Advertisement
Free access
Research Article
15 October 2007

Genetic and Phenotypic Variation of Foot-and-Mouth Disease Virus during Serial Passages in a Natural Host

ABSTRACT

Foot-and-mouth disease virus (FMDV), like other RNA viruses, exhibits high mutation rates during replication that have been suggested to be of adaptive value. However, even though genetic variation in RNA viruses and, more specifically, FMDV has been extensively examined during virus replication in a wide variety of in vitro cell cultures, very little is known regarding the generation and effects of genetic variability of virus replication in the natural host under experimental conditions and no genetic data are available regarding the effects of serial passage in natural hosts. Here, we present the results of 20 serial contact transmissions of the highly pathogenic, pig-adapted O Taiwan 97 (O Tw97) isolate of FMDV in swine. We examined the virus genomic consensus sequences for a total of 37 full-length viral genomes recovered from 20 in vivo passages. The characteristics and distributions of changes in the sequences during the series of pig infections were analyzed in comparison to the O Tw97 genomes recovered from serially infected BHK-21 cell cultures. Unexpectedly, a significant reduction of virulence upon pig passages was observed, and finally, interruption of the viral transmission chain occurred after the14th pig passage (T14). Virus was, however, isolated from the tonsils and nasal swabs of the asymptomatic T15 pigs at 26 days postcontact, consistent with a natural establishment of the carrier state previously described only for ruminants. Surprisingly, the region encoding the capsid protein VP1 (1D) did not show amino acid changes during in vivo passages. These data demonstrate that contact transmission of FMDV O Tw97 in pigs mimics the fitness loss induced by the bottleneck effect, which was previously observed by others during plaque-to-plaque FMDV passage in vitro, suggesting that unknown mechanisms of virulence recovery might be necessary during the evolution and perpetuation of FMDV in nature.
Foot-and-mouth disease (FMD) has a high economical impact, affecting domestic and wild cloven-hoofed animal species worldwide (reviewed in references 2, 3, 24, and 46). The etiological agent FMD virus (FMDV) of Picornaviridae occurs as seven distinct serotypes and multiple subtypes, reflecting significant genetic and antigenic heterogeneity. In the field, this heterogeneity is reflected by the lack of cross-protection even between intraserotype variants (2, 3, 46).
VP1 (1D), the highly variable FMDV capsid protein with roles in virus entry, immunity, and serotype specificity, has been the subject of extensive comparative sequence analysis (reviewed in reference 22). These studies have shown cocirculation of FMDV genotypes in single outbreaks, with genotypes usually grouping into geographically and genetically distinct lineages (less than 15% nucleotide differences) known as topotypes (41). With the expansion of FMDV genomic databases, however, evidence is accumulating for the inadequacy of VP1 analysis alone for epidemiological studies and for the importance of recombination in FMDV evolution (4, 20, 23).
The selective forces at work during the emergence of FMDV populations in nature are likely to be influenced by specific epidemiological and immunological aspects of host-virus interaction as well as the quasispecies composition of the viral population. Many important questions, including those regarding the significance of high mutation rates in adaptive virus evolution, of Darwinian selection in diversification of viruses with short infection cycles, and of genetic drift as a mechanism for FMDV evolution, remain unanswered. Similarly, there is no knowledge of the limits within which a highly variable pathogen, such as FMDV, can accumulate genomic changes and still reproduce the disease in the natural host and spread in the natural environment. Very few studies have been published regarding FMDV-natural host interactions at the genetic level (5, 6, 47, 49). No studies have been conducted to examine FMDV evolution during replication in the natural host, and very few evolutionary analyses have examined genomic regions other than those corresponding to VP1 or its precursor, P1 (4, 27). Paradoxically, the few experimental studies conducted with natural isolates suggest extreme constrains for 1D variation (5, 6) and loss of fitness during passages in natural hosts (1, 22, 46). In fact, enhanced mutagenesis experiments have shown infectivity loss for a number of RNA viruses, including FMDV, lymphocytic choriomeningitis virus, and Hantavirus (18, 31, 32, 33, 38, 42), suggesting that critical variability thresholds that may explain the restrictions for change observed in vivo exist. However, the characteristics and boundaries of those limits in genetic variation and phenotypic expression remain unknown.
Here, we analyzed genetic changes in full-length FMDV genomes during serial passages of O Taiwan 97 (O Tw97) virus in pigs and in BHK-21 cells. Originally isolated from pigs during an FMD outbreak, O Tw97 virus exhibits rapid spread and high virulence in pigs (13, 21, 50). New FMDV genetic variants with altered pathogenicity in pigs and the rapid replacement of the original consensus sequence by new variant genotypes with acquired mutations, mostly outside the capsid coding region P1, were observed. The data indicate rapid accumulation of nucleotide substitutions and fitness loss, suggesting bottleneck transmission effects. Fixation of amino acid changes in nonstructural proteins (NSPs) likely resulted in deleterious effects for virus biology, leading to the establishment of a subclinical infection that resembles the carrier state described for cattle (2, 39, 46). Furthermore, we found significant differences in evolution parameters between in vivo- and in vitro-passaged virus, reflecting differences in selective pressures operating on virus populations, expressed as differences between numbers of synonymous and nonsynonymous substitutions, frequencies of transitions and transversions, and levels of tolerance for changes in specific viral proteins.

MATERIALS AND METHODS

Viruses.

O Tw97 virus was obtained from the Animal and Plant Health Inspection Service, USDA, as a 10% swine epithelial tissue homogenate and was completely sequenced (GenBank no. AY593835). For stock virus production, two pigs (no. 48 and 50) were inoculated with the supernatant of the epithelial homogenate (0.5 ml; 105.7 50% tissue culture infectious doses [TCID50]/ml) by the intradermal (i.d.) route. Within 24 h after inoculation, both animals developed high fevers and generalized lesions with large vesicles on the feet and snout, symptoms consistent with previous descriptions of O Tw97 virus infection (14, 50). Vesicular fluid was collected from independent lesions and pooled to create a viral stock, T00. The T00 stock was titrated and the FMDV genome completely sequenced and then used to infect a pig i.d. in pig passage T0 (Table 1).

Virus titration.

Eight log10 serial dilutions of vesicle fluid were used to inoculate BHK-21 cells. After 1 h of virus adsorption, cells were cultivated with 50 μl medium containing 2% fetal calf serum (FCS) at 37°C and 5% CO2 for 72 h. Cell monolayers were stained with neutral violet, plaques counted, and titers determined using the Reed and Muench method (37) and expressed as numbers of TCID50.

Animal experiments.

For the serial passage experiment, 4-week-old pigs were randomly paired and housed in containment rooms. One pig, T0 (meaning time zero of infection), was inoculated by the i.d. route with 100 μl of T00 (106.47 TCID50/ml) and housed with two recipient pigs (T1 [time 1]) in the same room. When the body temperatures of the T1 pigs reached 104°F or above, the T1 pigs were moved to a clean room with two noninfected pigs (T2 [time 2]). The period of time between the T1-T2 contact and the appearance of vesicular lesions on the feet and/or mouth of any of the T2 pigs is what we define as the “infectious round.” The number of cohabitation days for each infectious round differed between passages. This procedure was repeated for every infectious round up to T13, the last round of the transmission-of-infection chain. For each infectious round, when vesicles in donors became evident, vesicle fluid was collected, and the animals were kept in contact with the recipient animals until fever occurred (i.e., T3); then, the animals were culled. For each infected animal, we recorded daily body temperatures and the presence of clinical symptoms.

