Research Article
01 May 2005

The DotL Protein, a Member of the TraG-Coupling Protein Family, Is Essential for Viability of Legionella pneumophila Strain Lp02

ABSTRACT

Legionellapneumophila is able to survive inside phagocytic cells by aninternalization route that bypasses fusion of the nascent phagosomewith the endocytic pathway to allow formation of a replicativephagosome. The dot/icm genes, a major virulence system ofL. pneumophila, encode a type IVB secretion system that isrequired for intracellular growth. One Dot protein, DotL, has sequencesimilarity to type IV secretion system coupling proteins (T4CPs). Inother systems, coupling proteins are not required for viability of theorganism. Here we report the first example of a strain, L.pneumophila Lp02, in which a putative T4CP is essential forviability of the organism on bacteriological media. This result isparticularly surprising since the majority of the dot/icmgenes in Lp02 are dispensable for growth outside of a host cell, acondition that does not require a functional Dot/Icm secretion complex.We were able to isolate suppressors of the ΔdotLlethality and found that many contained mutations in other componentsof the Dot/Icm secretion system. A systematic analysis ofdot/icm deletion mutants revealed that the majority of them(20 of 26) suppressed the lethality phenotype, indicating a partiallyassembled secretion system may be the source of ΔdotLtoxicity in the wild-type strain. These results are consistent with amodel in which the DotL protein plays a role in regulating the activityof the L. pneumophila type IV secretionapparatus.
The gram-negative bacterium Legionella pneumophila is thecausative agent of a potentially fatal form of pneumonia calledLegionnaires' disease. L. pneumophila is found infreshwater environments, where it parasitizes many different species ofprotozoa (17). Humansbecome infected with L. pneumophila by inhaling aerosolsgenerated from contaminated water sources. Upon entry into the humanlung, L. pneumophila is internalized into bactericidal,alveolar macrophages. In contrast to phagosomes bearing most bacterialspecies, the compartment harboring L. pneumophila does nottraffic into the lysosomal network and is not significantly acidifiedin the first few hours after uptake(26,27). Instead, thephagosome interacts with early secretory vesicles at endoplasmicreticulum exit sites (29)and then undergoes a series of maturation events in which itsequentially associates with small vesicles, mitochondria, andeventually becomes surrounded by the rough endoplasmic reticulum(25,60). Formation of thisspecialized compartment, called a “replicativephagosome,” allows the microorganism to grow intracellularly(25,28). Later in theinfective cycle, a majority of the replicative phagosomes fuse withacidified compartments containing late endocytic markers, and this isbelieved to play an important role in the replicative cycle of thispathogen prior to exit from its host cell(59).
The key toL. pneumophila's virulence is its ability to form areplicative phagosome, since mutants defective in this trait cannotreplicate inside host cells and are thus unable to cause disease(24,26). One large class ofproteins that allow L. pneumophila to alter the endocyticpathway is encoded by the dot/icm genes(3,5,37). To date, over twodozen dot/icm genes have been identified and are clustered intwo areas of the L. pneumophila chromosome (region I andregion II) (63). Based onthe similarity of the Dot/Icm proteins to proteins involved inconjugative DNA transfer, and the fact that the Dot/Icm system cantransfer the mobilizeable plasmid RSF1010, it was proposed that thedot/icm genes of L. pneumophila encode a type IVsecretion system (31,50,63).
Type IVsecretion systems are able to export DNA and/or proteins out of thebacterial cell and include plasmid transfer systems (e.g., thetra and trb genes of the plasmid RP4), as well assystems involved in the delivery of virulence factors(10,46,66). The canonical typeIV secretion system is encoded by the virB operon of the plantpathogen Agrobacterium tumefaciens(66). A number of otherpathogens, including Bartonella tribocorum, Bordetellapertussis, Brucella abortus, Helicobacterpylori, and Rickettsia prowazekii, contain orthologues tothe VirB proteins, and some of these systems have been shown to exportproteins essential for virulence(10). In contrast tothese type IV systems, the L. pneumophila Dot/Icm proteinshave limited sequence similarity to the VirB proteins. Instead, theDot/Icm proteins show high similarity to the transfer proteins fromIncI plasmids (e.g., R64 and ColIb-P9) and compose a type IVB secretionsystem (31,57).
As with mostconjugative transfer systems, little is known about the specificfunction of many of the L. pneumophila Dot/Icm proteins. DotBwas recently shown to possess ATPase activity and likely providesenergy to the secretion apparatus(56). A second Dotprotein, DotL, also contains a nucleotide binding motif and showsextensive sequence similarity to the conjugal transfer protein TrbCfrom IncI plasmids (19,31). DotL also hasdetectable sequence similarity to a family of proposed ATPases known asTraG-like or type IV secretion system coupling proteins (T4CPs). Themore notable members of the T4CP family include TraG (RP4 plasmid),TrwB (R388 plasmid), TraD (F plasmid), and the A. tumefaciensVirD4 protein (8,18,33).
The term“coupling protein” was proposed for this family becauseits members are believed to target, or couple, exported substrates tothe secretion apparatus(8,9,15,22,23,32,61). This proposal wasinitially based on the phenotype of RP4 traG mutants, whichwere still able to process plasmid DNA into a secretion-competentintermediate and assemble a functional pilus but were unable totransfer the plasmid. This indicated that TraG plays a role in linkingthe two processes (9).Consistent with the idea of T4CPs linking substrates to the secretionapparatus, a number of T4CPs have been shown to interact with bothexported substrates and with components of the secretion apparatus(2,15,20,35,61). Although T4CPs areabsolutely required for export of substrates, their specific molecularfunction remains unknown(22).
Wedemonstrate here that a T4CP homologue, the DotL protein, is not onlyrequired for growth of L. pneumophila inside macrophages butis also essential for viability of certain strains on bacteriologicalmedia. The lethality caused by loss of dotL in those strainscan be suppressed by mutations that inactivate the Dot/Icm complex,which is consistent with a DotL role in regulating the activity of thistype IV secreton.

MATERIALS ANDMETHODS

Bacterial strains andmedia.

All L.pneumophila strains used in the present study are derived fromLp02 (hsdR rpsL thyA) or JR32 (hsdR rpsL), twoseparate isolates of L. pneumophila Philadelphia-1(3,7,38) (Table1). L. pneumophila strains were cultured onN-(2-acetamido)-2-aminoethanesulfonic acid (ACES)-bufferedcharcoal yeast extract agar (CYET) or ACES-buffered yeast extract broth(AYET) supplemented with thymidine (100 μg/ml). Saltsensitivity was assayed on CYET plates containing0.65% sodium chloride(11,45,64). Antibiotics(kanamycin, 20 μg/ml; chloramphenicol, 5 μg/ml;streptomycin, 50 μg/ml; gentamicin, 5 μg/ml) andsucrose (5%) were added as needed. Escherichia colistrains were cultured on Luria-Bertani medium, and antibiotics(kanamycin, 20 μg/ml; ampicillin, 100 μg/ml;chloramphenicol, 17 μg/ml) were added as needed.Replication-competent plasmids were propagated in the E. colistrain XL1-Blue. In order to propagate suicide plasmids containing theR6K origin of replication, a strain expressing the R6K πprotein, E. coli strain DH5α(λpir),was used (30,67).

Plasmidconstruction.

