Advertisement
Free access
Research Article
15 April 2013

The Cpx Stress Response System Potentiates the Fitness and Virulence of Uropathogenic Escherichia coli

ABSTRACT

Strains of uropathogenic Escherichia coli (UPEC) are the primary cause of urinary tract infections, representing one of the most widespread and successful groups of pathogens on the planet. To colonize and persist within the urinary tract, UPEC must be able to sense and respond appropriately to environmental stresses, many of which can compromise the bacterial envelope. The Cpx two-component envelope stress response system is comprised of the inner membrane histidine kinase CpxA, the cytosolic response regulator CpxR, and the periplasmic auxiliary factor CpxP. Here, by using deletion mutants along with mouse and zebrafish infection models, we show that the Cpx system is critical to the fitness and virulence of two reference UPEC strains, the cystitis isolate UTI89 and the urosepsis isolate CFT073. Specifically, deletion of the cpxRA operon impaired the ability of UTI89 to colonize the murine bladder and greatly reduced the virulence of CFT073 during both systemic and localized infections within zebrafish embryos. These defects coincided with diminished host cell invasion by UTI89 and increased sensitivity of both strains to complement-mediated killing and the aminoglycoside antibiotic amikacin. Results obtained with the cpxP deletion mutants were more complicated, indicating variable strain-dependent and niche-specific requirements for this well-conserved auxiliary factor.

INTRODUCTION

Urinary tract infections (UTIs) afflict a large proportion of the human population, representing an enormous health and financial burden worldwide (1). Most UTIs are caused by a genetically diverse group of bacteria known as uropathogenic Escherichia coli (UPEC). These pathogens can survive and grow within urine and the lumen of the bladder, but many can also bind and invade uroepithelial cells (24). Within the bladder, entry into uroepithelial cells can promote UPEC survival and persistence, rendering the pathogens protected from a variety of stresses and commonly used antibiotics (3, 5, 6). Prior to introduction into the urinary tract, UPEC likely first colonizes the host nasopharynx and gastrointestinal tract, where it does not appear to elicit any overt pathology (79). Within these varied host environments, and while in transit between hosts, UPEC will encounter an assorted array of stresses, including reactive nitrogen and oxygen species, nutrient limitation, shearing forces, professional phagocytes, complement and other antimicrobial compounds, competition with other microbes and, potentially, antibiotics (1015). The ability to deal with these stresses is of paramount importance to the success of UPEC as a pathogen.
The envelope of Gram-negative bacteria interfaces with the extracellular environment, functioning as both a sensor of external conditions and as a selectively permeable physical barrier. Envelope stress response pathways are likely critical to the ability of UPEC to detect and respond to potentially fatal environmental insults during the course of infection. UPEC, as well as other E. coli strains, encode a number of envelope stress response systems, including sigma E (σE), Rcs, Psp, and the BaeSR and CpxRA two-component systems (1619). The Cpx system is comprised of the inner membrane histidine kinase CpxA and the cytoplasmic response regulator CpxR (2022). Autophosphorylation of CpxA in response to envelope stress results in the phosphorylation of CpxR, which then functions as a transcriptional regulator. CpxR controls the expression of protein folding and degrading factors involved in relieving envelope stress and can also regulate biofilm formation (2326), bacterial adherence (23, 27, 28), motility and chemotaxis (29, 30), type III and type IV secretion systems (3135) and, possibly, the synthesis of bacterial toxins (27, 36, 37). Studies using E. coli K-12 strains like MG1655 and MC4100 have indicated that CpxR may regulate the expression of well over 100 genes (38, 39).
In E. coli and other microbes, the Cpx system is subject to negative feedback through CpxP, a small CpxR-regulated periplasmic protein that can bind the sensor kinase CpxA, keeping it in an inactive state (40, 41). CpxR binding sites are situated upstream of the cpxP gene within a conserved 146-bp region that separates cpxP from the cpxRA operon. CpxP is the most highly inducible member of the Cpx regulon so far identified, and it has elevated expression in response to both envelope stress and entry into stationary-phase growth (40, 42). In addition to its role as a negative regulator of CpxA, CpxP also functions as an adaptor protein, interacting with subsets of misfolded periplasmic proteins and delivering them to the protease DegP for degradation (43, 44). In this process, CpxP is degraded along with its misfolded substrate, suggesting a mechanism by which bacteria can posttranslationally modulate CpxP levels. By varying the amounts of CpxP within the periplasm, bacteria may be able to fine-tune the Cpx stress response, limiting inappropriate activation of CpxA in the absence of envelope stress and permitting rapid shutoff of the system once the stress is under control (20, 45).
The Cpx system appears to have a key role in regulating the virulence potential of a number of pathogens (17), including Salmonella spp. (46, 47), Legionella pneumophila (31, 48), Shigella spp. (3335), enteropathogenic E. coli (32, 49, 50), Actinobacillus suis (51), Haemophilus ducreyi (52, 53), Xenorhabdus nematophila (37, 54), and Yersinia pseudotuberculosis (5557). However, direct evidence that the Cpx system can affect pathogen fitness and virulence in vivo within an animal host is limited to only a few studies (47, 50, 53, 54). In UPEC, the Cpx system has been examined primarily with respect to its ability to modulate the expression of P pili, filamentous adhesive organelles that can promote bacterial interactions with host kidney cells (27, 28, 58). Here, by using isogenic deletion mutants, we assessed how components of the Cpx stress response system affect the fitness and virulence of two reference UPEC isolates. Employing in vitro assays coupled with in vivo mouse and zebrafish infection models, we demonstrate that cpxP and cpxRA can have profound and sometimes divergent effects on the pathogenic potential of UPEC.

