The DotL Protein, a Member of the TraG-Coupling Protein Family, Is Essential for Viability of Legionella pneumophila Strain Lp02

All L.pneumophila strains used in the present study are derived fromLp02 (hsdR rpsL thyA) or JR32 (hsdR rpsL), twoseparate isolates of L. pneumophila Philadelphia-1(3,7,38) (Table1). L. pneumophila strains were cultured onN-(2-acetamido)-2-aminoethanesulfonic acid (ACES)-bufferedcharcoal yeast extract agar (CYET) or ACES-buffered yeast extract broth(AYET) supplemented with thymidine (100 μg/ml). Saltsensitivity was assayed on CYET plates containing0.65% sodium chloride(11,45,64). Antibiotics(kanamycin, 20 μg/ml; chloramphenicol, 5 μg/ml;streptomycin, 50 μg/ml; gentamicin, 5 μg/ml) andsucrose (5%) were added as needed. Escherichia colistrains were cultured on Luria-Bertani medium, and antibiotics(kanamycin, 20 μg/ml; ampicillin, 100 μg/ml;chloramphenicol, 17 μg/ml) were added as needed.Replication-competent plasmids were propagated in the E. colistrain XL1-Blue. In order to propagate suicide plasmids containing theR6K origin of replication, a strain expressing the R6K πprotein, E. coli strain DH5α(λpir),was used (30,67).

To make theΔdotL suicide plasmid, pJB1001, two PCR-amplifiedfragments were cloned into the NotI/SalI sites of pSR47S(40). Fragment 1 wasamplified by using the primers5′-CCCAAACGGCCGCCAAACGAGTATTTACCATGC(JVP201 with the EagI site underlined) and5′-CCCAAAGGATCCCGCATCATGGCTCTAATTCC(JVP202 with the BamHI site underlined). Fragment 2 was amplified byusing the primers5′-CCCAAAGGATCCGCTATTGGGCATGAAGAGAGC(JVP203 with the BamHI site underlined) and5′-CCCAAAGTCGACCCTACTGATGCAACTTTAATCC(JVP204 with the SalI site underlined). Plasmid pJB1005 was constructedby inserting a gene encoding chloramphenicol acetyltransferase that wasamplified from pKRP10 by using the primers5′-CCCAAAGGATCCGAGGTTCCAACTTTCACC(JVP206 with the BamHI site underlined) and5′-CCCAAAGGATCCCTGCCTTAAAAAAATTACGC(JVP207 with the BamHI site underlined) into the BamHI site of plasmidpJB1001.

To make the ΔdotN suicide plasmid,pJB3046, two PCR-amplified fragments were cloned into the NotI/SalIsites of pSR47S (40).Fragment 1 was amplified by using the primers5′-CCCGCGGCCGCGGTGTATCGTTAGGTAAAATGG(JVP289 with the NotI site underlined) and5′-CCCGGATCCCGCCATAGTTTGGTTCACATTCAGTC(JVP903 with the BamHI site underlined). Fragment 2 was amplified byusing the primers5′-CCCGGATCCGAGAAATGGGCTGCCAGTGC(JVP904 with the BamHI site underlined) and5′-CCCGTCGACGCAGCTTTTAACTGATCGC(JVP286 with the SalI site underlined).

To make theΔdotM suicide plasmid, pJB3050, two PCR-amplifiedfragments were cloned into the NotI/SalI sites of pSR47S(40). Fragment 1 wasamplified by using the primers5′-CCCGCGGCCGCGAAGCAATCTTCAGTCCTGG(JVP297 with the NotI site underlined) and5′-CCCGGATCCCTGCTGTTGTTGTGCCATCTC(JVP901 with the BamHI site underlined). Fragment 2 was amplified byusing the primers5′-CCCGGATCCGATGAAGCGATTAGAGCTCTGG(JVP902 with the BamHI site underlined) and5′-CCCGTCGACGCATACAGAGAGTTATCTCC(JVP294 with the SalI site underlined).

pJB1010, the His-taggedversion of DotL, was constructed by amplifying the dotL openreading frame (ORF) using plasmid pJB359 and the primers5′-GACATGCATGCGATGGGGTTGACTAATTAAGG(JVP217 with the SphI site underlined) and5′-GACATGCATGCCCCGAAAGCAAAAGTTGCC(JVP218 with the SphI site underlined). The PCR product was digestedwith SphI and cloned into the SphI site of pQE-32 (Qiagen). The finalconstruct can be used to express a fusion protein containing sixhistidines fused to amino acids 72 through 783 of DotL.