To make theΔdotL suicide plasmid, pJB1001, two PCR-amplifiedfragments were cloned into the NotI/SalI sites of pSR47S(40). Fragment 1 wasamplified by using the primers5′-CCCAAACGGCCGCCAAACGAGTATTTACCATGC(JVP201 with the EagI site underlined) and5′-CCCAAAGGATCCCGCATCATGGCTCTAATTCC(JVP202 with the BamHI site underlined). Fragment 2 was amplified byusing the primers5′-CCCAAAGGATCCGCTATTGGGCATGAAGAGAGC(JVP203 with the BamHI site underlined) and5′-CCCAAAGTCGACCCTACTGATGCAACTTTAATCC(JVP204 with the SalI site underlined). Plasmid pJB1005 was constructedby inserting a gene encoding chloramphenicol acetyltransferase that wasamplified from pKRP10 by using the primers5′-CCCAAAGGATCCGAGGTTCCAACTTTCACC(JVP206 with the BamHI site underlined) and5′-CCCAAAGGATCCCTGCCTTAAAAAAATTACGC(JVP207 with the BamHI site underlined) into the BamHI site of plasmidpJB1001.
To make the ΔdotN suicide plasmid,pJB3046, two PCR-amplified fragments were cloned into the NotI/SalIsites of pSR47S (40).Fragment 1 was amplified by using the primers5′-CCCGCGGCCGCGGTGTATCGTTAGGTAAAATGG(JVP289 with the NotI site underlined) and5′-CCCGGATCCCGCCATAGTTTGGTTCACATTCAGTC(JVP903 with the BamHI site underlined). Fragment 2 was amplified byusing the primers5′-CCCGGATCCGAGAAATGGGCTGCCAGTGC(JVP904 with the BamHI site underlined) and5′-CCCGTCGACGCAGCTTTTAACTGATCGC(JVP286 with the SalI site underlined).
To make theΔdotM suicide plasmid, pJB3050, two PCR-amplifiedfragments were cloned into the NotI/SalI sites of pSR47S(40). Fragment 1 wasamplified by using the primers5′-CCCGCGGCCGCGAAGCAATCTTCAGTCCTGG(JVP297 with the NotI site underlined) and5′-CCCGGATCCCTGCTGTTGTTGTGCCATCTC(JVP901 with the BamHI site underlined). Fragment 2 was amplified byusing the primers5′-CCCGGATCCGATGAAGCGATTAGAGCTCTGG(JVP902 with the BamHI site underlined) and5′-CCCGTCGACGCATACAGAGAGTTATCTCC(JVP294 with the SalI site underlined).
pJB1010, the His-taggedversion of DotL, was constructed by amplifying the dotL openreading frame (ORF) using plasmid pJB359 and the primers5′-GACATGCATGCGATGGGGTTGACTAATTAAGG(JVP217 with the SphI site underlined) and5′-GACATGCATGCCCCGAAAGCAAAAGTTGCC(JVP218 with the SphI site underlined). The PCR product was digestedwith SphI and cloned into the SphI site of pQE-32 (Qiagen). The finalconstruct can be used to express a fusion protein containing sixhistidines fused to amino acids 72 through 783 of DotL.
ThedotL complementing clone, pJB1014, was constructed by firstamplifying the dotL ORF from Lp02 chromosomal DNA by using theprimers5′-GGGGTACCGGAATTAGAGCCATGATGCG(JVP227 with the KpnI site underlined) and5′-GACATGCATGCGATGGGGTTGACTAATTAAGG(JVP217 with the SphI site underlined). The resulting product wasdigested with KpnI and SphI and ligated into KpnI/SphI-digestedpJB908. pJB908, a derivative of the plasmid pKB5, has thefollowing features: (i) an RSF1010 origin to permit replication inL. pneumophila, (ii) an ΔoriT mutation toprevent inhibition of growth in macrophages, and (iii) a tacpromoter driving DotL expression(3). Constitutiveexpression from pJB1014 is able to rescue a dotL deletionstrain for viability on plates and in macrophages and expresses similarlevels of DotL compared to a wild-type strain.
pJB1242, theΔlvhB suicide plasmid, was constructed by cloning twoPCR-amplified fragments into the SalI and NotI sites of pSR47S.Fragment 1 was amplified by using the primers5′-CCCGTCGACGTTTGGAGAAGTCAGTTTAAGG(JVP342 with the SalI site underlined) and5′-CCCGGATCCTCATGGCGCCACCTTTTGC(JVP343 with the BamHI site underlined). Fragment 2 was amplified withthe primers5′-CCCGGATCCGAAGCACTCGAACTATAAACC(JVP344 with the BamHI site underlined) and5′-CCCGCGGCCGCGTTTCGCCATTGTATCCC(JVP345 with the NotI site underlined).
pJB1304, containing thelvhB operon, was constructed by first amplifying thelvhB operon from JR32 chromosomal DNA by using the primers5′-CCCGTCGACGTTTGGAGAAGTCAGTTTAAGG(JVP342 with the SalI site underlined) and5′-CCCGCGGCCGCGTTTCGCCATTGTATCCC(JVP345 with the NotI site underlined). The resulting product wasdigested with SalI and NotI and ligated into SalI/NotI-digestedpJB1300. pJB1300, a derivative of the plasmid pKB5(3), has the HindIII sitein the polylinker replaced with a unique NotIsite.

Antibody production.

pJB1010, a polyhistidine-taggedversion of DotL in which the amino-terminal signal sequence of DotL wasreplaced with six histidines, was purified by using Ni-nitrilotriaceticacid chromatography (Qiagen). The purified His6-DotL fusionprotein was injected into rabbits to raise polyclonal antibodiesagainst DotL (Cocalico). The serum recognized a single protein fromwild-type L. pneumophila extracts that was absent in extractsfrom an E. coli strain and a L. pneumophila strainlacking the dotLgene.

Fractionation and Westernanalysis.

L.pneumophila was fractionated as previously described(55). Briefly, a cultureof Lp02 was grown to mid-exponential phase, and the cells were pelletedand resuspended in 50 mM Tris-HCl (pH 8.0), 0.5 M sucrose, 5 mM EDTA,and 0.1 mg of lysozyme/ml. The cell suspension was incubated on ice for1 h, MgSO4 was added to a final concentration of20 mM, and spheroplasts were collected by centrifugation at 5,000×g. The pellet was resuspended in 50 mM Tris-HCl (pH8.0), sonicated, and then centrifuged at 5,000 × g tocollect any unlysed cells. The supernatant was then centrifuged at100,000 × g for 1 h at 4°C to obtaina total membrane fraction. The supernatant was removed, centrifuged at100,000 × g, and saved as the cytoplasmic sample. Thepellet was washed and resuspended in 50 mM Tris-HCl (pH 8.0). The innermembranes were solubilized by the addition of Triton X-100, and theouter membranes were collected by centrifugation at 100,000 ×g. Fractions were resuspended in sodium dodecylsulfate-polyacrylamide gel electrophoresis loading buffer, subjected tosodium dodecyl sulfate-polyacrylamide gel electrophoresis, and eitherCoomassie blue stained for total protein or transferred to a membraneand probed with the anti-DotL serum(1:5,000).

Cell culture.

The histiocytic cell line U937(American Type Culture Collection) was cultured in RPMI 1640 media(BioWhittaker) containing 10% fetal bovine serum (BioWhittaker).Cells were differentiated with12-O-tetradecanoylphorbol-13-acetate (TPA; Sigma) as describedpreviously (3).Differentiated U937 cells were plated as a confluent monolayer in24-well plates, with each well containing ca. 2 ×106 cells per well.

Southernblot analysis.

L.pneumophila chromosomal DNA was isolated by a combination of ahigh-salt precipitation to eliminate contaminating proteins, followedby isopropanol precipitation of the DNA. Chromosomal DNA was digestedwith 10 U of HaeII restriction enzyme overnight at 37°C.Southern blots were performed according to the ECL Southernhybridization kit (Amersham), with probes specific to regions flankingdotL (from pJB1001) or dotB(pJB921).

Transposon mutagenesis ofL. pneumophila.

L. pneumophila wasmutagenized by using the transposon delivery system encoded on pJK211-2(13). pJK211-2 contains atemperature-sensitive origin that is not permissive for replication at37°C, an altered sites transposase that increases therandomness of insertion, and a mini-Tn10 transposon containinga kanamycin cassette (KanR) and a conditional origin from plasmid R6Klater used to recover the transposon insertions in E. colistrain DH5α(λpir). A pool of insertions was placed onsucrose chloramphenicol plates to select for recombinants (sucrose toselect for recombinants and chloramphenicol to select for theΔdotL::Cmr).Chloramphenicol-resistant (Cmr), kanamycin-sensitive,sucrose-resistant (Sucr) colonies were colony purified andscored for loss of the plasmid-encoded resistance cassette to ensurethey had resolved the integrated plasmid. Insertions were recovered aspreviously described(13). The site ofinsertion was identified by sequencing by using the primers JVP348(GGATCTGGTACCGGATCC) or JVP349(TCAACAGGTTGAACTGCGGATC).

Screenfor suppression of the ΔdotL lethality.

Plasmids pJB1001 and pJB1005 weretransferred into L. pneumophila strains by using an RP4conjugation system encoded on pRK600(14). L.pneumophila strains containing the integrated plasmid wereselected by plating on CYET containing kanamycin and streptomycin.Resulting merodiploid strains that had a second crossover event wereselected by plating on CYET plates containing 5% sucrose.Resolution of the integrated plasmid was confirmed by loss of kanamycinresistance. In the case of strains containing theΔdotL::Cmr cassette,sucrose-resistant colonies were streaked onto chloramphenicol to screenfor the wild-type or mutant dotLalleles.

Replication of L.pneumophila strains in U937 cells.

L. pneumophila strains wereresuspended in phosphate-buffered saline to an optical density at 600nm of 1. The bacterial suspensions were then diluted 1:1,000 in RPMI1640 containing 10% fetal bovine serum, and 2 mM glutamine. Amonolayer of TPA-treated U937 cells were infected with various L.pneumophila strains at a multiplicity of infection of one for1 h. The monolayers were washed with fresh RPMI and thenincubated in RPMI 1640 containing 10% fetal bovine serum and 2mM glutamine at 37°C and 5% CO2. Thymidinewas added when appropriate. At 1, 24, 48, and 72 hpostinfection, cells were lysed in sterile ddH2O anddilutions were plated on CYET. Plates were incubated for 4 days at37°C, and viable counts weredetermined.

Accession numbers.

GenBank accession numbers forsubmitted sequences are as follows: DotU isAF533658and DotV isAF533657.

RESULTS

DotLis an inner membrane protein with homology to T4CPs.

The L. pneumophila DotLprotein has extensive similarity to several proteins found in GenBank(Fig.1A), with the highest degree of similarity (56% identity) to anuncharacterized ORF found in Coxiella burnetii that has beenproposed to be part of a type IV secretion system(57). DotL also hassimilarity to TrbC (27% identity), a protein required for thetransfer of the IncI plasmids R64 and ColIb-P9 (Fig.1, top)(19,31), and to an ORF on aplasmid found in Pseudomonas syringae strains that may be partof the conjugative transfer apparatus for this plasmid(57). DotL also hassequence similarity, extending primarily over the Walker A box, tomembers of the type IV coupling protein family, most notably TraD,TraG, TrwB, and VirD4 (Fig.1A). In addition, DotLshares a number of characteristics with members of the T4CP family.These include a predicted size of 86 kDa, the presence of a potentialnucleotide binding motif (a Walker A box), and an amino-terminalhydrophobic sequence that would likely target the protein to thebacterial inner membrane(52,65). Thesecharacteristics, combined with its homology, suggest DotL may be aT4CP.
To confirm the subcellular localization of DotL, L.pneumophila extracts were prepared, fractionated, and the proteinwas detected by Western analysis with a DotL specific antibody. TheDotL protein was primarily localized to the membrane fraction (Fig.1B, lane 3). Moreover, themajority of the protein was Triton X-100 soluble, indicating it waslikely to be in the inner membrane of the bacterial cell (Fig.1B, lane 4)(48). In addition, asmaller cross-reacting species of ca. 75 kDa could be detected thatlocalized completely to the cytoplasmic fraction (Fig.1B, lane 2) and isconsistent with a DotL breakdown product lacking the hydrophobicamino-terminal transmembrane domains.

