | ||||||||
| 2.n.1 | − | 2 | ND | ND | − | − | − | 3 | US | |||||||||||
| 3.n.1 | − | 3 | ND | ND | − | − | − | 2 | US | |||||||||||
| 3.n.2 | − | 3 | ND | ND | + | − | − | 10 | F | |||||||||||
| 4.n.1 | − | 4 | ND | ND | − | − | − | 3 | US | |||||||||||
| NT | − | − | A | − | + | − | + | − | − | 2 | UN | |||||||||
| + | − | NT | − | − | − | + | − | − | 1 | US | ||||||||||
| − | − | NT | − | − | − | − | − | − | 3 | US | ||||||||||
a
The subtypes are shown as Arabic numerals separated by a period. The first number indicates the subtype of the J1 region, the second number indicates the subtype of the J2 region, and the third number indicates the subtype of the J3 region. Each number is separated by a period. If the subtype of the J2 region was not examined, it was indicated as n.
b
Abbreviations: A, Australia; C, Canada; D, Denmark; E, Egypt; F, France; I, Ireland; Eng, England; S, Switzerland; U, Uganda; US, United States; UN, unknown.
c
ND, not determined.
d
NT, nontypeable.
e
Numbers in parentheses indicate the number of positive strains if the number is not the same as the number of strains indicated in the next column.
Acknowledgments
This work was supported by a Grant-in-Aid for 21st Century COE Research and a Grant-in-Aid for Scientific Research on Priority Areas (13226114) from the Ministry of Education, Science, Sports, Culture, and Technology of Japan.
REFERENCES
1.
Cha, H. Y., D. C. Moon, C. H. Choi, J. Y. Oh, Y. S. Jeong, Y. C. Lee, S. Y. Seol, D. T. Cho, H. H. Chang, S. W. Kim, and J. C. Lee. 2005. Prevalence of the ST239 clone of methicillin-resistant Staphylococcus aureus and differences in antimicrobial susceptibilities of ST239 and ST5 clones identified in a Korean hospital. J. Clin. Microbiol.43:3610-3614.
2.
Chongtrakool, P., T. Ito, X. X. Ma, Y. Kondo, S. Trakulsomboon, C. Tiensasitorn M. Jamklang, T. Chavalit, J.-H. Song, and K. Hiramatsu. 2006. Staphylococcal cassette chromosome mec (SCCmec) typing of MRSA strains isolated in 11 Asian countries: a proposal for a new nomenclature for SCCmec elements.Antimicrob. Agents Chemother.50:1001-1012.
3.
Deresinski, S. 2005. Methicillin-resistant Staphylococcus aureus: an evolutionary, epidemiologic, and therapeutic odyssey.Clin. Infect. Dis.40:562-573.
4.
Eady, E. A., and J. H. Cove. 2003. Staphylococcal resistance revisited: community-acquired methicillin resistant Staphylococcus aureus—an emerging problem for the management of skin and soft tissue infections. Curr. Opin. Infect. Dis.16:103-124.
5.
Hartman, B. J., and A. Tomasz. 1984. Low-affinity penicillin-binding protein associated with β-lactam resistance in Staphylococcus aureus. J. Bacteriol.158:513-516.
6.
Hildén, P., K. Savolainen, J. Tyynela, M. Vuento, and P. Kuusela. 1996 . Purification and characterisation of a plasmin-sensitive surface protein of Staphylococcus aureus.Eur. J. Biochem.236:904-910.
7.
Hisata, K., K. Kuwahara-Arai, M. Yamanoto, T. Ito, Y. Nakatomi, L. Cui, T. Baba, M. Terasawa, C. Sotozono, S. Kinoshita, Y. Yamashiro, and K. Hiramatsu. 2005. Dissemination of methicillin-resistant staphylococci among healthy Japanese children.J. Clin. Microbiol.43:3364-3372.
8.
Ito, T., K. Kuwahara, and K. Hiramatsu. Staphylococcalcassette chromosome mec (SCCmec) analysis of MRSA. Methods Mol. Med., in press.
9.
Ito, T., K. Okuma, X. X. Ma, H. Yuzawa, and K. Hiramatsu. 2003 . Insights on antibiotic resistance of Staphylococcus aureus from its whole genome: genomic island SCC. Drug Resist. Update6:41-52.
10.
Ito, T., Y. Katayama, K. Asada, N. Mori, K. Tsutsumimoto, C. Tiensasitorn, and K. Hiramatsu. 2001. Structural comparison of three types of staphylococcal cassette chromosome mec integrated in the chromosome in methicillin-resistant Staphylococcus aureus. Antimicrob. Agents Chemother.45:1323-1336.
11.
Ito, T., X. X. Ma, F. Takeuchi, K. Okuma, H. Yuzawa, and K. Hiramatsu. 2004. Novel type V staphylococcal cassette chromosome mec driven by a novel cassette chromosome recombinase, ccrC. Antimicrob. Agents Chemother.48:2637-2651.
12.
Ito, T., Y. Katayama, and K. Hiramatsu. 1999. Cloning and nucleotide sequence determination of the entire mec DNA of pre-methicillin-resistant Staphylococcus aureus N315.Antimicrob. Agents Chemother.43:1449-1458.
13.