ThedotL complementing clone, pJB1014, was constructed by firstamplifying the dotL ORF from Lp02 chromosomal DNA by using theprimers5′-GGGGTACCGGAATTAGAGCCATGATGCG(JVP227 with the KpnI site underlined) and5′-GACATGCATGCGATGGGGTTGACTAATTAAGG(JVP217 with the SphI site underlined). The resulting product wasdigested with KpnI and SphI and ligated into KpnI/SphI-digestedpJB908. pJB908, a derivative of the plasmid pKB5, has thefollowing features: (i) an RSF1010 origin to permit replication inL. pneumophila, (ii) an ΔoriT mutation toprevent inhibition of growth in macrophages, and (iii) a tacpromoter driving DotL expression(3). Constitutiveexpression from pJB1014 is able to rescue a dotL deletionstrain for viability on plates and in macrophages and expresses similarlevels of DotL compared to a wild-type strain.

pJB1242, theΔlvhB suicide plasmid, was constructed by cloning twoPCR-amplified fragments into the SalI and NotI sites of pSR47S.Fragment 1 was amplified by using the primers5′-CCCGTCGACGTTTGGAGAAGTCAGTTTAAGG(JVP342 with the SalI site underlined) and5′-CCCGGATCCTCATGGCGCCACCTTTTGC(JVP343 with the BamHI site underlined). Fragment 2 was amplified withthe primers5′-CCCGGATCCGAAGCACTCGAACTATAAACC(JVP344 with the BamHI site underlined) and5′-CCCGCGGCCGCGTTTCGCCATTGTATCCC(JVP345 with the NotI site underlined).

pJB1304, containing thelvhB operon, was constructed by first amplifying thelvhB operon from JR32 chromosomal DNA by using the primers5′-CCCGTCGACGTTTGGAGAAGTCAGTTTAAGG(JVP342 with the SalI site underlined) and5′-CCCGCGGCCGCGTTTCGCCATTGTATCCC(JVP345 with the NotI site underlined). The resulting product wasdigested with SalI and NotI and ligated into SalI/NotI-digestedpJB1300. pJB1300, a derivative of the plasmid pKB5(3), has the HindIII sitein the polylinker replaced with a unique NotIsite.

pJB1010, a polyhistidine-taggedversion of DotL in which the amino-terminal signal sequence of DotL wasreplaced with six histidines, was purified by using Ni-nitrilotriaceticacid chromatography (Qiagen). The purified His₆-DotL fusionprotein was injected into rabbits to raise polyclonal antibodiesagainst DotL (Cocalico). The serum recognized a single protein fromwild-type L. pneumophila extracts that was absent in extractsfrom an E. coli strain and a L. pneumophila strainlacking the dotLgene.

L.pneumophila was fractionated as previously described(55). Briefly, a cultureof Lp02 was grown to mid-exponential phase, and the cells were pelletedand resuspended in 50 mM Tris-HCl (pH 8.0), 0.5 M sucrose, 5 mM EDTA,and 0.1 mg of lysozyme/ml. The cell suspension was incubated on ice for1 h, MgSO₄ was added to a final concentration of20 mM, and spheroplasts were collected by centrifugation at 5,000×g. The pellet was resuspended in 50 mM Tris-HCl (pH8.0), sonicated, and then centrifuged at 5,000 × g tocollect any unlysed cells. The supernatant was then centrifuged at100,000 × g for 1 h at 4°C to obtaina total membrane fraction. The supernatant was removed, centrifuged at100,000 × g, and saved as the cytoplasmic sample. Thepellet was washed and resuspended in 50 mM Tris-HCl (pH 8.0). The innermembranes were solubilized by the addition of Triton X-100, and theouter membranes were collected by centrifugation at 100,000 ×g. Fractions were resuspended in sodium dodecylsulfate-polyacrylamide gel electrophoresis loading buffer, subjected tosodium dodecyl sulfate-polyacrylamide gel electrophoresis, and eitherCoomassie blue stained for total protein or transferred to a membraneand probed with the anti-DotL serum(1:5,000).