DotLis essential for viability on bacteriological media.

To investigate the function of the DotLprotein, we attempted to delete the dotL gene from thechromosome of Lp02, a strain of L. pneumophila with an intactdot/icm system(3,63). Previous attempts todelete dot/icm genes have been uniformly successful,indicating that the Dot/Icm complex is not required for viability onbacteriological media (1,3,63). To construct anin-frame deletion of the dotL gene, ca. 500 bp of DNA upstreamand downstream adjacent to the dotL gene was cloned into thesuicide vector pSR47S, generating plasmid pJB1001 (Fig.2). The dotL deletion plasmid was electroporated into strain Lp02and introduced onto the chromosome by selecting for a single crossoverevent generating a dotL/ΔdotL merodiploid strain.Merodiploids that had resolved were selected by plating on sucrose, atoxic compound for gram-negative organisms containing thecounterselectable marker sacB(4). Resolution of themerodiploid should result in an equal proportion of strains containingeither the wild-type copy of dotL or ΔdotL onthe chromosome (Fig.2).
Examination of14 independent sucrose resistant recombinants derived from thedotL/ΔdotL merodiploid strain revealed no strains thatlacked the wild-type copy of dotL (Fig.3, top panel). In contrast, sucrose resistant recombinants derived from asimilarly constructed dotB/ΔdotB merodiploid(55)re sulted in ten strains containing wild-type dotB and fourstrains containing ΔdotB (Fig.3, bottom panel). Toensure that the recombination event in the dotL/ΔdotLmerodiploid strain was not theoretically impossible, recombinants wereselected in a merodiploid containing thedotL+ plasmid pJB1014. In thissituation, chromosomal dotL deletions were recovered,indicating that a ΔdotL could be obtained in a strainexogenously expressing DotL (data shown below). Finally, theΔdotL::Cmr reporterplasmid pJB1005 could not be introduced directly onto the chromosome ofthe L. pneumophila strain Lp02 by using natural transformation(56), confirming thedifficulty of constructing a dotL deletion. These resultsindicated a strong bias against deleting the wild-type version ofdotL and suggested that loss of dotL may result inlethality of L. pneumophila on bacteriologicalmedia.
Although it appeared not to be feasible to isolate astrain lacking dotL, it was possible that an insufficientnumber of events were examined in order to identify such a strain. Toscreen a larger number of recombination events, the deletion strategywas repeated with a chloramphenicol-marked version of the dotLdeletion. AdotL/ΔdotL::Cmrmerodiploid was subjected to selection on sucrose, in the absence ofchloramphenicol, and the presence of theΔdotL::Cmr cassette wassubsequently screened by plating sucrose resistant recombinants onmedium containing chloramphenicol. Examination of a larger number ofsucrose-resistant strains still failed to detect a recombinant thatcontained just theΔdotL::Cmr allele (0 of753 events scored). Based on these results, we conclude thatdotL is required for the viability of the L.pneumophila strain Lp02 on bacteriologicalmedia.

Isolation of suppressors ofΔdotL.

Inorder to determine whether it was possible to suppress the lethalitycaused by loss of dotL, we plated an even greater number ofthe dotL/ΔdotL::Cmrmerodiploid on plates containing sucrose and chloramphenicol, therebydirectly selecting for loss of dotL. Rare sucrose-resistant,chloramphenicol-resistant recombinants were isolated at a rate of∼10−6. This was consistent withdotL being an essential gene, with thechloramphenicol-resistant colonies that arose being pseudorevertantsdue to spontaneous mutations in other genes. To identify the nature ofthe pseudorevertants, random transposon insertions were generated inthe dotL/ΔdotL::Cmrmerodiploid strain background by using a mini-Tn10 transposon,and the insertion pool was plated on sucrose and chloramphenicol toselect for strains that could tolerate loss of dotL.Thirty-three such insertions were isolated from independent pools.These strains were first analyzed by Southern blot to ensure that theyhad only one insertion. To confirm that the phenotype was linked to thetransposon insertion, the strains were recreated by transforming thetransposon and flanking chromosomal DNA into the original,unmutagenized merodiploid strain by using natural transformation(56). Examination of the33 strains by this assay demonstrated that, in each case, the phenotypewas linked to the transposon insertion. Finally, the transposons andflanking DNA were recovered on a plasmid, and the sites of thetransposon insertions on the L. pneumophila chromosome wereidentified by sequencing off the end of eachtransposon.
Surprisingly, approximately one-half of theinsertions (16 of 33) were in other dot/icm genes. Thisincluded four insertions in dotA, two in dotG, one indotI, five in dotO, three in icmF, and onein icmX (Fig.4). In most cases, the phenotype appeared to be due to inactivation of thegene the transposon was inserted in, because the insertions were interminal genes of proposed operons (e.g., dotA, dotO,icmF, and icmX). Among the insertions that were notin known dot/icm genes, three mutants (JV1308, JV1343, andJV1499) were defective for intracellular growth of L.pneumophila when the insertions were separated from theΔdotL (data not shown). The three mutants eachcontained an insertion in a different site of the same gene, which islocated ca. 20 kb from region II (Fig.4)(63). This gene codes fora small protein of 180 amino acids that has extensive homology to DotE(40% amino acid identity over 171 amino acids). We havedesignated this gene dotV because it is required for propertargeting of the L. pneumophila phagosome and forintracellular growth (unpublished results) (accession no.AF533657).Finally, the remaining insertions were not in known dot/icmgenes or homologous genes and, when separated from the dotLdeletion, caused the corresponding strains to exhibit various degreesof growth inhibition inside host cells (data notshown).

Other dot/icm mutationssuppress loss of dotL.

To confirm that loss of a specificdot gene could suppress a ΔdotL, we attemptedto delete dotL in a strain containing an in-frame deletion ofthe dotA gene. In contrast to the previous attempt to deletedotL (Fig. 3),both dotL and ΔdotL loopouts were obtainedfrom the ΔdotA dotL/ΔdotL merodiploid,demonstrating that loss of a single dot gene could allow theisolation of the ΔdotL mutation (Fig.5). Because the ΔdotL suppressor hunt identified only asubset of dot/icm genes, we investigated whether they were theonly dot/icm genes that, when inactivated, could suppress theΔdotL lethality. In-frame deletions were constructedin 23 of the 26 dot/icm genes, and the ΔdotLsuicide plasmid was integrated into each strain to assay for theability to tolerate loss of dotL. Remarkably, dotLcould be deleted in almost all of the strains containing differentdot/icm mutations (Fig.6). This suppression was specific in that dotL could not bedeleted in a strain lacking a housekeeping gene found in region II,citA, which is not required for intracellular growth (Fig.6)(42).
In contrast,inactivation of three dot/icm genes, dotK,icmS, and icmW, did not suppress loss ofdotL (Fig. 6).dotK encodes an outer membrane protein with homology to OmpAand is only partially required for growth in amoebae(53). icmS andicmW encode two small, acidic, cytoplasmic proteins that havebeen proposed to function as secretion chaperones(12). Similar todotK, icmS and icmW are not absolutelyrequired for the growth of L. pneumophila in permissive celllines such as U937s and HL60s(12,53). Therefore, it waspossible that inactivation of these genes failed to suppress loss ofdotL simply because they are not absolutely required forintracellular growth. However, inactivation of three otherdot/icm genes—icmF, dotU, andicmR—did suppress loss of dotL (Fig.6), even though loss ofthese genes caused only a partial inhibition of growth in permissivehosts (12,53,54,62,68). These resultsindicate that, although inactivation of the majority of thedot/icm genes can suppress the lethality caused by loss ofdotL, there is specificity to thesuppression.

dotL is notessential in all L. pneumophila strain backgrounds.

dotL, also known asicmO, is essential for viability in the Lp02 background.However, it has been previously published that loss of dotL inanother L. pneumophila strain, JR32, is not a lethal event(52). Lp02 and JR32 wereindependently derived from L. pneumophila Philadelphia-1, anorganism isolated from the original Legionnaires' disease outbreakin 1976 (3,38). Each strain wasindividually selected to be streptomycin resistant and to lack hostrestriction, and Lp02 was then also selected to be a thymidineauxotroph. Due to the relatedness of these two strains, it wassurprising that dotL/icmO was essential for viability in Lp02but was dispensable in JR32. To confirm that dotL was not anessential gene in JR32, a clean ΔdotL was constructedin the JR32 background and was indeed found to be viable on bufferedCYE plates (data not shown). To examine intracellular growth,monolayers of U937 macrophages were challenged with wild-type L.pneumophila strains Lp02 and JR32. Both strains were able tomultiply >1,000-fold in 3 days (Fig.7). In contrast, an Lp02 strain lacking a functional dotA gene,Lp03, was unable to replicate inside macrophages. As previously shown,deletion of dotL in JR32 prevented the strain from replicatingin U937 macrophages, and this defect could be complemented by theaddition of a plasmid containingdotL+ (Fig.7)(52).
Although theJR32 ΔdotL strain was viable, closer examinationrevealed that it displayed a key difference from other dot/icmmutants (Table2). Wild-type L. pneumophila stains, such as Lp02 and JR32,exhibit a significantly decreased plating efficiency on buffered CYEplates containing a low amount of sodium chloride (0.65%)compared to growth on plates lacking sodium chloride(11,45,64). Mostdot/icm deletions (e.g., ΔdotA) exhibit anincreased plating efficiency on plates supplemented with salt (Table2). However, the JR32ΔdotL strain was even more sensitive to sodiumchloride than JR32 (Table2), suggesting that thephysiology of the JR32 ΔdotL is perturbed. These datasuggest that loss of dotL in either the Lp02 strain or theJR32 strain is detrimental to thecell.