Sample collection.

Vesicular fluids were individually collected with sterile syringes, placed on ice, and transported to the laboratory, where titrations were immediately performed. The remaining volume was stored at −70°C until used for RNA extraction and sequencing. Epithelial tissue from broken vesicles was collected using clean sterile scissors, immersed in cryotubes containing 500 μl of Dulbecco's modified Eagle's medium (DMEM), and immediately frozen at −70°C. Tonsil scrapings and nasal swabs were collected from animals that did not present signs of disease after 26 days in contact with donor animals. This material was used for both reverse transcription (RT)-PCR and virus isolation in BHK-21 cells.

BHK-21 cell culture infections.

BHK-21 cells were grown in T25 tissue culture flasks with DMEM containing 5% FCS. Cells were serially passaged 23 times at a concentration of 105 cells/ml. Infections were carried out when cells were approximately 95% confluent using a multiplicity of infection of 1 to 10 virus particles per cell from the previous viral passage and cultured in DMEM with 2% FCS. The first passage, P1, was carried out with 0.5 ml of vesicular fluid containing 106.47 TCDI50s/ml from the T00 stock virus, resulting in a multiplicity of infection of 1 to 10 virus particles per cell. In this case, we define the infectious round as the period of time between the culture inoculation and the detection of a complete cytopathic effect. When the cytopathic effect was complete, the culture was frozen and thawed three consecutive times; the supernatant was clarified by centrifugation at 3,000 rpm for 10 min and fractionated in 1-ml aliquots at −70°C. For the next infectious round, 1 ml of the supernatant was used for infecting BHK-21 tissue cultures in duplicate (P2a and P2b). By repetition of these steps, serial infections of separated lineages (A and B) were carried out up to passages 23A and 23B. Titrations of every infected cell culture supernatant were performed for each passage.

RT-PCR and sequencing.

Total RNA was directly extracted from 140 μl of the DMEM-vesicular fluid mixture or from infected cell culture supernatants. Full-length FMDV genome sequences were obtained by RT of the viral genomic RNA, followed by amplification and sequencing of overlapping cDNA fragments spanning the entire viral genome as previously described (4).
Direct DNA sequencing of amplicons derived from a given FMDV isolate yielded a consensus sequence representing the most probable nucleotide for each position of the sequence. This approach prevented analysis of minor sequence variants, polymerase misincorporation errors, and sequencing ambiguities through multiple independent cDNA synthesis, PCR amplification, and direct sequencing events. Due to the quasispecies nature of FMDV populations, polymorphisms were detected in some nucleotide positions. Nevertheless, all positions could be unambiguously assigned to a single dominant nucleotide due to the high degree of redundancy generated by the sequencing strategy.

Sequence analysis.

As described previously (4), bases were called from chromatogram traces with the Phred program, which also produced a quality file containing a predicted error probability at each base position. Viral sequences were assembled with the Phrap and CAP3 assemblers. Gap closure was performed as described previously (4). Multiple sequence alignments were performed with the ClustalW (version 1.7) computer program. Analyses of codons and synonymous/nonsynonymous substitution ratios were calculated using the programs SNAP, CodonW (http://www.molbiol.ox.ac.uk/cu/), and codeml (PAML3.14 package), which was also used for statistical evaluation of heterogeneous selection pressures at amino acid sites. For protein analysis, the PRETTY program was used. Protein secondary-structure predictions were performed using the GOR and Pratt computer programs. The codeml program was used to analyze and compare predicted positively selected sites in the FMDV genome under in vitro and in vivo growth conditions. A Bayes Empirical Bayes (BEB) analysis-based codeml model giving the highest probability values (P = 0.001) was chosen for the analysis.

RESULTS

FMDV infections and disease presentation.

After i.d. inoculation, fevers and soreness were present within 12 h postinfection, with numerous large vesicles appearing on the feet, nose, and tongue at 24 h postinfection. In some cases, complete prostration accompanied by the loss of hooves was observed. During pig-to-pig contact transmission, animals presented severe signs of disease, including salivation, soreness, and loss of appetite, and large vesicles on the nose, mouth, and feet appeared rapidly postcontact for the first three transmission rounds (T1, T2 and T3). Clinical symptoms gradually decreased in severity as the number of passages increased, and acute disease was not observed in the T15 pig passage. Pig 5016 (T14) did not show a fever during the 26 days of observation, despite the fact that vesicle fluids collected from its two T13 contacts (Table 1) contained 108.3 TCID50/ml and 105.9 TCID50/ml (pigs 5013 and 5014, respectively). Pig 5015 (T14) developed mild symptoms of disease; after a significant delay in the onset of a fever, a few small vesicles, containing 106.2 TCID50/ml on average, were detected. The T15 animals, pigs 5017 and 4822, did not exhibit any clinical signs after 26 days in contact with T14 animals. Infectious virus isolated from tonsil scrapings and nasal swabs collected from these animals had titers in the range of 104 TCID50/ml, however, indicating that infection had occurred in the absence of clinical disease.
The absence of clinical symptoms and vesicles in T15 animals suggested altered infection potential for T14-derived virus. To asses the infectious potential of T14 viral progeny, 25 μl of vesicle fluid from pig 5015 containing 106.63 TCID50/ml was i.d. inoculated into pig 4823, which presented generalized FMD at 7 days postinoculation. Virus recovered from pig 4823 vesicular fluid (containing 105.85 TCID50/ml) was labeled as the T15 passage and was able to transmit disease via contact to a T16 recipient pig, no. 4824, with vesicular fluid containing 105.75 TCID50/ml. The T17 contact animals, no. 4825 and 4826, exhibited a few small vesicles, but they were able to transmit the disease to T18 pigs 5184 and 5185. Although viral RNA was isolated from both T18 pigs, infection was not transmitted and infectious virus (101.97 TCID50/ml) was detected only in a tonsil scraping from pig 5185. Similarly to previous observations for reestablishment of T14 contact transmission, T18 vesicular fluid (150 μl containing 101.97 TCID50/ml) was infectious when inoculated i.d. into a naïve pig, no. 5005. Acute clinical disease was observed, although vesicle virus titers were low (103.42 TCID50/ml). T20 pigs 5006 and 5007 were free of clinical signs of infection and failed to transmit infection to T21 pigs, thus ending viral transmission.
The interruption of contact FMDV transmission (Table 1) observed here was accompanied by reductions in the numbers and sizes of vesicular lesions and by a dramatic reduction of virus present in vesicular fluid, indicating a gradual loss of virulence of O Tw97 FMDV on repeated pig passage.

Characterization and distribution of nucleotide substitutions in the consensus FMDV genome sequence.