The histiocytic cell line U937(American Type Culture Collection) was cultured in RPMI 1640 media(BioWhittaker) containing 10% fetal bovine serum (BioWhittaker).Cells were differentiated with12-O-tetradecanoylphorbol-13-acetate (TPA; Sigma) as describedpreviously (3).Differentiated U937 cells were plated as a confluent monolayer in24-well plates, with each well containing ca. 2 ×10⁶ cells per well.

L.pneumophila chromosomal DNA was isolated by a combination of ahigh-salt precipitation to eliminate contaminating proteins, followedby isopropanol precipitation of the DNA. Chromosomal DNA was digestedwith 10 U of HaeII restriction enzyme overnight at 37°C.Southern blots were performed according to the ECL Southernhybridization kit (Amersham), with probes specific to regions flankingdotL (from pJB1001) or dotB(pJB921).

L. pneumophila wasmutagenized by using the transposon delivery system encoded on pJK211-2(13). pJK211-2 contains atemperature-sensitive origin that is not permissive for replication at37°C, an altered sites transposase that increases therandomness of insertion, and a mini-Tn10 transposon containinga kanamycin cassette (KanR) and a conditional origin from plasmid R6Klater used to recover the transposon insertions in E. colistrain DH5α(λpir). A pool of insertions was placed onsucrose chloramphenicol plates to select for recombinants (sucrose toselect for recombinants and chloramphenicol to select for theΔdotL::Cm^r).Chloramphenicol-resistant (Cm^r), kanamycin-sensitive,sucrose-resistant (Suc^r) colonies were colony purified andscored for loss of the plasmid-encoded resistance cassette to ensurethey had resolved the integrated plasmid. Insertions were recovered aspreviously described(13). The site ofinsertion was identified by sequencing by using the primers JVP348(GGATCTGGTACCGGATCC) or JVP349(TCAACAGGTTGAACTGCGGATC).

Plasmids pJB1001 and pJB1005 weretransferred into L. pneumophila strains by using an RP4conjugation system encoded on pRK600(14). L.pneumophila strains containing the integrated plasmid wereselected by plating on CYET containing kanamycin and streptomycin.Resulting merodiploid strains that had a second crossover event wereselected by plating on CYET plates containing 5% sucrose.Resolution of the integrated plasmid was confirmed by loss of kanamycinresistance. In the case of strains containing theΔdotL::Cm^r cassette,sucrose-resistant colonies were streaked onto chloramphenicol to screenfor the wild-type or mutant dotLalleles.

L. pneumophila strains wereresuspended in phosphate-buffered saline to an optical density at 600nm of 1. The bacterial suspensions were then diluted 1:1,000 in RPMI1640 containing 10% fetal bovine serum, and 2 mM glutamine. Amonolayer of TPA-treated U937 cells were infected with various L.pneumophila strains at a multiplicity of infection of one for1 h. The monolayers were washed with fresh RPMI and thenincubated in RPMI 1640 containing 10% fetal bovine serum and 2mM glutamine at 37°C and 5% CO₂. Thymidinewas added when appropriate. At 1, 24, 48, and 72 hpostinfection, cells were lysed in sterile ddH₂O anddilutions were plated on CYET. Plates were incubated for 4 days at37°C, and viable counts weredetermined.

GenBank accession numbers forsubmitted sequences are as follows: DotU isAF533658and DotV isAF533657.