Mutation of lvhD4 does notsuppress the lethality caused by loss of dotL.

Since the sequences of thedot/icm genes are identical between Lp02 and JR32, it islikely that there is an additional genetic difference between the twostrains responsible for the more severe effect of deletingdotL in Lp02. For example, a gene may have been inactivated orlost during the derivation of JR32 that allows the JR32ΔdotL strain to survive. Alternatively, a gene may beabsent in Lp02 that is normally able to suppress the lethality causedby loss of dotL. In fact, a number of differences have beenreported between various L. pneumophila serogroup I isolatesincluding Lp01, the progenitor strain of Lp02, and JR32 (Table1)(6,36,47). One potentialcandidate is lvhD4, which is present in JR32 but not in Lp01(47). lvhD4 isencoded in the lvhB1-11/lvhD operon and is a component of asecond type IV secretion system found in L. pneumophilastrains such as JR32(51). lvhD4encodes a protein with similarity to T4CPs, most specifically to theA. tumefaciens VirD4(51), and could in theoryfunctionally substitute for DotL.
To confirm that the JR32 andLp02 isolates we were working with contained and lacked lvhD4,respectively, we performed Southern analysis with a probe specific tolvhD4 (Fig.8, top). Consistent with previous reports, Lp01 and Lp02 lackedlvhD4, whereas JR32 and Philadelphia-1, the progenitor strainfor both Lp02 and JR32, both contained it (Fig.8A). Lp01 and Lp02 mayhave lost the lvhB-lvhD region during their derivation tobecome restriction minus, since a number of restriction or modificationgenes are located adjacent to the lvhB/lvhD4 system(47). To determinewhether there was a connection between the presence of lvhD4and ΔdotL lethality, we deleted lvhD4 fromJR32 or added it back to Lp02 and then assayed the consequence ofdeleting dotL. dotL could still be deleted in a JR32strain lacking the lvhB-lvhD4 region, indicating thatlvhD4 was not responsible for the viability of the JR32ΔdotL strain (Fig.8B). Likewise, theaddition of the lvhB-lvhD4 region from JR32to the Lp02 strain did not suppress loss of dotL. Therefore,lvhD4 does not appear to be responsible for the alteredrequirements of dotL in these two L. pneumophilastrains.
In addition to the dot/icm and thelvhB systems, certain L. pneumophila strains containan additional type IV secretion system(6). This system isencoded in an ca. 65-kb locus, LpPI-1, that bears the hallmarks of apathogenicity island. It contains homologues to a type IV secretionsystem that resembles the F plasmid, including a T4CP that resemblesthe F plasmid TraD protein, mobile genetic elements, and severalputative virulence factors(6). In contrast tolvhD4, LpPI-1 is present in Lp02 but is absent from JR32.However, deletion of the TraD-like protein from Lp02 did not suppressthe lethality caused by loss of dotL (C. Vincent andJ. P. Vogel, unpublished data). Thus, some additional,as-yet-uncharacterized, mutation must exist in one of these strainsthat is responsible for the differential requirement of dotLfor viability.

dotM anddotN are also essential for viability in the Lp02background.

Whileconstructing a collection of dot/icm deletions, we were ableto generate in-frame deletions in 23 of the 26 known dot/icmgenes. However, similar to the dotL deletion, we could notconstruct a deletion in dotM, the gene upstream ofdotL (Table3). dotM, also known as icmP, codes for a predictedinner membrane protein with similarity to TrbA of the IncI plasmids R64and ColIb-P9 (24% amino acid identity). Since dotL anddotM are likely to be cotranscribed in a two gene operon,dotML, it was possible that the lethality of the dotMdeletion was due solely to polarity on the downstream dotLgene (Fig. 4). However,the ΔdotM mutation could not be obtained in thepresence of a complementing clone containing a wild-type version ofdotL, suggesting that the dotM lethality was not dueto polarity but reflected the essentiality of dotM (Table3). Moreover, insertionsin dotM were obtained in a screen for genes that resembledotL, i.e., genes that are essential in the presence of afunctional Dot/Icm complex(13).
A third gene,dotN, also proved difficult to delete from the L.pneumophila chromosome. dotN, also known asicmJ, is located ca. 12 kb downstream of the proposeddotML operon and is the first gene of another predictedoperon, dotNO (Fig.4). dotN codesfor a small protein of 208 amino acids that contains a high proportionof cysteines (4.3%). The lethality of the ΔdotNcould not be due to simple polarity on the downstream genedotO because deletions could easily be made in thedotO gene. Similar to dotL, both dotM anddotN could each be deleted in strains lacking a functionaldot complex (Table3). These results indicatethat three dot genes, dotL, dotM, anddotN are each essential for viability on bacteriological mediain the Lp02 background and in each case, the lethality can besuppressed by inactivation of the Dot/Icmcomplex.