Initial rounds of i.d. virus inoculation resulted in full conservation of the consensus sequence as confirmed by genome sequencing of T00 and T0 viruses collected from several vesicles (48T00v1, 48T00v2, 48T00v3, 50T00v1, 50T00v2, 50T00v3, and 483 T0 in Table 2). In contrast, contact pig passages induced both transitory and permanent mutations in the viral genome as early as the first passage (Table 2).
During pig passages, 11 out of 48 nucleotide changes were located in the untranslated regions (UTRs) and 37 were detected in the coding region (open reading frame [ORF]). Of these, approximately 76% were silent substitutions, with only nine (24%) resulting in an amino acid substitution (Tables 3 and 5). Eight nucleotide changes were located in the structural protein (SP)-coding region, with two of them occurring in the VP1-coding region (Tables 2 and 3). Changes in VP1 (1D) were transitory. The NSP-coding region contained 29 of the total 37 nucleotide substitutions located in coding regions (Tables 2, 3, and 5). The 2C region seemed most prone to mutation, exhibiting 10 nucleotide changes, followed by the Leader protease (Lpro) and the polymerase 3D, with 6 mutations each. Amino acid changes in the host-range-associated protein 3A were not observed during pig passages.
In contrast, for BHK-21 cell culture-passaged FMDV, 35% of the mutations were observed in the SP region, with 4 substitutions in VP1 (1D). All resulted in amino acid changes, with 44% of all amino acid substitutions concentrated in the SP. Interestingly, the host-range-associated protein 3A was also very well conserved (data not shown).

Quantification of nucleotide and amino acid substitutions per round of infection.

The average difference between the two viral populations in the same pig passage was 4.9 × 10−4 substitutions per nucleotide. To estimate the rate of fixation of mutation during passages, we considered the infectious round a “time” unit (see Materials and Methods). Based on this, the rate of fixation of mutation during pig passages was 6.4 × 10−4 substitutions per nucleotide per infectious round (Table 4). The accumulation of nontransitory mutations (substitutions per nucleotide per infectious round) with successive passages resulted in significant differences in rates of accumulation of substitutions, ranging from 3.7 × 10−4 substitutions per nucleotide between the parental and first-passage progeny (T0/T1) sequences to 2.4 × 10−3 substitutions per nucleotide between the parental and 20th-passage progeny (T0/T20) sequences (Table 4). However, there is also a tendency for the number of substitutions per infectious round to increase, as shown in Table 4 in the column indicating the numbers of substitutions per nucleotide per infectious round between passages, where the first passages (i.e., T1/T2) show differences ranging from 1 × 10−4 to 6 × 10−4 substitutions per nucleotide per infectious round but the last passages (i.e., T18/T19) show differences ranging from 8 × 10−4 to 1.7 × 10−3. Quantification of the number of amino acids changed in the 2,322 amino acids of the complete polyprotein showed an average of 1.1, or a total of 4.6 × 10−4, substitutions per amino acid per infectious round, with higher rates between passages T13 and T18, concurrent with loss of transmission capability of the disease.

Predicted selective pressures in vivo and in vitro.

The distribution and translational significance of the nucleotide substitutions in both in vitro and in vivo populations were significantly different (Fig. 1). Remarkably, 76% and 21% of the substitutions occurred in the third codon position during animal-to-animal and cell culture virus passages, respectively (SNAP and CodonW results not shown). The BEB calculation of probabilities for site classes, implemented for the best-fitted model (M8 [β and ω]) to the nonsynonymous/synonymous rate ratio (dN/dS [ω]) for in vivo and in vitro FMDV populations (30) were estimated to be 10 times lower for pig passages (Fig. 1). The log likelihood value (lnL) obtained for the best tree under the substitution model that best fit the data set was reasonably close between both groups. However, the estimated branch lengths for the likelihood analysis, which represents the number of nucleotides substituted per codon, were 5.5 times higher for pig passages than for cell culture-passaged FMDV. The transition/transversion rate ratio, corrected for multiple hits (or κ value), was 4.5 times higher for the cell passages (Fig. 1). To further analyze differences attributable to host selection, we estimated and compared BEB analyses of positively selected sites in the FMDV genome under in vitro and in vivo growth conditions. Amino acid replacements Q580/R in VP2 and P1753/S, E1863/Q, and K2008/E in 3CD were predicted (P ≥ 0.05) positively selected sites during replication in pigs, while for in vitro-replicating virus, the probability was lower and relevant only for positions in 3D (M2108/T and D2321/G).