The L. pneumophila DotLprotein has extensive similarity to several proteins found in GenBank(Fig.1A), with the highest degree of similarity (56% identity) to anuncharacterized ORF found in Coxiella burnetii that has beenproposed to be part of a type IV secretion system(57). DotL also hassimilarity to TrbC (27% identity), a protein required for thetransfer of the IncI plasmids R64 and ColIb-P9 (Fig.1, top)(19,31), and to an ORF on aplasmid found in Pseudomonas syringae strains that may be partof the conjugative transfer apparatus for this plasmid(57). DotL also hassequence similarity, extending primarily over the Walker A box, tomembers of the type IV coupling protein family, most notably TraD,TraG, TrwB, and VirD4 (Fig.1A). In addition, DotLshares a number of characteristics with members of the T4CP family.These include a predicted size of 86 kDa, the presence of a potentialnucleotide binding motif (a Walker A box), and an amino-terminalhydrophobic sequence that would likely target the protein to thebacterial inner membrane(52,65). Thesecharacteristics, combined with its homology, suggest DotL may be aT4CP.

To confirm the subcellular localization of DotL, L.pneumophila extracts were prepared, fractionated, and the proteinwas detected by Western analysis with a DotL specific antibody. TheDotL protein was primarily localized to the membrane fraction (Fig.1B, lane 3). Moreover, themajority of the protein was Triton X-100 soluble, indicating it waslikely to be in the inner membrane of the bacterial cell (Fig.1B, lane 4)(48). In addition, asmaller cross-reacting species of ca. 75 kDa could be detected thatlocalized completely to the cytoplasmic fraction (Fig.1B, lane 2) and isconsistent with a DotL breakdown product lacking the hydrophobicamino-terminal transmembrane domains.

To investigate the function of the DotLprotein, we attempted to delete the dotL gene from thechromosome of Lp02, a strain of L. pneumophila with an intactdot/icm system(3,63). Previous attempts todelete dot/icm genes have been uniformly successful,indicating that the Dot/Icm complex is not required for viability onbacteriological media (1,3,63). To construct anin-frame deletion of the dotL gene, ca. 500 bp of DNA upstreamand downstream adjacent to the dotL gene was cloned into thesuicide vector pSR47S, generating plasmid pJB1001 (Fig.2). The dotL deletion plasmid was electroporated into strain Lp02and introduced onto the chromosome by selecting for a single crossoverevent generating a dotL/ΔdotL merodiploid strain.Merodiploids that had resolved were selected by plating on sucrose, atoxic compound for gram-negative organisms containing thecounterselectable marker sacB(4). Resolution of themerodiploid should result in an equal proportion of strains containingeither the wild-type copy of dotL or ΔdotL onthe chromosome (Fig.2).

Examination of14 independent sucrose resistant recombinants derived from thedotL/ΔdotL merodiploid strain revealed no strains thatlacked the wild-type copy of dotL (Fig.3, top panel). In contrast, sucrose resistant recombinants derived from asimilarly constructed dotB/ΔdotB merodiploid(55)re sulted in ten strains containing wild-type dotB and fourstrains containing ΔdotB (Fig.3, bottom panel). Toensure that the recombination event in the dotL/ΔdotLmerodiploid strain was not theoretically impossible, recombinants wereselected in a merodiploid containing thedotL⁺ plasmid pJB1014. In thissituation, chromosomal dotL deletions were recovered,indicating that a ΔdotL could be obtained in a strainexogenously expressing DotL (data shown below). Finally, theΔdotL::Cm^r reporterplasmid pJB1005 could not be introduced directly onto the chromosome ofthe L. pneumophila strain Lp02 by using natural transformation(56), confirming thedifficulty of constructing a dotL deletion. These resultsindicated a strong bias against deleting the wild-type version ofdotL and suggested that loss of dotL may result inlethality of L. pneumophila on bacteriologicalmedia.