DISCUSSION

The dot/icmgenes are required for the intracellular replication of L.pneumophila and encode a type IVB secretion system that appears tohave evolved from the conjugation apparatus of an IncI plasmid. We havedemonstrated here that three dot genes, dotL,dotM, and dotN, are essential for growth of L.pneumophila strain Lp02 on bacteriological media. This is indirect contrast to the established paradigm that the dot/icmgenes are dispensable under the laboratory conditions of growth onplates (3,37). In addition, we wereable to isolate a large collection of suppressors of theΔdotL lethality and have shown that the majority ofthese map to other dot/icm genes. However, inactivation ofseveral dot/icm genes (dotK, icmS, andicmW) did not suppress loss of dotL, indicatingspecificity to the suppression.
DotL has limited homology to theT4CP family of proteins. T4CPs have been proposed to play a centralrole in type IV secretion systems(34). They have beenshown to bind substrates synthesized in the cytoplasm and target themto the secretion apparatus in the inner membrane(2,15,61). T4CPs have also beenshown to interact with other components of the secretion apparatus,namely, the VirB10-family of proteins(20,35). Finally, T4CPs areabsolutely required for export of substrates(22). Based on theirhomology to Escherichia coli FtsK and Bacillussubtilis SpoIIIE, and their ability to bind DNA, T4CPs have beenproposed to function as molecular pumps, driving export of substratesvia hydrolysis of ATP(22). In consideration ofthese traits, T4CPs would appear to be likely candidates to function asregulators of the type IV secretion complexes.
Based on thesimilarity of DotL to T4CPs, it is surprising that inactivation of thedotL gene in strain Lp02 is lethal. No other known T4CP isessential for viability. Moreover, the only proteins associated withconjugative transfer that that are required for bacterial viability areinhibitors of plasmid toxin segregation factors(43). DotL, however,shows no sequence similarity to such factors. In addition, if DotLfunctioned as an inhibitor of a plasmid segregation toxin, then theΔdotL lethality suppressors would be predicted to mapto the toxin. In contrast, many of the ΔdotLsuppressors are components of the Dot/Icm machinery, and thenon-dot/icm suppressors do not have homology to any knowntoxin inhibitors.
To explain these overall observations regardingtoxicity induced by loss of dotL, we propose that loss of theDotL protein results in the accumulation of a toxic structureconsisting of a portion of the Dot/Icm complex (Fig.9). This partial Dot/Icm complex could be deleterious for a number ofdifferent reasons. First, a partial Dot/Icm complex could misassembleor misfold in the absence of DotL, disrupting the membrane in somefashion. Alternatively, loss of dotL could be toxic becausethe type IV secretion system forms an unregulated pore in the membranein the absence of DotL (Fig.9). In this model, DotLwould play the role of a regulator of the complex, controlling theopening and closing of the pore.
We favor the unregulated poremodel for the following reasons. First, if a misfolded subcomplex werethe cause of the lethality one would not anticipate that inactivationof the majority of dot/icm genes (20 of 23) would suppress theloss of dotL. Second, the JR32 ΔdotLphenotype, increased sensitivity to sodium relative to a wild-typestrain, is much more consistent with an unregulated pore. Although thesodium sensitivity of wild-type L. pneumophila strains is notwell understood, it is believed to result from leakage of sodium ionsthrough the Dot/Icm secretion apparatus(11,64). This model issupported by the observation that strains resistant to sodium chlorideoften contain mutations in dot/icm genes(63). Taken in thiscontext, loss of a regulator of the secretion pore is predicted toenhance the effect of exogenous sodium and is consistent with thehypersensitivity of the JR32 ΔdotL. Finally, there isprecedence in the literature of an example in which loss of a proteinresulted in an unregulated pore that can be lethal under certaincircumstances. Inactivation of Yersinia pestis lcrG results inan unregulated type III secretion pore under certain conditions and hasled to the model where LcrG forms a plug at the base of the apparatus(39,58).
Based on thephenotype of a strain lacking dotL, mutations that causelowered viability in the presence of an intact Dot/Icm apparatus werepreviously isolated (13).lidA was shown to encode a protein exported by the Dot/Icmsystem that may interact directly with DotL(13). Other lidgenes may encode proteins necessary for proper assembly of the Dot/Icmcomplex, particularly a subcomplex consisting of DotL, DotM, and DotN.For example, three Lid proteins are involved in disulfide bondmetabolism and, since the DotN protein is rich in cysteine residues, itmay be that mutations affecting the formation of disulfide bonds coulddisrupt folding of DotN(13).
TheΔdotL lethality phenotype in Lp02 has proven to beuseful for several additional reasons. First, it has provided aconvenient plate selection for additional dot/icm mutants.This is noteworthy because many of the dot/icm genes wereidentified by labor-intensive screens that have never been performed tosaturation (1,3,45). The only selectionfor dot/icm mutants previously available was based on thephenomenon that sodium-resistant L. pneumophila strains wereoften avirulent, although this phenomenon is poorly understood and maybe mutagenic (11,64). The benefit of ournew selection is amply demonstrated since we have already identified anadditional dot/icm gene, dotV, by thisprocedure.
The ΔdotL lethality phenotype alsoprovides information about existing Dot/Icm proteins. A number ofDot/Icm proteins that appear to be primarily cytoplasmic and notmembrane associated were still able to suppress the loss of DotL whentheir genes were inactivated. For example, IcmQ and IcmR have beenshown to be soluble proteins in the cytoplasm of L.pneumophila where IcmR appears to function as a chaperone for IcmQ(16). Although thespecific function of IcmQ remains unknown, the fact thatΔicmQ and ΔicmR were able to suppressthe lethality caused by the ΔdotL suggests that theyare directly required for the assembly or activity of the Dot/Icmcomplex. Another example is the DotB ATPase(55). Although DotB doesnot appear to be an integral component of the Dot/Icm membrane complex,it is required for expression of the ΔdotL lethalitytrait, thus indicating that the protein plays a role in the assemblyand/or function of the apparatus.
In contrast, inactivation oficmS or icmW did not suppress loss of dotL.Since icmS and icmW are predicted to encodecytoplasmic proteins and have been proposed to function as chaperonesfor secreted substrates(12), their failure tosuppress is consistent with our model. Moreover, inactivation of asecreted substrate ralF(41) also failed tosuppress loss of dotL (unpublished results). One additionalDot/Icm protein, the putative lipoprotein DotK, was also not requiredfor ΔdotL lethality. Combined with the observationthat a ΔdotK strain shows only mild defects forintracellular growth(53), this suggests thatDotK is not essential for the formation of the Dot/Icm complex. Furtherexamination of how various dot/icm mutants are able tosuppress loss of dotL may reveal information on whichcomponents are key to formation of the secretion pore.
A thirdinteresting observation that resulted from our analysis of theΔdotL lethality involved dotM anddotN. Similar to dotL, we discovered thatdotM and dotN are also essential for viability in theLp02 background and are not essential for the viability of JR32 onbacteriological media but are required for growth of JR32 insidemacrophages (50). Sinceall three proteins appear to code for inner membrane components of thesecretion apparatus, it is possible that DotM and DotN interact withDotL and regulate its activity, perhaps by modulating its proposednucleotide hydrolysis capability. In fact, we have recently shown thatDotM can be coimmunoprecipitated by using DotL specific antibodies(Vincent and Vogel, unpublished).
It is interesting that deletingdotL in two very closely related strains results in verydifferent phenotypes: death versus life. This is likely to be due to agenetic difference between the two strains acquired during theirderivation. The JR32 strain may have acquired a suppressor mutation orLp02 may have lost a gene that prevents ΔdotLlethality. One difference between these strains is that Lp02 lacks thesecond type IV secretion system encoded by the lvhB operon(47). However, deletionof the lvhB operon in JR32 did not cause the dotLdeletion to be lethal, and therefore the identity of the suppressor(s)remains to be discovered. Nevertheless, the difference between thesetwo strains may not be as profound as it initially appeared, since theJR32 ΔdotL strain is less fit than a wild-type strain,as demonstrated by its hyper-NaCl sensitivity. It is possible that thedifference in phenotypes between the two strains is more a matter ofdegrees of sensitivity to loss of dotL rather than JR32 beingimpervious to its loss.
The ΔdotL phenotypedescribed here is consistent with the proposal that T4CPs function asinner membrane gates for exported substrates(49). Furthercharacterization of this interesting phenomenon should shed light notonly on the function of DotL and other T4CPs but also on the L.pneumophila Dot/Icm complex and other type IV secretionsystems.
FIG. 1.
FIG. 1. (Top)DotL shows sequence similarity to members of the T4CP family. DotL hasextensive similarity to a number of putative type IVB secretion systemATPases, including an uncharacterized ORF in Coxiella burnetii[ORF (C.b.)], the TrbC protein of the IncI plasmid R64[TrbC (R64)], and a TrbC orthologue on the pPT23A plasmid ofPseudomonas syringae strains [ORF (pPT23A)]. DotLhas similarity to plasmid T4CPs (MobB, TraD, TraJ, TrwB, and TraG fromthe plasmids CloDF13, F, pKM101, R388, and RP4, respectively) and toT4CPs from adapted conjugation systems found in pathogens (HP0524 fromHelicobacter pylori, VirD4 from the Ti plasmid ofAgrobacterium tumefaciens, and a VirD4 orthologue fromRickettsia prowazekii). Most strains of L.pneumophila contain at least one additional T4CP, LvhD4, which ispart of a second type IV secretion system(51). The dendrogram wasgenerated by using CLUSTAL W alignment. (Bottom) The DotL protein islocalized to the inner membrane of L. pneumophila. Extracts ofwild-type L. pneumophila were separated into cytoplasmic andmembrane fractions by high-speed centrifugation. The membrane fractionswere then further separated into inner membrane versus outer membranefractions by extraction with the detergent Triton X-100. Duplicatesamples were run on two 7.5% acrylamide gels; the first gel wastransferred to a polyvinylidene difluoride membrane and probed withanti-DotL serum (lanes 1 to 5), whereas the second gel was stained withCoomassie blue for total protein (lanes 6 to 10). Lanes 1 and 6 aretotal cell lysates, lanes 2 and 7 are soluble cytoplasmic fractions,lanes 3 and 8 are total membrane, lanes 4 and 9 are Triton X-100soluble (inner membrane), and lanes 5 and 10 are Triton X-100 insoluble(outer membrane). All samples were loaded proportionally except forlanes 8, 9, and 10, which were overloaded in order to detect theprotein profile (lane 8 is 3-fold, lane 9 is 2-fold, and lane 10 is25-fold overloaded relative to lanes 1 to 7). The quality of thefractionation procedure can be determined by monitoring thelocalization of the major outer membrane protein, MOMP, on theCoomassie blue-stained gel (lane 10)(44). A DotL breakdownproduct detected by Western analysis is indicated with an asterisk(lane2).