DISCUSSION

Repeated contact transmission of the highly virulent O Tw97 isolate of FMD resulted in complete attenuation of pathogenicity in pigs, characterized by an asymptomatic infection resembling the FMD carrier state previously described for ruminants but not previously described as occurring in swine (39). This work is the first to correlate decay of infection levels with fixation and accumulation of genetic mutations in in vivo viral quasispecies during serial infections, which could be interpreted as the result of bottleneck transmission and the genetic effect of Muller's ratchet (7, 29). Such a rapid substitution of the consensus sequence has been demonstrated to occur during in vitro clone-to-clone replication of FMDV (17) and other viruses (7, 8, 10, 51), leading to a detrimental accumulation of mutations. In the case of plaque-to-plaque transfers; however, the mutations were never transitory but remained fixed in the genomes. We have shown that loss of transmission was not due to lower viral titers in vesicular fluids; however, as we mentioned above, significant decreases in numbers and sizes of lesions may have impacted total viral yields from one to the next infectious round. In any case, progressive loss of virulence upon pig passages is related to viral genetic factors. These results suggest that if the observed loss of pathogenicity and accumulation of genetic mutations is due to the so-called Muller's ratchet effect, our data may reflect features of FMDV infection of great importance for pathogenesis, virus transmission, and FMD epidemiology in nature (7, 12, 13). In contrast to the observed resistance to extinction of FMDV subjected to plaque-to-plaque in vitro transfers (15, 25), animal-to-animal transmission in nature may lead to virus extinction. Under conditions of natural host transmission, a number of viral phenotypic functions are likely involved in virus-host interactions and an unknown number of bottlenecks lead to a continuous purification of the population, narrowing the mutant spectrum composition of the quasispecies in such a way that it is unable to successfully retain its fitness. This has recently been observed for another picornavirus, a poliovirus mutant displaying enhanced polymerase fidelity (35, 48).
For survival in nature, the viability, virulence, and transmission capability of FMDV must be maintained by as yet unknown mechanisms. In light of recent insights from bottlenecking effects observed during poliovirus infection in mice (36), it is likely that bottlenecking is the result of organ tropism and tissue-specific amplification within the host, resulting in the generalization of the progeny from very few particles of the parental quasispecies. Two observations suggest that more than one point of selection may act as a bottleneck during FMDV infection of the host. Our present data (Table 2) and previous reports have demonstrated with different FMDV isolates that 100 or more TCID50 of BHK-21 cell passaged infectious viral particles injected i.d. into pigs result in identical parental and progeny viral consensus sequences (5, 6). The rapid imposition of new genetic variants observed here indicates that the initial route of animal infection imposes a serious barrier and acts as a bottleneck for the initial viral population. Additionally, it has been previously shown that an FMDV variant isolated during the febrile phase of the disease from blood from a pig infected with a highly purified homologous population of C-S8c1, an FMDV variant isolated from pigs and plaque purified three times in BHK-21 tissue culture before being inoculated into pigs (5), showed a consensus sequence different from that of the virus obtained from vesicles. This viremic variant was genetically stable upon cell culture and pig passages and showed phenotypic differences from the parental strain, which correlated with its origination from viremic blood (6). Thus, different viral variants cocirculate during FMDV infection of the host, likely as a result of bottlenecks during spread and replication within the host, although unless the genetic mutation selected during the bottleneck is advantageous with respect to the parental virus, the epitheliotropic FMDV consensus sequence will be the major progeny population in vesicular fluid. Therefore, more than one bottlenecking event may occur during FMDV infection and this may affect subsequent transmission in natural hosts.
The RasMol 2.7.1 program (www.rasmol.org) and published crystal structures of FMDV proteins were used to analyze predicted effects of amino acid changes detected in viral proteins during pig and cell culture passages. The E186/A substitution in Lpro falls in a highly disordered, unresolved region of the protease. The nonconservative Q580/R change affecting position 76 in VP3 is in close contact with P132 of the same protein, and its replacement by R may have an effect on the folding of the protein since R76 seems to interrupt the long α-helix structure of the parental sequence to induce a β-sheet structure. Secondary-structure analysis (Chou-Fasman) of the P114S substitution in the 3C viral proteinase predicts no significant effect. Both residues are small and uncharged; examination of the A10 virus 3C crystal structure revealed that P114 is on the protein surface, and although distant from the active site, P114 may somehow affect the protease substrate specificity pocket (S. Curry, personal communication). Substitutions in the 3D region, E11/Q and K156/E, seem to affect the protein surface and may have possible consequences for functional interaction between 3D and other proteins in the replication complex (Table 5).
The quantification of the FMDV genomic variability following the cell culture passage observed here is consistent with previous published reports (11, 16, 43, 44). Characterizations of FMDV genomic regions most extensively affected by mutations are difficult to reconcile with the many reports using VP1 as an indicator of variability to obtain phylogenetic information from field isolates (24, 26, 45). Previous analyses of partial sequences of the VP1-coding region following a single passage in vivo (5, 6), along with recent full-length genome studies performed with UK2001 field isolates, support our present data indicating that a surprisingly low number of mutations are found in SPs in animals that have not been vaccinated (9). These differences could be the result of early transmission events which precede development of antigenic variants due to host immune responses, while the field isolates compared in epidemiological studies come from animals with developing immune responses to previous infections and/or vaccination, which could act as driving forces for positive selection of antigenic variants (26, 34, 40).