Although it appeared not to be feasible to isolate astrain lacking dotL, it was possible that an insufficientnumber of events were examined in order to identify such a strain. Toscreen a larger number of recombination events, the deletion strategywas repeated with a chloramphenicol-marked version of the dotLdeletion. AdotL/ΔdotL::Cm^rmerodiploid was subjected to selection on sucrose, in the absence ofchloramphenicol, and the presence of theΔdotL::Cm^r cassette wassubsequently screened by plating sucrose resistant recombinants onmedium containing chloramphenicol. Examination of a larger number ofsucrose-resistant strains still failed to detect a recombinant thatcontained just theΔdotL::Cm^r allele (0 of753 events scored). Based on these results, we conclude thatdotL is required for the viability of the L.pneumophila strain Lp02 on bacteriologicalmedia.

Inorder to determine whether it was possible to suppress the lethalitycaused by loss of dotL, we plated an even greater number ofthe dotL/ΔdotL::Cm^rmerodiploid on plates containing sucrose and chloramphenicol, therebydirectly selecting for loss of dotL. Rare sucrose-resistant,chloramphenicol-resistant recombinants were isolated at a rate of∼10⁻⁶. This was consistent withdotL being an essential gene, with thechloramphenicol-resistant colonies that arose being pseudorevertantsdue to spontaneous mutations in other genes. To identify the nature ofthe pseudorevertants, random transposon insertions were generated inthe dotL/ΔdotL::Cm^rmerodiploid strain background by using a mini-Tn10 transposon,and the insertion pool was plated on sucrose and chloramphenicol toselect for strains that could tolerate loss of dotL.Thirty-three such insertions were isolated from independent pools.These strains were first analyzed by Southern blot to ensure that theyhad only one insertion. To confirm that the phenotype was linked to thetransposon insertion, the strains were recreated by transforming thetransposon and flanking chromosomal DNA into the original,unmutagenized merodiploid strain by using natural transformation(56). Examination of the33 strains by this assay demonstrated that, in each case, the phenotypewas linked to the transposon insertion. Finally, the transposons andflanking DNA were recovered on a plasmid, and the sites of thetransposon insertions on the L. pneumophila chromosome wereidentified by sequencing off the end of eachtransposon.

Surprisingly, approximately one-half of theinsertions (16 of 33) were in other dot/icm genes. Thisincluded four insertions in dotA, two in dotG, one indotI, five in dotO, three in icmF, and onein icmX (Fig.4). In most cases, the phenotype appeared to be due to inactivation of thegene the transposon was inserted in, because the insertions were interminal genes of proposed operons (e.g., dotA, dotO,icmF, and icmX). Among the insertions that were notin known dot/icm genes, three mutants (JV1308, JV1343, andJV1499) were defective for intracellular growth of L.pneumophila when the insertions were separated from theΔdotL (data not shown). The three mutants eachcontained an insertion in a different site of the same gene, which islocated ca. 20 kb from region II (Fig.4)(63). This gene codes fora small protein of 180 amino acids that has extensive homology to DotE(40% amino acid identity over 171 amino acids). We havedesignated this gene dotV because it is required for propertargeting of the L. pneumophila phagosome and forintracellular growth (unpublished results) (accession no.AF533657).Finally, the remaining insertions were not in known dot/icmgenes or homologous genes and, when separated from the dotLdeletion, caused the corresponding strains to exhibit various degreesof growth inhibition inside host cells (data notshown).

To confirm that loss of a specificdot gene could suppress a ΔdotL, we attemptedto delete dotL in a strain containing an in-frame deletion ofthe dotA gene. In contrast to the previous attempt to deletedotL (Fig. 3),both dotL and ΔdotL loopouts were obtainedfrom the ΔdotA dotL/ΔdotL merodiploid,demonstrating that loss of a single dot gene could allow theisolation of the ΔdotL mutation (Fig.5). Because the ΔdotL suppressor hunt identified only asubset of dot/icm genes, we investigated whether they were theonly dot/icm genes that, when inactivated, could suppress theΔdotL lethality. In-frame deletions were constructedin 23 of the 26 dot/icm genes, and the ΔdotLsuicide plasmid was integrated into each strain to assay for theability to tolerate loss of dotL. Remarkably, dotLcould be deleted in almost all of the strains containing differentdot/icm mutations (Fig.6). This suppression was specific in that dotL could not bedeleted in a strain lacking a housekeeping gene found in region II,citA, which is not required for intracellular growth (Fig.6)(42).