FIG. 2.
FIG. 2. Assayfor ability of L. pneumophila to tolerate theΔdotL mutation. A merodiploid consisting of awild-type copy of dotL and a dotL deletion wasconstructed by integration of the suicide plasmid pJB1001. This plasmidcontains an origin, from the R6K plasmid, that is unable to replicatein L. pneumophila strains lacking the replication proteinπ(30). pSR47Salso contains the selectable marker, Kanr, and acounterselectable marker, sacB, which confers sensitivity tosucrose. The kanamycin marker was used to select for a single crossovergenerating a merodiploid strain containing bothdotL+ and ΔdotL(step A). Recombination between duplicated sequences in theheterozygote was selected by growth on 5% sucrose (step B). IfdotL is a nonessential gene, bothdotL+ and the ΔdotL willbe obtained (step C). If dotL is an essential gene, then onlywild-type dotL will berecovered.
FIG. 3.
FIG. 3. dotLis an essential gene on bacteriological media. dotL anddotB merodiploids were constructed and recombinants selectedas described in Fig. 2were analyzed by Southern analysis (as described in Materials andMethods). The top panel shows a Southern blot of recombinants derivedfrom a parental dotL/ΔdotL merodiploid strain probedwith a 700-bp SalI fragment of DNA adjacent to the dotL gene.Lane 1 is the wild-type strain Lp02; lane 2 is JV1003, aΔdotL/dotL merodiploid; and lanes 3 to 16 are JV1003plated on CYET plus 5% sucrose. All 14 strains that wereselected for sucrose resistance in this fashion retained the wild-typeversion of dotL. In contrast, the bottom panel is a similarexperiment in which sucrose resistant recombinants derived from adotB/ΔdotB merodiploid strain were probed with adotB-region specific probe. Lane 1 is the wild-type strainLp02; lane 2 is JV941, a dotB/ΔdotB merodiploid; andlanes 3 to 16 are JV941 selected on CYET plus 5% sucrose. Inthis case, two distinct types of recombinants are observed, a findingconsistent with either dotB or ΔdotB,indicating that dotB is not an essentialgene.
FIG. 4.
FIG. 4. Mini-Tn10insertions in multiple dot/icm genes suppress the lethalitycaused by loss of dotL. The dotL/ΔdotLmerodiploid strain, JV1003, was mutagenized with mini-Tn10,and viable strains harboring ΔdotL were directlyselected on sucrose-chloramphenicol-containing plates. Shown are theL. pneumophila dot/icm regions I and II(63). dot/icmgenes are indicated with filled arrows, whereas flanking genes that arenot required for intracellular growth are designated by open arrows(ORFs 1 to 9). Region I contains an 8-kb intervening region, whichcontains apparent housekeeping genes, separating the twodot/icm loci. dotV is separated from the rest of thedot/icm genes in region II by 20 kb. Mini-Tn10insertions that suppressed the ΔdotL lethality werefound in dotA, dotG, dotI, dotO,dotV, and icmF, and the sites of insertions areindicated with verticalarrows.
FIG. 5.
FIG. 5. ThedotL gene can be deleted in a strain lacking dotA.Southern blot analysis of ΔdotL recombinants in aΔdotA background. A 700-bp SalI fragment from pJB1001encoding DNA flanking dotL on the chromosome was used as aprobe to determine the status of dotL in these strains. Lane 1is the wild-type strain Lp02; lane 2 is JV1005, aΔdotL/dotL merodiploid in a dotA mutantbackground; and lanes 3 to 16 are JV1005 resolved on CYET plus5%sucrose.
FIG. 6.
FIG. 6. Deletionof most dot/icm genes can suppress the lethality caused bydeletion of dotL. AdotL/ΔdotL::CmR merodiploid wasconstructed in a variety of different dot/icm backgrounds.Sucrose-resistant recombinants were selected and then screened for theΔdotL allele by resistance to chloramphenicol.ΔdotL recombinants could not be obtained from thedotL/ΔdotL::Cmrmerodiploid strain JV1003. The presence of a wild-type copy ofdotL on a low-copy vector allowed the isolation ofΔdotL recombinants (JV1003 plus dotL).Inactivation of 20 of 23 dot/icm genes suppressed the loss ofdotL. In addition, deletion of citA/tphA, ahousekeeping gene found near the dot/icm genes, did not allowloss of dotL(42). In contrast,dotL is not essential in a related L. pneumophilastrain, JR32. The data shown reflects the average number ofΔdotL recombinants recovered from scoring 50 eventsfrom four independentexperiments.
FIG. 7.
FIG. 7. dotLis required for growth of the L. pneumophila strain JR32 inU937 cells. A number of L. pneumophila strains were assayedfor their ability to replicate inside U937 cells over 3 days. The toppanel includes Lp02 (wild type) and Lp03 (a dotA mutantderivative of Lp02) as controls. The bottom panel includes JR32containing the vector pJB908, a JR32ΔdotL straincontaining the dotL+ complementingclone pJB1014, and a JR32ΔdotL strain containing thevector pJB908. The data shown are the average of triplicate samples andare representative of two independentexperiments.
FIG. 8.
FIG. 8. ThelvhB operon is not responsible for viability of the JR32ΔdotL strain. (Top) The presence of thelvhB/lvhD operon in a variety of L. pneumophilastrains was assayed by Southern analysis with a probe that contains theentire operon: lane 1 is the Philadelphia-1 progenitor of JR32, lane 2is JR32, lane 3 is the Philadelphia-1 progenitor of Lp01 and Lp02, lane4 is Lp01, and lane 5 is Lp02. (Bottom) A dotL/ΔdotLmerodiploid of JR32 can be resolved to the ΔdotL,indicating it is not an essential gene. Two independently derived JR32strains lacking the lvhB operon, JV1630 and JV1631, stillallow deletion of dotL, whereas dotL is essential forviability in Lp02. The data shown reflect the average number ofΔdotL recombinants recovered from scoring 50 eventsfrom four independentexperiments.
FIG. 9.
FIG. 9. Modelfor potential DotL regulation of the Dot/Icm translocator.(A) In wild-type L. pneumophila strains, the Dot/Icmproteins form a secretion apparatus in the membrane, which is used toexport substrate(s). DotL is shown interacting with the complex as ahexameric gate based on homology to the hexameric T4CP, TrwB(21). Translocatedsubstrates would be exported through the complex after interacting withDotL on the cytoplasmic face of the inner membrane. (B)During conditions in which L. pneumophila is not activelysecreting substrates, the export apparatus would be closed via DotL andpotentially substrates such as LidA (indicated as a ball)(13). (C) Inthe absence of DotL, the secretion pore might remain constitutivelyopen and the cell would die, possibly due to cell lysis. (D)Inactivation of the Dot/Icm complex would suppress theΔdotL lethality since an unregulated pore would nolongerexist.
TABLE 1.
TABLE 1. Strainsand plasmids used
Strain or plasmidRelevantgenotypeaSource or reference
Strains  
    E.colistrains  
        DH5αendA1hsdR17 (rKmK+) glnV44thi-1 recA1 gyrA (Nalr)relA1lacIZYA-argF)U169 deoR(φ80dlac ΔlacZ)M1567
    DH5α(λpir)DH5α(λpir)tet::Mu30
    XL1-BluerecA1endA1 gyrA96 thi-1 hsdR17 supE44 relA1 lac[F′proAB lacIqZΔM15 Tn10(Tetr)]Stratagene
    L. pneumophilastrains  
        Philadelphia-1Wild-typestrain3, 38
        Lp01Philadelphia-1rpsLhsdR3
        Lp02Philadelphia-1rpsL hsdR thyAmutant3
        Lp03Lp02dotAmutant3
        JR32Philadelphia-1rpsLhsdR38
        JV1001Lp02dotL+dotLThisstudy
        JV1003Lp02dotL+dotL::CmrThisstudy
        JV1067JV1003 +pJB1014This study
        JV1630JR32ΔlvhBThis study
        JV1631JR32ΔlvhBThis study
        JV2114JR32ΔdotLThis study
        JV2348JR32ΔdotL + pJB1079This study
        JV2349JR32ΔdotL + pJB1081This study
        JV2097Lp02dotM+dotM::CmrThisstudy
        JV2100Lp02dotN+dotN::CmrThisstudy
        JV2114JR32 ΔlvhBdotL+dotL::CmrThisstudy
        JV2116JR32 ΔlvhBdotL+dotL::CmrThisstudy
        JV2118JR32 ΔlvhBdotL+dotL::CmrThisstudy
        JV2153JR32ΔdotBThis study
        JV2238Lp02dotM+dotM::CmrΔdotAThis study
        JV2240Lp02dotN+dotN::CmrΔdotAThis study
        JV2256Lp02 ΔdotVdotL+dotL::CmrThisstudy
        JV2258Lp02 ΔdotOdotL+dotL::CmrThisstudy
        JV2260Lp02 ΔdotPdotL+dotL::CmrThisstudy
        JV2262Lp02 ΔdotEdotL+dotL::CmrThisstudy
        JV2264Lp02 ΔicmQdotL+dotL::CmrThisstudy
        JV2274Lp02 ΔicmXdotL+dotL::CmrThisstudy
        JV2276Lp02 ΔdotAdotL+dotL::CmrThisstudy
        JV2282Lp02 ΔicmSdotL+dotL::CmrThisstudy
        JV2284Lp02 ΔicmRdotL+dotL::CmrThisstudy
        JV2286Lp02 ΔdotBdotL+dotL::CmrThisstudy
        JV2290Lp02 ΔdotUdotL+dotL::CmrThisstudy
        JV2292Lp02 ΔicmFdotL+dotL::CmrThisstudy
        JV2294Lp02 ΔcitAdotL+dotL::CmrThisstudy
        JV2465Lp02dotM+dotM::Cmr+pdotL+Thisstudy
        JV3748Lp02 ΔdotHdotL+dotL::CmrThisstudy
        JV3750Lp02 ΔicmTdotL+dotL::CmrThisstudy
        JV3752Lp02 ΔicmWdotL+dotL::CmrThisstudy
        JV3754Lp02 ΔdotIdotL+dotL::CmrThisstudy
        JV3756Lp02 ΔdotJdotL+dotL::CmrThisstudy
        JV3758Lp02 ΔdotKdotL+dotL::CmrThisstudy
        JV3760Lp02 ΔdotDdotL+dotL::CmrThisstudy
        JV3762Lp02 ΔdotCdotL+dotL::CmrThisstudy
        JV3765Lp02 ΔicmVdotl+dotL::CmrThisstudy
        JV3767Lp02 ΔdotGdotL+dotL::CmrThisstudy
        JV3769Lp02 ΔdotFdotL+dotL::CmrThisstudy
Plasmids  
    pJB908pKB5ΔoriT56
    pJB921ΔdotBinpSR47S55
    pJB1001ΔdotLin pSR47SThis study
    pJB1005ΔdotL::Cmrin pSR47SThis study
    pJB1010His-taggedDotL in pQE-32This study
    pJB1014pJB908+dotL+Thisstudy
    pJB1079pJB1014 +Genr cassetteThis study
    pJB1081pJB908 +Genr cassetteThis study
    pJB1242ΔlvhB inpSR47SThis study
    pJB1300pKB5 withNotI siteThisstudy
    pJB1304lvhBoperon inpJB1300Thisstudy
    pJB3046ΔdotNin pSR47SThis study
    pJB3050ΔdotM inpSR47SThis study
    pKB5RSF1010 cloningvector3
    pSR47SoriR6K oriTRP4 kansacB40
a
Nalr, nalidixic acid resistant;Tetr, tetracycline resistant; Genr, gentamicinresistant.
TABLE 2.
TABLE 2. Deletionof dotL in JR32 confers an enhanced salt sensitivity to thestrain
StrainGenotypePlatingefficiencya (%)Phenotype
Lp02Wildtype0.09Saltsensitive
Lp03Lp02dotA13Salt resistant
JR32Wild type0.05Salt sensitive
JV2153JR32ΔdotB9.0Salt resistant
JV2114JR32ΔdotL0.002Hyper-saltsensitive
a
The plating efficiencywas calculated as the number of colonies on a buffered CYE platecontaining 0.65% sodium chloride divided by the number ofcolonies on a buffered CYE plate ×100.
TABLE 3.
TABLE 3. dotMand dotN are required for the viability ofLp02
StrainGenotypeNo.of ΔdotM orΔdoctN recombinants/totala
JV2097dotM+dotM::Cmr0/600
JV2465dotM+dotM::Cmr+pdotL+0/280
JV2238dotM+dotM::CmrΔdotA172/400
JV2100dotN+dotN::Cmr0/700
JV2240dotN+dotN::CmrΔdotA158/400
a
This value was determined as the number ofevents in which the merodiploid resolved to eitherΔdotM::Cmr or toΔdotN::Cmr.