Pigs 5017 and 4822 did not exhibit any sign of disease after 26 days in contact with T14 donors. Nevertheless, infectious virus was isolated from tonsil scrapings and nasal swabs collected from both animals, with titers of 103.2 TCID50/ml and 103.9 TCID50/ml and 103.9 TCID50/ml and 102.4 TCID50/ml, respectively. Virus isolation from pig tonsils at day 26 postcontact confirmed that these animals had been infected without clinical symptoms of disease and that virus had persisted in them for 4 weeks. This case resembles what has been described as a carrier state of FMDV for cattle, sheep, and goats (2, 39, 46) but not yet demonstrated for pigs. Bottleneck transmission may confer on the virus the ability to ratchet down fitness and virulence to ensure the immunization of at least a fraction of the population rather than kill or debilitate the entire susceptible host population. Indeed, most lineages would be destined to be self-limiting in subclinical and nonproductive infections. Interestingly, phylogenetically based epidemiological studies have indicated that FMDV topotypes appear to represent evolutionary cul-de-sacs (41). Our results suggest strong selection against changes in capsid proteins and higher flexibility for changes in NSP 2C and 3D in vivo, while a strong selection for substitutions in the P1 region (Table 3) is shown in vitro. These data confirm previous reports of spontaneous mutations in VP1 and the rise of antigenic variants occurring during FMDV replication in cell cultures in the absence of immunological selective pressure (11, 44). We do not understand this difference, since in both cases there is no immunological selective pressure. This observation may result from as yet unknown selective pressures involving viral receptor binding and/or particle internalization present in vivo. Finally, our results demonstrate that the effects of host adaptation can be objectively quantified and compared through the calculation of parameters of evolution and selective pressure, like those obtained with the CODELM analysis program (PALM). Although preliminary and limited, this is a novel and promising approach for analysis of FMDV genomic variability suggesting that the extension of our knowledge regarding viral evolution under experimental conditions in natural hosts will allow development of molecular epidemiology tools for improved identification of viral strains.
FIG. 1.
FIG. 1. Schematic representation of changes observed in the FMDV genome during passages in vivo and in vitro. White stars represent nucleotide changes fixed along the genome during passages. Black stars represent nonsynonymous fixed nucleotide changes. Data summary of in vivo and in vitro parameters of selective pressure: lnL, neperian log likelihood ratio value; tree branch length, number of nucleotide substitutions per codon; Ts/Tv, transition/transversion; dN/dS, number of nonsynonymous substitutions per nonsynonymous site/number of synonymous substitutions per synonymous site.
TABLE 1.
TABLE 1. FMDV passage in vivo and in vitro
Pig no.Pig passageAvg TCID50 (n = 4)aObservationsBHK-21 cell passageAvg TCID50 (n = 4)a
48T005.92 ± 0.54Injected to produce stockP1A5.8 ± 0.51
50T005.81 ± 1.1Injected to produce stockP1B5.8 ± 0.39
483T07.30 ± 0Injected, in contact with two naive pigsbP2A7.6 ± 0.54
484T17.13 ± 0.67 P2B6.3 ± 0.51
485T17.97 ± 0.17 P3A6.8 ± 1.55
486T25.79 ± 0.3 P3B5.8 ± 1.2
487T27.58 ± 0.39 P4A6.6 ± 0.51
488T35.29 ± 0.86 P4B6.6 ± 0.72
489T33.5 ± 0.9 P5A6.5 ± 0.5
490T47.09 ± 0.46 P5B6.5 ± 0.22
491T48.34 ± 1.04 P6A6.8 ± 0.72
492T55.8 ± 1.0 P6B6.6 ± 0.5
493T55.93 ± 0.37 P7A6.1 ± 0.05
494T67.75 ± 0.05 P7B6.8 ± 0.37
495T66.46 ± 0.16 P8A6.3 ± 0.54
496T75.3 ± 0.83 P8B7.3 ± 1.55
497T77.8 ± 0.63 P9A6.3 ± 0.27
498T86.74 ± 1.4 P9B7.3 ± 1.04
499T85.35 ± 0.78 P10A6.6 ± 0.3
725T93.07 ± 0.27 P10B6.6 ± 0.39
726T97.07 ± 0.44 P11A6.8 ± 0.51
4500T105.21 ± 3.9 P11B6.8 ± 0.27
5008T101.84 ± 1 P12A7.5 ± 0.05
5009T114.02 ± 0.45 P12B6.1 ± 0.17
5010T116.85 ± 0.27 P13A6.5 ± 0.54
5011T125.57 ± 0.22 P13B6.8 ± 1.04
5012T126.41 ± 0.89 P14A7.1 ± 0.72
5013T138.3 ± 0.17 P14B6.0 ± 0.39
5014T135.9 ± 0.61 P15A7.0 ± 0.45
5015T146.21 ± 0.6Contact transmitted with no clinical signsP15B7.0 ± 0.27
5016T14<0.8Contact transmitted with no clinical signsP16A7.0 ± 0.54
4823T155.85 ± 0.5Injected with 5015 vesicular fluidcP16B6.8 ± 0.61
4824T165.75 ± 0.72In contact with 4823P17A7.3 ± 0.16
4825T176.92 ± 0.51 P17B6.6 ± 0.51
4826T17<0.8 P18A7.0 ± 0.89
5184T18<0.8Contact transmitted with no clinical signsP18B6.8 ± 0.44
5185T181.97 ± 1.2Contact transmitted with no clinical signsP19A7.3 ± 1.04
5005T193.42 ± 1.55Injected with 5185 vesicular fluiddP19B6.6 ± 0.22
5006T20<0.8Contact transmitted with no clinical signsP20A7.1 ± 0.17
5007T20<0.8Contact transmitted with no clinical signsP20B6.8 ± 0.05
a
Titers are expressed as log10 numbers of of TCID50/ml. Titer values represent the means and standard deviations for four different vesicles from the same pig or four replicates of titration of supernatant from the same cell culture.
b
Pig 483 was inoculated i.d. with 106.37 TCID50 from original viral stock T00.
c
Pig 4823 was inoculated i.d. with 105.7 TCID50 from pig 5015 vesicular fluid.
d
Pig 5005 was inoculated with 101.15 TCID50 from pig 5185 vesicular fluid.
TABLE 2.
TABLE 2. Progressive substitutions of dominant nucleotides in the consensus O Tw97 genome sequence during pig passage
Pig designationcInfectious rounddNucleotide in indicated position and region                        Nucleotide in indicated position and region                      
  5′ UTRa         3′ UTRLpro     P1       P2           P3          
  82b15540347448052454181884495580961087141114441522157316112290279328602881289030403724376340154252442644384469477950022032510752575276529156565986628363116364664170767183737575617792
ParentalO Tw97eTTGAGACTAATAGATTAAACTCATACTGAGCCCACACTGTCTGACCCC
48T00v1                                                
48T00v2                                                
48T00v3                                                
50T00v1                                                
50T00v2                                                
50T00v3                                                
483T0                                                
484T1                     T                          
485T1       C              G        T                
486T2                      G        T                
487T2   G        A  C          C                     
488T3   G        A             C                  T  
489T3            A            AC                     
490T4   G        A            AC              C   T  
491T4   G        A            AC                  T  
492T5   G        A            AC          C   C   T  
493T5   G        A            AC              C   T  
494T6   G        A            AC              C   T  
495T6   G     G  A             C              C   T  
496T7            A             C              C   T  
497T7 C    T    GA             C       T   A      T  
498T8 C G       GA             C           A      T  
499T8 C G        A             C       T   A      T  
725T9 C G G     GA             C           A      T  
726T9 C    T    GA             C       T   A      T  
4500T10 C         GA             C           A      T  
5008T10 C          A             C       TG  A      T  
5009T11 C          A             C       TG  A      T  
5010T11 C         GA      T      C       TG  A    G T  
5011T12 C         GA      T      C       TG  A    G T  
5012T12 C G       GA      T      C       TG  A    G T  
5013T13 C G       GA      TC     C  AT   TG  A    G T  
5014T13 C G       GA      T      C       TG  A    G T  
5015T14 CAG       GAG    GT      C       TG  A T  G T  
5016T14                                                
4823T15 (14-I) C                                    A T  G T  