In contrast,inactivation of three dot/icm genes, dotK,icmS, and icmW, did not suppress loss ofdotL (Fig. 6).dotK encodes an outer membrane protein with homology to OmpAand is only partially required for growth in amoebae(53). icmS andicmW encode two small, acidic, cytoplasmic proteins that havebeen proposed to function as secretion chaperones(12). Similar todotK, icmS and icmW are not absolutelyrequired for the growth of L. pneumophila in permissive celllines such as U937s and HL60s(12,53). Therefore, it waspossible that inactivation of these genes failed to suppress loss ofdotL simply because they are not absolutely required forintracellular growth. However, inactivation of three otherdot/icm genes—icmF, dotU, andicmR—did suppress loss of dotL (Fig.6), even though loss ofthese genes caused only a partial inhibition of growth in permissivehosts (12,53,54,62,68). These resultsindicate that, although inactivation of the majority of thedot/icm genes can suppress the lethality caused by loss ofdotL, there is specificity to thesuppression.

dotL, also known asicmO, is essential for viability in the Lp02 background.However, it has been previously published that loss of dotL inanother L. pneumophila strain, JR32, is not a lethal event(52). Lp02 and JR32 wereindependently derived from L. pneumophila Philadelphia-1, anorganism isolated from the original Legionnaires' disease outbreakin 1976 (3,38). Each strain wasindividually selected to be streptomycin resistant and to lack hostrestriction, and Lp02 was then also selected to be a thymidineauxotroph. Due to the relatedness of these two strains, it wassurprising that dotL/icmO was essential for viability in Lp02but was dispensable in JR32. To confirm that dotL was not anessential gene in JR32, a clean ΔdotL was constructedin the JR32 background and was indeed found to be viable on bufferedCYE plates (data not shown). To examine intracellular growth,monolayers of U937 macrophages were challenged with wild-type L.pneumophila strains Lp02 and JR32. Both strains were able tomultiply >1,000-fold in 3 days (Fig.7). In contrast, an Lp02 strain lacking a functional dotA gene,Lp03, was unable to replicate inside macrophages. As previously shown,deletion of dotL in JR32 prevented the strain from replicatingin U937 macrophages, and this defect could be complemented by theaddition of a plasmid containingdotL⁺ (Fig.7)(52).

Although theJR32 ΔdotL strain was viable, closer examinationrevealed that it displayed a key difference from other dot/icmmutants (Table2). Wild-type L. pneumophila stains, such as Lp02 and JR32,exhibit a significantly decreased plating efficiency on buffered CYEplates containing a low amount of sodium chloride (0.65%)compared to growth on plates lacking sodium chloride(11,45,64). Mostdot/icm deletions (e.g., ΔdotA) exhibit anincreased plating efficiency on plates supplemented with salt (Table2). However, the JR32ΔdotL strain was even more sensitive to sodiumchloride than JR32 (Table2), suggesting that thephysiology of the JR32 ΔdotL is perturbed. These datasuggest that loss of dotL in either the Lp02 strain or theJR32 strain is detrimental to thecell.

Since the sequences of thedot/icm genes are identical between Lp02 and JR32, it islikely that there is an additional genetic difference between the twostrains responsible for the more severe effect of deletingdotL in Lp02. For example, a gene may have been inactivated orlost during the derivation of JR32 that allows the JR32ΔdotL strain to survive. Alternatively, a gene may beabsent in Lp02 that is normally able to suppress the lethality causedby loss of dotL. In fact, a number of differences have beenreported between various L. pneumophila serogroup I isolatesincluding Lp01, the progenitor strain of Lp02, and JR32 (Table1)(6,36,47). One potentialcandidate is lvhD4, which is present in JR32 but not in Lp01(47). lvhD4 isencoded in the lvhB1-11/lvhD operon and is a component of asecond type IV secretion system found in L. pneumophilastrains such as JR32(51). lvhD4encodes a protein with similarity to T4CPs, most specifically to theA. tumefaciens VirD4(51), and could in theoryfunctionally substitute for DotL.