Acknowledgments

We thank James Kirby forthe generous gift of pJK211-2. We also thank Jessica Sexton and CarrVincent for suggestions and critical reading of themanuscript.
G.M.C. was supported by training programJ32AI1007422. This study was funded by the Whitaker Foundation(J.P.V.), the American Lung Association (J.P.V.), and NIH grantAI48052-01A2 (J.P.V.) and by funding from the Howard Hughes MedicalInstitute toR.R.I.

REFERENCES

1.
Andrews,H. L., J. P. Vogel, and R. R. Isberg.1998. Identification of linked Legionellapneumophila genes essential for intracellular growth and evasionof the endocytic pathway. Infect. Immun.66:950-958.
2.
Atmakuri,K., Z. Ding, and P. J. Christie.2003.VirE2, a type IV secretion substrate, interacts with the VirD4 transferprotein at cell poles of Agrobacterium tumefaciens.Mol. Microbiol.49:1699-1713.
3.
Berger,K. H., and R. R. Isberg.1993. Twodistinct defects in intracellular growth complemented by a singlegenetic locus in Legionella pneumophila. Mol.Microbiol.7:7-19.
4.
Blomfield,I. C., V. Vaughn, R. F. Rest, and B. I.Eisenstein.1991. Allelic exchange in Escherichiacoli using the Bacillus subtilis sacB gene and atemperature-sensitive pSC101 replicon. Mol. Microbiol.5:1447-1457.
5.
Brand,B. C., A. B. Sadosky, and H. A.Shuman.1994. The Legionella pneumophilaicm locus: a set of genes required for intracellularmultiplication in human macrophages. Mol. Microbiol.14:797-808.
6.
Brassinga,A. K., M. F. Hiltz, G. R. Sisson,M. G. Morash, N. Hill, E. Garduno, P. H. Edelstein,R. A. Garduno, and P. S. Hoffman.2003. A 65-kilobase pathogenicity island is unique toPhiladelphia-1 strains of Legionella pneumophila. J.Bacteriol.185:4630-4637.
7.
Brenner,D. J., A. G. Steigerwalt, and J. E.McDade.1979. Classification of the Legionnaires'disease bacterium: Legionella pneumophila, genus novum,species nova, of the family Legionellaceae, familia nova.Ann. Intern. Med.90:656-658.
8.
Cabezon,E., E. Lanka, and F. de la Cruz.1994. Requirementsfor mobilization of plasmids RSF1010 and ColE1 by the IncW plasmidR388: trwB and RP4 traG are interchangeable.J. Bacteriol.176:4455-4458.
9.
Cabezon,E., J. I. Sastre, and F. de la Cruz.1997.Genetic evidence of a coupling role for the TraG protein family inbacterial conjugation. Mol. Gen. Genet.254:400-406.
10.
Cascales,E., and P. J. Christie.2003. The versatilebacterial type IV secretion systems. Nat. Rev.Microbiol.1:137-149.
11.
Catrenich,C. E., and W. Johnson.1989.Characterization of the selective inhibition of growth of virulentLegionella pneumophila by supplemented Mueller-Hinton medium.Infect. Immun.57:1862-1864.
12.
Coers,J., J. C. Kagan, M. Matthews, H. Nagai, D. M.Zuckman, and C. R. Roy.2000. Identificationof Icm protein complexes that play distinct roles in the biogenesis ofan organelle permissive for Legionella pneumophilaintracellular growth. Mol. Microbiol.38:719-736.
13.
Conover,G. M., I. Derre, J. P. Vogel, and R. R.Isberg.2002. The Legionella pneumophila LidAprotein: a translocated substrate of the Dot/Icm system associated withmaintenance of bacterial integrity. Mol. Microbiol.48:305-321.
14.
deLorenzo, V., and K. N. Timmis.1994.Analysis and construction of stable phenotypes in gram-negativebacteria with Tn5- and Tn10-derived minitransposons.Methods Enzymol.235:386-405.
15.
Disque-Kochem,C., and B. Dreiseikelmann.1997. The cytoplasmicDNA-binding protein TraM binds to the inner membrane protein TraD invitro. J. Bacteriol.179:6133-6137.
16.
Dumenil,G., and R. R. Isberg.2001. TheLegionella pneumophila IcmR protein exhibits chaperoneactivity for IcmQ by preventing its participation inhigh-molecular-weight complexes. Mol. Microbiol.40:1113-1127.
17.
Fields,B. S.1996. The molecular ecology oflegionellae. Trends Microbiol.4:286-290.
18.
Frost,L. S., K. Ippen-Ihler, and R. A. Skurray.1994. Analysis of the sequence and gene products of thetransfer region of the F sex factor. Microbiol. Rev.58:162-210.
19.
Furuya,N., and T. Komano.1996. Nucleotide sequence andcharacterization of the trbABC region of the IncI1 plasmidR64: existence of the pnd gene for plasmid maintenance withinthe transfer region. J. Bacteriol.178:1491-1497.
20.
Gilmour,M. W., J. E. Gunton, T. D. Lawley, andD. E. Taylor.2003. Interaction between theIncHI1 plasmid R27 coupling protein and type IV secretion system: TraGassociates with the coiled-coil mating pair formation protein TrhB.Mol. Microbiol.49:105-116.
21.
Gomis-Ruth,F. X., G. Moncalian, F. de la Cruz, and M. Coll.2002. Conjugative plasmid protein TrwB, an integralmembrane type IV secretion system coupling protein. Detailed structuralfeatures and mapping of the active site cleft. J.Biol. Chem.277:7556-7566.
22.
Gomis-Ruth,F. X., M. Sola, F. de la Cruz, and M. Coll.2004. Coupling factors in macromolecular type-IV secretionmachineries. Curr. Pharm. Des.10:1551-1565.
23.
Hamilton,C. M., H. Lee, P. L. Li, D. M. Cook,K. R. Piper, S. B. von Bodman, E. Lanka, W. Ream,and S. K. Farrand.2000. TraG from RP4 andTraG and VirD4 from Ti plasmids confer relaxosome specificity to theconjugal transfer system of pTiC58. J. Bacteriol.182:1541-1548.
24.
Horwitz,M. A.1987. Characterization of avirulentmutant Legionella pneumophila that survive but do not multiplywithin human monocytes. J. Exp. Med.166:1310-1328.
25.
Horwitz,M. A.1983. Formation of a novel phagosomeby the Legionnaires' disease bacterium (Legionellapneumophila) in human monocytes. J. Exp. Med.158:1319-1331.
26.
Horwitz,M. A.1983. The Legionnaires' diseasebacterium (Legionella pneumophila) inhibits phagosome-lysosomefusion in human monocytes. J. Exp. Med.158:2108-2126.
27.
Horwitz,M. A., and F. R. Maxfield.1984.Legionella pneumophila inhibits acidification of its phagosomein human monocytes. J. Cell Biol.99:1936-1943.
28.
Horwitz,M. A., and S. C. Silverstein.1980. Legionnaires′ disease bacterium(Legionella pneumophila) multiples intracellularly in humanmonocytes. J. Clin. Investig.66:441-450.
29.
Kagan,J. C., and C. R. Roy.2002.Legionella phagosomes intercept vesicular traffic from endoplasmicreticulum exit sites. Nat. Cell. Biol.4:945-954.
30.
Kolter,R., M. Inuzuka, and D. R. Helinski.1978.Trans-complementation-dependent replication of a low molecular weightorigin fragment from plasmid R6K. Cell15:1199-1208.
31.
Komano,T., T. Yoshida, K. Narahara, and N. Furuya.2000. Thetransfer region of IncI1 plasmid R64: similarities between R64tra and Legionella icm/dot genes. Mol.Microbiol.35:1348-1359.
32.
Lessl,M., D. Balzer, K. Weyrauch, and E. Lanka.1993. Themating pair formation system of plasmid RP4 defined by RSF1010mobilization and donor-specific phage propagation. J.Bacteriol.175:6415-6425.
33.
Lessl,M., W. Pansegrau, and E. Lanka.1992. Relationship ofDNA-transfer-systems: essential transfer factors of plasmids RP4, Tiand F share common sequences. Nucleic Acids Res.20:6099-6100.
34.
Llosa,M., F. X. Gomis-Ruth, M. Coll, and F. de la Cruz Fd.2002. Bacterial conjugation: a two-step mechanism for DNAtransport. Mol. Microbiol.45:1-8.
35.
Llosa,M., S. Zunzunegui, and F. de la Cruz.2003.Conjugative coupling proteins interact with cognate and heterologousVirB10-like proteins while exhibiting specificity for cognaterelaxosomes. Proc. Natl. Acad. Sci. USA100:10465-10470.
36.
Luneberg,E., B. Mayer, N. Daryab, O. Kooistra, U. Zahringer, M. Rohde, J.Swanson, and M. Frosch.2001. Chromosomal insertionand excision of a 30 kb unstable genetic element is responsible forphase variation of lipopolysaccharide and other virulence determinantsin Legionella pneumophila. Mol. Microbiol.39:1259-1271.
37.
Marra,A., S. J. Blander, M. A. Horwitz, and H.A. Shuman.1992. Identification of a Legionellapneumophila locus required for intracellular multiplication inhuman macrophages. Proc. Natl. Acad. Sci. USA89:9607-9611.
38.
Marra,A., and H. A. Shuman.1989. Isolation of aLegionella pneumophila restriction mutant with increasedability to act as a recipient in heterospecific matings. J.Bacteriol.171:2238-2240.
39.
Matson,J. S., and M. L. Nilles.2001.LcrG-LcrV interaction is required for control of Yops secretion inYersinia pestis. J. Bacteriol.183:5082-5091.
40.
Merriam,J. J., R. Mathur, R. Maxfield-Boumil, and R. R.Isberg.1997. Analysis of the Legionellapneumophila fliI gene: intracellular growth of a defined mutantdefective for flagellum biosynthesis. Infect. Immun.65:2497-2501.
41.
Nagai,H., J. C. Kagan, X. Zhu, R. A. Kahn, andC. R. Roy.2002. A bacterial guaninenucleotide exchange factor activates ARF on Legionellaphagosomes. Science295:679-682.
42.
Purcell,M., and H. A. Shuman.1998. TheLegionella pneumophila icmGCDJBF genes arerequired for killing of human macrophages. Infect.Immun.66:2245-2255.
43.
Rawlings,D. E.1999. Proteic toxin-antitoxin,bacterial plasmid addiction systems and their evolution with specialreference to the pas system of pTF-FC2. FEMS Microbiol.Lett.176:269-277.
44.
Roy,C. R., and R. R. Isberg.1997.Topology of Legionella pneumophila DotA: an inner membraneprotein required for replication in macrophages. Infect.Immun.65:571-578.
45.
Sadosky,A. B., L. A. Wiater, and H. A.Shuman.1993. Identification of Legionellapneumophila genes required for growth within and killing of humanmacrophages. Infect. Immun.61:5361-5373.
46.
Salmond,G. P. C.1994. Secretion ofextracellular virulence factors by plant pathogenic bacteria.Annu. Rev. Phytopathol.32:181-200.
47.
Samrakandi,M. M., S. L. Cirillo, D. A. Ridenour,L. E. Bermudez, and J. D. Cirillo.2002. Genetic and phenotypic differences betweenLegionella pneumophila strains. J. Clin.Microbiol.40:1352-1362.
48.
Schnaitman,C. A.1971. Solubilization of thecytoplasmic membrane of Escherichia coli by Triton X-100.J. Bacteriol.108:545-552.
49.
Schroder,G., S. Krause, E. L. Zechner, B. Traxler, H. J.Yeo, R. Lurz, G. Waksman, and E. Lanka.2002.TraG-like proteins of DNA transfer systems and of the Helicobacterpylori type IV secretion system: inner membrane gate for exportedsubstrates? J. Bacteriol.184:2767-2779.
50.
Segal,G., M. Purcell, and H. A. Shuman.1998. Hostcell killing and bacterial conjugation require overlapping sets ofgenes within a 22-kb region of the Legionella pneumophilagenome. Proc. Natl. Acad. Sci. USA95:1669-1674.
51.
Segal,G., J. J. Russo, and H. A. Shuman.1999. Relationships between a new type IV secretion systemand the icm/dot virulence system of Legionellapneumophila. Mol. Microbiol.34:799-809.
52.
Segal,G., and H. A. Shuman.1997. Characterizationof a new region required for macrophage killing by Legionellapneumophila. Infect. Immun.65:5057-5066.
53.
Segal,G., and H. A. Shuman.1999. Legionellapneumophila utilizes the same genes to multiply withinAcanthamoeba castellanii and human macrophages. Infect.Immun.67:2117-2124.
54.
Sexton,J. A., J. L. Miller, A. Yoneda, T. E.Kehl-Fie, and J. P. Vogel.2004.Legionella pneumophila DotU and IcmF are required forstability of the Dot/Icm complex. Infect. Immun.72:5983-5992.
55.
Sexton,J. A., J. S. Pinkner, R. Roth, J. E.Heuser, S. J. Hultgren, and J. P. Vogel.2004. The Legionella pneumophila PilT homologueDotB exhibits ATPase activity that is critical for intracellulargrowth. J. Bacteriol.186:1658-1666.
56.
Sexton,J. A., and J. P. Vogel.2004.Regulation of hypercompetence in Legionella pneumophila.J. Bacteriol.186:3814-3825.
57.
Sexton,J. A., and J. P. Vogel.2002. TypeIVB secretion by intracellular pathogens. Traffic3:178-185.
58.
Skryzpek,E., and S. C. Straley.1993. LcrG, asecreted protein involved in negative regulation of the low- calciumresponse in Yersinia pestis. J. Bacteriol.175:3520-3528.
59.
Sturgill-Koszycki,S., and M. S. Swanson.2000. Legionellapneumophila replication vacuoles mature into acidic, endocyticorganelles. J. Exp. Med.192:1261-1272.
60.
Swanson,M. S., and R. R. Isberg.1995.Association of Legionella pneumophila with the macrophageendoplasmic reticulum. Infect. Immun.63:3609-3620.
61.
Szpirer,C. Y., M. Faelen, and M. Couturier.2000.Interaction between the RP4 coupling protein TraG and the pBHR1mobilization protein Mob. Mol. Microbiol.37:1283-1292.
62.
VanRheenen,S. M., G. Dumenil, and R. R. Isberg.2004. IcmF and DotU are required for optimal effectortranslocation and trafficking of the Legionella pneumophilavacuole. Infect. Immun.72:5972-5982.
63.
Vogel,J. P., H. L. Andrews, S. K. Wong, andR. R. Isberg.1998. Conjugative transfer bythe virulence system of Legionella pneumophila.Science279:873-876.
64.
Vogel,J. P., C. Roy, and R. R. Isberg.1996. Use of salt to isolate Legionellapneumophila mutants unable to replicate in macrophages.Ann. N. Y. Acad. Sci.797:271-272.
65.
Walker,J. E., M. Saraste, M. J. Runswick, and N.J. Gay.1982. Distantly related sequences in thealpha- and beta-subunits of ATP synthase, myosin, kinases and otherATP-requiring enzymes and a common nucleotide binding fold. EMBOJ.1:945-951.
66.
Winans,S. C., D. L. Burns, and P. J.Christie.1996. Adaptation of a conjugal transfersystem for the export of pathogenic macromolecules. TrendsMicrobiol.4:64-68.
67.
Woodcock,D. M., P. J. Crowther, J. Doherty, S. Jefferson, E.DeCruz, M. Noyer-Weidner, S. S. Smith, M. Z.Michael, and M. W. Graham.1989.Quantitative evaluation of Escherichia coli host strains fortolerance to cytosine methylation in plasmid and phage recombinants.Nucleic Acids Res.17:3469-3478.
68.
Zusman,T., M. Feldman, E. Halperin, and G. Segal.2004.Characterization of the icmH and icmF genes requiredfor Legionella pneumophila intracellular growth, genes thatare present in many bacteria associated with eukaryotic cells.Infect. Immun.72:3398-3409.