4824T16 C         GA     G     G             A CTCG T  
4825T17 C      G  GAGC   GT      CAG     TG  A T CGTT T
4826T17 C GA   G  GAG         C  C       TG  A    GTT  
5184T18 C         GA             C      GTG  A T CGTT  
5185T18 CAG    G   A             C      GTG  A T CGTT  
5005T19 (18-I)CC G    G  GAG    GT            T TGT A T CGTTT 
5006T20CC G    G GGAGC CGGT      C      GTG  A T CGTT  
5007T20 C G    G   A     GT      C       TG  A T CGTT  
a
Genomic regions include UTRs and precursor protein-coding regions.
b
Specific position number in the full-length O Tw97 genome (GenBank accession no. AY593835).
c
Pig identification number.
d
The infectious round represented by each pig number is shown, followed by the nucleotide substitutions detected in the corresponding consensus sequence. Empty spaces indicate no change of nucleotides with respect to the parental O Tw97 sequence.
e
The O Tw97 row indicates the nucleotides assigned for the parental consensus O Tw97 sequence.
TABLE 3.
TABLE 3. Numbers and distributions of nucleotide and amino acid substitutions observed in the O Tw97 genome consensus sequence during passages in vivo and in vitroa
Passage groupNo. (%) of substitutions for indicated regionb                       
 Lpro P1       P2     P3       
  VP4 VP3 VP2 VP1 2A 2B 2C 3A 3B 3C 3D  
 ntaantaantaantaantaantaantaantaantaantaantaantaa
In vivo6 (16)1 (11)001 (3)05 (13)1 (11)2 (5)0002 (5)1 (11)10 (27)3 (33)1 (3)0004 (11)1 (11)6 (16)2 (22)
In vitro3 (15)2 (12)1 (5)1 (6)1 (5)1 (6)1 (5)1 (6)4 (20)4 (25)001 (5)01 (5)1 (6)1 (5)1 (6)1 (5)1 (6)1 (5)1 (6)5 (24)3 (19)
a
The total numbers of substitutions were 48 in vivo and 22 in vitro. Total numbers (percentages) of substitutions for subgroups are as follows: for UTRs in vivo, 11 (23); for ORFs in vivo, 37 (77); for UTRs in vitro, 2 (9); for ORFs in vitro, 20 (91); for nucleotides in P1 in vivo, 8 (22); for amino acids in P1 in vivo, 1 (11); for nucleotides in P2 in vivo, 12 (32); for amino acids in P2 in vivo, 4 (44); for nucleotides in P3 in vivo, 11 (30); for amino acids in P3 in vivo, 3 (33); for nucleotides in P1 in vitro, 7 (35); for amino acids in P1 in vitro, 7 (44); for nucleotides in P2 in vitro, 2 (20); for amino acids in P2 in vitro, 1 (6); for nucleotides in P3 in vitro, 8 (40); for amino acids in P3 in vitro, 6 (37).
b
nt, nucleotide; aa, amino acid.
TABLE 4.
TABLE 4. Rates of fixation of mutations and rates of O Tw97 evolution upon in vivo and in vitro passages
Passage group and infectious roundsNo. of substitutions per nucleotide per infectious round Infectious round(s)e, fO Tw97 evolution ratec
 Between passagesa, e, fWithin the same passageb, e, f  
In vivod    
    T0/T13.7 × 10−4 T00
    T1/T1 6.2 × 10−4T13.7 × 10−4
    T1/T25.5 × 10−4   
    T2/T2 8.6 × 10−4T24.3 × 10−4
    T2/T34.6 × 10−4   
    T3/T3 2.5 × 10−4T32.9 × 10−4
    T3/T43.1 × 10−4   
    T4/T4 1.2 × 10−4T46.8 × 10−4
    T4/T51.2 × 10−4   
    T5/T5 2.5 × 10−4T57.4 × 10−4
    T5/T61.8 × 10−4   
    T6/T6 1.2 × 10−4T68.0 × 10−4
    T6/T76.1 × 10−4   
    T7/T7 6.2 × 10−4T78.0 × 10−4
    T7/T85.5 × 10−4   
    T8/T8 1.2 × 10−4T89.2 × 10−4
    T8/T93.1 × 10−4   
    T9/T9 4.9 × 10−4T99.8 × 10−4
    T9/T103.7 × 10−4   
    T10/T10 3.7 × 10−4T108.0 × 10−4
    T10/T112.1 × 10−4   
    T11/T11 3.7 × 10−4T111.0 × 10−3
    T11/T122.5 × 10−4   
    T12/T12 1.2 × 10−4T121.3 × 10−3
    T12/T134.3 × 10−4NA  
    T13/T148.6 × 10−4NAT131.7 × 10−3
    T14/T151.3 × 10−3NAT141.8 × 10−3
    T15/T166.2 × 10−4NAT157.4 × 10−4
    T16/T171.7 × 10−3NAT161.2 × 10−3
    T17/T17 1.7 × 10−3T172.0 × 10−3
    T17/T181.4 × 10−3   
    T18/T18 4.9 × 10−4T181.6 × 10−3
    T18/T191.3 × 10−3   
    T19/T208 × 10−4 T192.6 × 10−3
    T20/T20 8.6 × 10−4  
    T20/O Tw97  T20/O Tw972.4 × 10−3
In vitrod    
    A1/A31.2 × 10−4 A10
    A3/A60 A31.2 × 10−4
    A6/A90 A61.2 × 10−4
    A9/A120 A91.2 × 10−4
    A12/A150 A121.2 × 10−4
    A15/A181.2 × 10−4 A151.2 × 10−4
    A18/A212.5 × 10−4 A182.5 × 10−4
    A21/A232.5 × 10−4 A214.9 × 10−4
   A237.4 × 10−4
    B1/B31.2 × 10−4 B10
    B3/B60 B31.2 × 10−4
    B6/B92.5 × 10−4 B61.2 × 10−4
    B9/B123.7 × 10−4 B93.7 × 10−4
    B12/B152.3 × 10−3 B127.4 × 10−4
    B15/B181.2 × 10−4 B151.9 × 10−3
    B18/B210 B182.0 × 10−3
    B21/B230 B212.0 × 10−3
   B232.0 × 10−3
    Lineages    
        A1/B10   
        A3/B30   
        A6/B60   
        A9/B92.5 × 10−4   
        A12/B126.2 × 10−4   
        A15/B151.7 × 10−3   
        A18/B181.7 × 10−3   
        A21/B211.7 × 10−3   
        A23/B231.4 × 10−3   
a
The number of substitutions per nucleotide per infectious round for one passage and its immediate predecessor was calculated as the average for four genomes compared by pairs.
b
The number of substitutions per nucleotide for both replicates for each infectious round. NA, not available.
c
The accumulative rate of incorporations of mutations during passages with T0 or A1 as the start point, respectively.
d
Cell passage sequences are compared every three passages.
e
The ranges (maximum and minimum numbers of changes detected during passages) are as follows: for between-pass rates in vivo, 1.3 × 10−3 to 8.0 × 10−4; for between-pass rates in vitro, 1.2 × 10−4 to 2.3 × 10−3; for O Tw97 evolution rates in vivo, 2.9 × 10−4 to 2.5 × 10−3; for O Tw97 evolution rates in vitro, 1.2 × 10−4 to 2.0 × 10−3.
f
The averages (mean numbers of changes detected during the passages) are as follows: for between-pass rates in vivo, 6.4 × 10−4; for between-pass rates in vitro, 1.4 × 10−4 (average B), 3 × 10−5 (average A), and 8.3 × 10−4 (average for lineages); for O Tw97 evolution rates in vivo, 1.3 × 10−4; for O Tw97 rates in vitro, 4.0 × 10−4 (average B) and 9 × 10−5 (average A).
TABLE 5.
TABLE 5. Amino acid changes observed following serial passage of O Tw97 in pigs
Pig designationInfectious roundAmino acid for indicated polyprotein position, protein position, and viral proteina        
  PP 186, P 186, LproPP 580, P 76, VP3PP 987, P 34, 2BPP 1139, P 32, 2CPP 1242, P 135, 2CPP 1408, P 301, 2CPP 1753, P 105, 3CPP 1863, P 11, 3DPP 2008, P 156, 3D
ParentalbO Tw97EQNATIPEK
48T00v1         
48T00v2         
48T00v3         
50T00v1         
50T00v2         
50T00v3         
483T0         
484T1         
485T1         
486T2         
487T2         
488T3         
489T3         
490T4  K      
491T4  K      
492T5  K      
493T5  K      
494T6  K      
495T6  K      
496T7         
497T7         
498T8         
499T8         
725T9         
726T9         
4500T10         
5008T10     V   
5009T11     V   
5010T11     V  E
5011T12     V  E
5012T12     V  E
5013T13   TIV  E
5014T13     V   
5015T14     VS E
4823T15 (T14-I)     VSQE
4824T16 R   VSQE
4825T17 R   VSQE
4826T17 R   VS  
5184T18 R   VSQE
5185T18 R   VSQE
5005T19 (T18-I) R   VSQE
5006T20AR   VSQE
5007T20 R   VSQE
Conservation index 0.30.40.40.40.21.10.40.70.3
Protein Structurec T to NDα to βT to αα to βNoneNoneNoneNoneND to α
Chargec − to NN to +N to +NoneNoneNoneNone− to N+ to −
a
Conservation indices (19) and predicted values of the detected amino acid substitutions. PP, polyprotein position; P, protein position.
b
Parental refers to the expected amino acid present in the consensus sequence of parental virus O Tw97 that has been substituted in the following pig passages.
c
T, turn; ND, not defined; α, alpha sheet; β, beta sheet.
dN, neutral; −, negative; +, positive.