To confirm that the JR32 andLp02 isolates we were working with contained and lacked lvhD4,respectively, we performed Southern analysis with a probe specific tolvhD4 (Fig.8, top). Consistent with previous reports, Lp01 and Lp02 lackedlvhD4, whereas JR32 and Philadelphia-1, the progenitor strainfor both Lp02 and JR32, both contained it (Fig.8A). Lp01 and Lp02 mayhave lost the lvhB-lvhD region during their derivation tobecome restriction minus, since a number of restriction or modificationgenes are located adjacent to the lvhB/lvhD4 system(47). To determinewhether there was a connection between the presence of lvhD4and ΔdotL lethality, we deleted lvhD4 fromJR32 or added it back to Lp02 and then assayed the consequence ofdeleting dotL. dotL could still be deleted in a JR32strain lacking the lvhB-lvhD4 region, indicating thatlvhD4 was not responsible for the viability of the JR32ΔdotL strain (Fig.8B). Likewise, theaddition of the lvhB-lvhD4 region from JR32to the Lp02 strain did not suppress loss of dotL. Therefore,lvhD4 does not appear to be responsible for the alteredrequirements of dotL in these two L. pneumophilastrains.

In addition to the dot/icm and thelvhB systems, certain L. pneumophila strains containan additional type IV secretion system(6). This system isencoded in an ca. 65-kb locus, LpPI-1, that bears the hallmarks of apathogenicity island. It contains homologues to a type IV secretionsystem that resembles the F plasmid, including a T4CP that resemblesthe F plasmid TraD protein, mobile genetic elements, and severalputative virulence factors(6). In contrast tolvhD4, LpPI-1 is present in Lp02 but is absent from JR32.However, deletion of the TraD-like protein from Lp02 did not suppressthe lethality caused by loss of dotL (C. Vincent andJ. P. Vogel, unpublished data). Thus, some additional,as-yet-uncharacterized, mutation must exist in one of these strainsthat is responsible for the differential requirement of dotLfor viability.

Whileconstructing a collection of dot/icm deletions, we were ableto generate in-frame deletions in 23 of the 26 known dot/icmgenes. However, similar to the dotL deletion, we could notconstruct a deletion in dotM, the gene upstream ofdotL (Table3). dotM, also known as icmP, codes for a predictedinner membrane protein with similarity to TrbA of the IncI plasmids R64and ColIb-P9 (24% amino acid identity). Since dotL anddotM are likely to be cotranscribed in a two gene operon,dotML, it was possible that the lethality of the dotMdeletion was due solely to polarity on the downstream dotLgene (Fig. 4). However,the ΔdotM mutation could not be obtained in thepresence of a complementing clone containing a wild-type version ofdotL, suggesting that the dotM lethality was not dueto polarity but reflected the essentiality of dotM (Table3). Moreover, insertionsin dotM were obtained in a screen for genes that resembledotL, i.e., genes that are essential in the presence of afunctional Dot/Icm complex(13).

A third gene,dotN, also proved difficult to delete from the L.pneumophila chromosome. dotN, also known asicmJ, is located ca. 12 kb downstream of the proposeddotML operon and is the first gene of another predictedoperon, dotNO (Fig.4). dotN codesfor a small protein of 208 amino acids that contains a high proportionof cysteines (4.3%). The lethality of the ΔdotNcould not be due to simple polarity on the downstream genedotO because deletions could easily be made in thedotO gene. Similar to dotL, both dotM anddotN could each be deleted in strains lacking a functionaldot complex (Table3). These results indicatethat three dot genes, dotL, dotM, anddotN are each essential for viability on bacteriological mediain the Lp02 background and in each case, the lethality can besuppressed by inactivation of the Dot/Icmcomplex.