Information & Contributors

Information

Published In

cover image Journal of Bacteriology
Journal of Bacteriology
Volume 187Number 91 May 2005
Pages: 2927 - 2938
PubMed: 15838018

History

Received: 6 July 2004
Accepted: 20 January 2005
Published online: 1 May 2005

Permissions

Request permissions for this article.

Contributors

Authors

Benjamin A. Buscher
Department of Molecular Microbiology, Washington University School of Medicine, St. Louis, Missouri 63110
Gloria M. Conover
Department of Molecular Biology and Microbiology, Tufts University School of Medicine, Boston, Massachusetts 02111
Jennifer L. Miller
Department of Molecular Microbiology, Washington University School of Medicine, St. Louis, Missouri 63110
Sinae A. Vogel
Department of Molecular Microbiology, Washington University School of Medicine, St. Louis, Missouri 63110
Stacey N. Meyers
Department of Molecular Microbiology, Washington University School of Medicine, St. Louis, Missouri 63110
Ralph R. Isberg
Department of Molecular Biology and Microbiology, Tufts University School of Medicine, Boston, Massachusetts 02111
Howard Hughes Medical Institute, Tufts University School of Medicine, Boston, Massachusetts 02111
Joseph P. Vogel [email protected]
Department of Molecular Microbiology, Washington University School of Medicine, St. Louis, Missouri 63110

Metrics & Citations

Metrics

VIEW ALL METRICS

Citations

If you have the appropriate software installed, you can download article citation data to the citation manager of your choice. Simply select your manager software from the list below and click Download.

View Options

View options

PDF

Download PDF

Full Text

Open Full Text

ePub

Open ePub

Get Access

Buy Article
Journal of Bacteriology Vol.187 • Issue 9 • ASM Journals Pay Per View, PPV 25
Journal Subscription
Journal of Bacteriology
ASM members can purchase subscriptions to journals.
Join or renew

Figures and Media

Figures

Media

Tables

Share

Share

Share the article link

Share with email

Share on social media

American Society for Microbiology ("ASM") is committed to maintaining your confidence and trust with respect to the information we collect from you on websites owned and operated by ASM ("ASM Web Sites") and other sources. This Privacy Policy sets forth the information we collect about you, how we use this information and the choices you have about how we use such information.
FIND OUT MORE about the privacy policy