Acknowledgments

We thank E. Domingo and C. Escarmis for their excellent suggestions during the writing of the manuscript. We thank M. V. Prarat for providing excellent editing assistance and suggestions. Finally, thanks to the animal caretakers of PIADC for providing technical assistance with the animal experiments.

REFERENCES

1.
Afzal, H., and M. M. Sarwar.1968. Attenuation of foot-and-mouth disease virus type “O” by serial passages in goats. Bull. Off. Int. Epizoot.69:467-486.
2.
Alexandersen, S., Z. Zhang, and A. I. Donaldson.2002. Aspects of the persistence of foot-and-mouth disease virus in animals—the carrier problem. Microbes Infect.4:1099-1110.
3.
Brown, F.2003. The history in foot-and mouth disease. Virus Res.91:1-7.
4.
Carrillo, C., E. R. Tulman, G. Delhon, Z. Lu, A. Carreno, A. Vagnozzi, G. F. Kutish, and D. L. Rock.2005. Comparative genomics of foot-and-mouth disease virus. J. Virol.79:6487-6504.
5.
Carrillo, C., J. Plana, R. Mascarella, J. Bergada, and F. Sobrino.1990. Genetic and phenotypic variability during replication of foot-and-mouth disease virus in swine. Virology179:890-892.
6.
Carrillo, C., M. Borca, D. M. Moore, D. O. Morgan, and F. Sobrino.1998. In vivo analysis of the stability and fitness of variants recovered from foot-and-mouth disease virus quasispecies. J. Gen. Virol.79:1699-1706.
7.
Chao, L.1990. Fitness of RNA virus decreased by Muller's ratchet. Nature348:454-455.
8.
Clarke, D., E. Duarte, A. Moya, S. Elena, E. Domingo, and J. J. Holland.1993. Genetic bottlenecks and population passages cause profound fitness differences in RNA viruses. J. Virol.67:222-228.
9.
Cottam, E. M., D. T. Haydon, D. J. Paton, J. Gloster, J. W. Wilesmith, N. P. Ferris, G. H. Hutchings, and D. P. King.2006. Molecular epidemiology of the foot-and-mouth disease virus outbreak in the United Kingdom in 2001. J. Virol.80:11274-11282.
10.
de la Peña, M., S. F. Elena, and A. Moya.2000. Effect of deleterious mutation accumulation of the fitness of RNA bacteriophage MS2. Evolution54:686-691.
11.
Diez, J., M. G. Mateu, and E. Domingo.1989. Selection of antigenic variants of foot-and-mouth disease virus in the absence of antibodies, as revealed by an in situ assay. J. Gen. Virol.70:3281-3289.
12.
Domingo, E., C. Biebricher, M. Eigen, and J. J. Holland.2001. Quasispecies and RNA virus evolution: principles and consequences. Landes Bioscience, Austin, TX.
13.
Duarte, E. A., D. K. Clarke, A. Moya, E. Domingo, and J. J. Holland.1992. Rapid fitness losses in mammalian RNA virus clones due to Muller's ratchet. Proc. Natl. Acad. Sci. USA89:6015-6019.
14.
Dunn, C. S., and A. I. Donaldson.1997. Natural adaption to pigs of a Taiwanese isolate of foot-and-mouth disease virus. Vet. Rec.141:174-175.
15.
Escarmis, C., G. Gomez-Mariano, M. Davila, E. Lazaro, and E. Domingo.2002. Resistance to extinction of low fitness virus subjected to plaque-to-plaque transfers: diversification by mutation clustering. J. Mol. Biol.315:647-661.
16.
Escarmís, C., E. C. Carrillo, M. Ferrer, J. F. García Arriaza, N. Lopez, C. Tami, N. Verdaguer, E. Domingo, and M. T. Franze-Fernández.1998. Rapid selection in modified BHK-21 cells of a foot-and-mouth disease virus variant showing alterations in cell tropism. J. Virol.72:10171-10179.
17.
Escarmís, C., M. Dávila, N. Charpentier, A. Bracho, A. Moya, and E. Domingo.1996. Genetic lesions associated with Muller's ratchet in an RNA virus. J. Mol. Biol.264:255-267.
18.
Grande-Perez, A., S. Sierra, M. G. Castro, E. Domingo, and P. R. Lowenstein.2002. Molecular indetermination in the transition to error catastrophe: systematic elimination of lymphocytic choriomeningitis virus through mutagenesis does not correlate linearly with large increases in mutant spectrum complexity. Proc. Natl. Acad. Sci. USA99:12938-12943.
19.
Gribskov, M., and R. R. Burgess.1986. Sigma factors from E. coli, B. subtilis, phage SP01, and phage T4 are homologous proteins. Nucleic Acids Res.14:6745-6763.
20.
Heath, L., E. van der Walt, A. Varsani, and D. P. Martin.2006. Recombination patterns in aphthoviruses mirror those found in other picornaviruses. J. Virol.80:11827-11832.
21.
Huang, C. C., Y. L. Lin, T. S. Huang, W. J. Tu, S. H. Lee, M. H. Jong, and S. Y. Lin.2001. Molecular characterization of foot-and-mouth disease virus isolated from ruminants in Taiwan in 1999-2000. Vet. Microbiol.81:193-205.
22.
Hughes, G. J., V. Mioulet, D. T. Haydon, R. P. Kitching, A. I. Donaldson, and M. E. Woolhouse.2002. Serial passage of foot-and-mouth disease virus in sheep reveals declining levels of viraemia over time. J. Gen. Virol.83:1907-1914.
23.
Jackson, A. L., H. O'Neill, F. Maree, B. Blignaut, C. Carrillo, L. Rodriguez, and D. T. Haydon.2007. Mosaic structure of foot-and-mouth disease virus genomes. J. Gen. Virol.88:487-492.
24.
Knowles, N. J., and A. R. Samuel.2003. Molecular epidemiology of foot-and-mouth disease virus. Virus Res.91:65-80.
25.
Lazaro, E., C. Escarmís, J. Pérez-Mercader, S. C. Manrubia, and E. Domingo.2003. Resistance of virus to extinction on bottleneck passages: study of a decaying and fluctuating pattern of fitness loss. Proc. Natl. Acad. Sci. USA100:10830-10835.
26.
Martínez, M. A., J. Dopazo, J. Hernández, M. G. Mateu, F. Sobrino, E. Domingo, and N. J. Knowles.1992. Evolution of the capsid protein genes of foot-and-mouth disease virus: antigenic variation without accumulation of amino acid substitutions over six decades. J. Virol.66:3557-3565.
27.
Mason, P. W., J. M. Pacheco, Q. Z. Zhao, and N. J. Knowles.2003. Comparisons of the complete genomes of Asian, African and European isolates of a recent foot-and-mouth disease virus type O pandemic strain (PanAsia). J. Gen. Virol.84:1583-1593.
28.
Reference deleted.
29.
Muller, H. J.1964. The relation of recombination to mutational advance. Mutat. Res.1:2-9.
30.
Nei, M., and T. Gojobori.1986. Simple methods for estimating the numbers of synonymous and non-synonymous nucleotide substitutions. Mol. Biol. Evol.3:418-426.
31.
Pariente, N., S. Sierra, and A. Airaksinen.2005. Action of mutagenic agents and antiviral inhibitors on foot-and-mouth disease virus. Virus Res.107:183-193.
32.
Pariente, N., S. Sierra, P. R. Lowenstein, and E. Domingo.2001. Efficient virus extinction by combination of a mutagen and antiviral inhibitors. J. Virol.75:9723-9730.
33.
Pariente, N., A. Airaksinen, and E. Domingo.2003. Mutagenesis versus inhibition in the efficiency of extinction of foot-and-mouth disease virus. J. Virol.77:7131-7138.
34.
Pattnaik, B., K. Venkataramanan, C. Tosh, A. Sanyal, D. Hemadri, A. R. Samuel, N. J. Knowles, and R. P. Kitching.1998. Genetic heterogeneity of Indian field isolates of FMDV serotype O as revealed by partial sequencing of 1D gene. Virus Res.55:115-127.
35.
Pfeiffer, J. K., and K. Kirkegaard.2005. Increased fidelity reduces poliovirus fitness and virulence under selective pressure in mice. PLoS Pathogens1:102-110.
36.
Pfeiffer J. K., and K. Kirkegaard.2006. Bottleneck-mediated quasispecies restriction during spread of an RNA virus from inoculation site to brain. Proc. Natl. Acad. Sci. USA103:5520-5525.
37.
Reed, L., and H. Muench.1938. Simple method of estimating fifty per cent endpoints. Am. J. Hyg.27:493.
38.
Ruiz-Jarabo, C. M., E. Domingo, and J. C. de la Torre.2003. Lethal mutagenesis of the prototypic arenavirus lymphocytic choriomeningitis virus (LCMV). Virology308:37-47.
39.
Salt, J. S.1993. The carrier state in foot and mouth disease—an immunological review. Br. Vet. J.149:207-223.
40.
Samuel, A. R., N. J. Knowles, R. P. Kitching, and S. M. Hafez.1997. Molecular analysis of foot-and-mouth type O viruses isolated in Saudi Arabia between 1983 and 1995. Epidemiol. Infect.119:381-389.
41.
Samuel, A. R., and N. J. Knowles.2001. Foot-and-mouth disease type O viruses exhibit genetically and geographically distinct evolutionary lineages (topotypes). J. Gen. Virol.82:609-621.
42.
Severson, W. E., C. S. Schmaljohn, A. Javadian, and C. B. Jonsson.2003. Ribavirin causes error catastrophe during Hantaan virus replication. J. Virol.77:481-488.
43.
Sevilla, N., N. Verdaguer, and E. Domingo.1996. Antigenically profound amino acid substitutions occur during large population passages of foot-and-mouth disease virus. Virology225:400-405.
44.
Sobrino, F., M. Davila, J. Ortin, and E. Domingo.1983. Multiple genetic variants arise in the course of replication of foot-and-mouth disease virus in cell culture. Virology128:310-318.
45.
Sobrino, F., M. A. Martinez, C. Carrillo, and E. Beck.1989. Antigenic variation of foot-and-mouth disease virus of serotype C during propagation in the field is mainly restricted to only one structural protein (VP1). Virus Res.14:273-280.
46.
Sutmoller, P., and R. C. Olascoaga.2003. The risks posed by the importation of animals vaccinated against foot and mouth disease and products derived from vaccinated animals: a review. Rev. Sci. Tech.22:823-835.
47.
Tami, C., O. Taboga, A. Berinstein, J. I. Nunez, E. L. Palma, E. Domingo, F. Sobrino, and E. Carrillo.2003. Evidence of the coevolution of antigenicity and host cell tropism of foot-and-mouth disease virus in vivo. J. Virol.77:1219-1226.
48.
Vignuzzi, M., J. K. Stone, J. J. Arnold, C. E. Cameron, and R. Andino.2006. Quasispecies diversity determines pathogenesis through cooperative interactions in a viral population. Nature439:344-348.
49.
Vosloo, W., A. D. Bastos, E. Kirkbride, J. J. Esterhuysen, D. J. van Rensburg, R. G. Bengis, D. W. Keet, and G. R. Thomson.1996. Persistent infection of African buffalo (Syncerus caffer) with SAT-type foot-and-mouth disease viruses: rate of fixation of mutations, antigenic change and interspecies transmission. J. Gen. Virol.77:1457-1467.
50.
Yang, P. C., R. M. Chu, W. B. Chung, and H. T. Sung.1999. Epidemiological characteristics and financial costs of the 1997 foot-and-mouth disease epidemic in Taiwan. Vet. Rec.145:731-734.
51.
Yuste, E., S. Sánchez-Palomino, C. Casado, E. Domingo, and C. López-Galíndez.1999. Drastic fitness loss in human immunodeficiency virus type 1 upon serial bottleneck events. J. Virol.73:2745-2751.