Katayama, Y., T. Ito, and K. Hiramatsu. 2001. Genetic organization of the chromosome region surrounding mecA in clinical staphylococcal strains: role of IS431-mediated mecI deletion in expression of resistance in mecA-carrying, low-level methicillin-resistant Staphylococcus haemolyticus. Antimicrob. Agents Chemother.45:1955-1963.
14.
Katayama, Y., T. Ito, and K. Hiramatsu. 2000. A new class of genetic element, staphylococcal cassette chromosome mec, encodes methicillin resistance in Staphylococcus aureus.Antimicrob. Agents Chemother.44:1549-1555.
15.
Kwon, N. H., K. T. Park, J. S. Moon, W. K. Jung, S. H. Kim, J. M. Kim, S. K. Hong, H. C. Koo, and Y. H. Park. 2005. Staphylococcal cassette chromosome mec (SCCmec) characterization and molecular analysis for methicillin-resistant Staphylococcus aureus and novel SCCmec subtype IVg isolated from bovine milk in Korea.J. Antimicrob. Chemother.56:624-632.
16.
Luong, T. T., S. Ouyang, K. Bush, and C. Y. Lee. 2002 . Type 1 capsule genes of Staphylococcus aureus are carried in a staphylococcal cassette chromosome genetic element. J. Bacteriol.184:3623-3629.
17.
Ma, X. X., T. Ito, C. Tiensasitorn, M. Jamklang, P. Chongtrakool, S. Boyle-Vavra, R. S. Daum, and K. Hiramatsu. 2002 . Novel type of staphylococcal cassette chromosome mec identified in community-acquired methicillin-resistant Staphylococcus aureus strains. Antimicrob. Agents Chemother.46:1147-1152.
18.
Okuma, K., K. Iwakawa, J. D. Turnidge, W. B. Grubb, J. M. Bell, F. G. O'Brien, G. W. Coombs, J. W. Pearman, F. C. Tenover, M. Kapi, C. Tiensasitorn, T. Ito, and K. Hiramatsu. 2002. Dissemination of new methicillin-resistant Staphylococcus aureus clones in the community. J. Clin. Microbiol.40:4289-4294.
19.
Oliveira, D. C., A. Tomasz, and H. Lencastre. 2001. The evolution of pandemic clones of methicillin-resistant Staphylococcus aureus: identification of two ancestral genetic backgrounds and the associated mec elements. Microb. Drug Resist.7:349-361.
20.
Oliveira, D. C., and H. Lencastre. 2002. Multiplex PCR strategy for rapid identification of structural types and variants of the mec element in methicillin-resistant Staphylococcus aureus. Antimicrob. Agents Chemother.46:2155-2161.
21.
Pfaller, M. A., A. L. Barry, L. D. Sabath, B. N. Kreiswirth, P. R. Murray, P. C. Fuchs, and J. C. McLaughlin. 1993. In vitro activity of ceftriaxone and other cephalosporins against 602 clinical isolates of staphylococci from geographically diverse medical centers.Eur. J. Epidemiol.9:658-662.
22.
Reynolds, P. E., and D. F. Brown. 1985. Penicillin-binding proteins of beta-lactam-resistant strains of Staphylococcus aureus. Effect of growth conditions. FEBS Lett.192:28-32.
23.
Shore, A., A. S. Rossney, C. T. Keane, M. C. Enright, and D. C. Coleman. 2005. Seven novel variants of the staphylococcal chromosomal cassette mec in methicillin-resistant Staphylococcus aureus isolates from Ireland. Antimicrob. Agents Chemother.49:2070-2083.
24.
Song, M. D., M. Wachi, M. Doi, F. Ishino, and M. Matsuhashi. 1987 . Evolution of an inducible penicillin-target protein in methicillin-resistant Staphylococcus aureus by gene fusion.FEBS Lett.221:167-171.
25.
Utsui, Y., and T. Yokota. 1985. Role of an altered penicillin-binding protein in methicillin- and cephem-resistant Staphylococcus aureus. Antimicrob. Agents Chemother.28:397-403.
26.
Zhang, K., J. A. McClure, S. Elsayed, T. Louie, and J. M. Conly. 2005. Novel multiplex PCR assay for characterization and concomitant subtyping of staphylococcal cassette chromosome mec types I to V in methicillin-resistant Staphylococcus aureus. J. Clin. Microbiol.43:5026-5033.
Information & Contributors
Information
Published In
Antimicrobial Agents and Chemotherapy
Volume 51 • Number 1 • January 2007
Pages: 264 - 274
PubMed: 17043114
Copyright
© 2007 American Society for Microbiology.
History
Received: 8 February 2006
Revision received: 7 April 2006
Accepted: 9 October 2006
Published online: 1 January 2007
Contributors
Metrics & Citations
Metrics
Note:
- For recently published articles, the TOTAL download count will appear as zero until a new month starts.
- There is a 3- to 4-day delay in article usage, so article usage will not appear immediately after publication.
- Citation counts come from the Crossref Cited by service.
Citations
Citation
2007.
Combination of Multiplex PCRs for Staphylococcal Cassette Chromosome mec Type Assignment: Rapid Identification System for mec, ccr, and Major
Differences in Junkyard Regions. Antimicrob Agents Chemother
51:.
If you have the appropriate software installed, you can download article citation data to the citation manager of your choice. For an editable text file, please select Medlars format which will download as a .txt file. Simply select your manager software from the list below and click Download.