Information & Contributors

Information

Published In

cover image Journal of Virology
Journal of Virology
Volume 81Number 2015 October 2007
Pages: 11341 - 11351
PubMed: 17686868

History

Received: 1 May 2007
Accepted: 24 July 2007
Published online: 15 October 2007

Permissions

Request permissions for this article.

Contributors

Authors

C. Carrillo [email protected]
Plum Island Animal Disease Center, ARS, USDA, P.O. Box 848, Greenport, New York 11944-0848
Present address: Plum Island Animal Disease Center, APHIS, USDA, P.O. Box 848, Greenport, NY 11944-0848.; ‡ Present address: : Center of Excellence for Vaccine Research, University of Connecticut, Storrs, CT 06269.; § Present address: : Department of Pathobiology, College of Veterinary Medicine, University of Illinois at Urbana-Champaign, Urbana, IL 61802.
Z. Lu
Plum Island Animal Disease Center, ARS, USDA, P.O. Box 848, Greenport, New York 11944-0848
M. V. Borca
Plum Island Animal Disease Center, ARS, USDA, P.O. Box 848, Greenport, New York 11944-0848
A. Vagnozzi
Plum Island Animal Disease Center, ARS, USDA, P.O. Box 848, Greenport, New York 11944-0848
G. F. Kutish
Plum Island Animal Disease Center, ARS, USDA, P.O. Box 848, Greenport, New York 11944-0848
Present address: Plum Island Animal Disease Center, APHIS, USDA, P.O. Box 848, Greenport, NY 11944-0848.; ‡ Present address: : Center of Excellence for Vaccine Research, University of Connecticut, Storrs, CT 06269.; § Present address: : Department of Pathobiology, College of Veterinary Medicine, University of Illinois at Urbana-Champaign, Urbana, IL 61802.
D. L. Rock
Plum Island Animal Disease Center, ARS, USDA, P.O. Box 848, Greenport, New York 11944-0848
Present address: Plum Island Animal Disease Center, APHIS, USDA, P.O. Box 848, Greenport, NY 11944-0848.; ‡ Present address: : Center of Excellence for Vaccine Research, University of Connecticut, Storrs, CT 06269.; § Present address: : Department of Pathobiology, College of Veterinary Medicine, University of Illinois at Urbana-Champaign, Urbana, IL 61802.

Metrics & Citations

Metrics

VIEW ALL METRICS

Citations

If you have the appropriate software installed, you can download article citation data to the citation manager of your choice. Simply select your manager software from the list below and click Download.

View Options

View options

PDF/ePub

PDF/ePub

Get Access

Buy Article
Journal of Virology Vol.81 • Issue 20 • ASM Journals Pay Per View, PPV 25
Journal Subscription
Journal of Virology
ASM members can purchase subscriptions to journals.
Join or renew

Figures and Media

Figures

Media

Tables

Share

Share

Share the article link

Share with email

Email a colleague

Share on social media

American Society for Microbiology ("ASM") is committed to maintaining your confidence and trust with respect to the information we collect from you on websites owned and operated by ASM ("ASM Web Sites") and other sources. This Privacy Policy sets forth the information we collect about you, how we use this information and the choices you have about how we use such information.
FIND OUT MORE about the privacy policy