MATERIALS AND METHODS

Bacterial strains and plasmids.

The bacterial strains and plasmids used in this study are listed in Table 1. Targeted gene knockouts were created in the human cystitis isolate UTI89 and the urosepsis isolate CFT073 by using lambda Red-based homologous recombination as previously described (59, 60). Briefly, the chloramphenicol resistance cassette (clmr) was amplified from the template plasmid pKD3 with flanking 40-bp overhangs specific for the target cpxP or cpxRA loci. PCR products were electroporated into UTI89 and CFT073 carrying the plasmid pKM208, which encodes an isopropyl-β-d-thiogalactopyranoside (IPTG)-inducible lambda Red recombinase. The yiiP (fieF) gene was knocked out by using a similar approach. Knockout strains were selected on Luria-Bertani (LB) agar plates containing chloramphenicol (20 μg/ml) and verified by PCR using the primers listed in Table 2.
Table 1
Table 1 Bacterial strains and plasmids
Strain or plasmidDescriptionSource or reference(s)
Wild-type strains  
    UTI89UPEC, cystitis isolate (O18:K1:H7)6, 95
    CFT073Urosepsis isolate (O6:K2:H1)96
Recombinant strains  
    UTI89ΔcpxPUTI89 ΔcpxP::clmrThis study
    UTI89ΔcpxRAUTI89 ΔcpxRA::clmrThis study
    UTI89ΔfieFUTI89 ΔfieF::clmrThis study
    CFT073ΔcpxPCFT073 ΔcpxP::clmrThis study
    CFT073ΔcpxRACFT073 ΔcpxRA::clmrThis study
    CFT073ΔfieFCFT073 ΔfieF::clmrThis study
Plasmids  
    pKM208IPTG-inducible Red recombinase expression plasmid, Ampr60
    pGEN-MCSHigh-retention plasmid containing empty multiple-cloning site, Ampr61
    pJLJ41pcpxP sequence with native promoter from UTI89 cloned into pGEN-MCS; AmprThis study
    pJLJ42cpxRA sequence with native promoter from UTI89 cloned into pGEN-MCS; AmprThis study
    pNLP10-luxLow-copy-number cloning vector with promoterless luxCDABE operon; Kanr39
    pJW1-cpxP-luxpNLP10 with PcpxP::luxCDABE, Kanr39
Table 2
Table 2 Primers used in this studya
PrimerSequence (5′–3′)
cpxP KO 
    ForwardATGCGCATAGTTACCGCTGCCGTCATGGCCTCAACGCTGGGTGTAGGCTGGAGCTGCTTC
    ReverseCTACTGGGAACGTGAGTTGCTACTACTCAATAGCTTCAACCATATGAATATCCTCCTTAG
cpxP confirmation 
    ForwardCTATCGTTGAATCGCGACAG
    ReverseGGATGGTGTCTATGGCAAGG
cpxRA KO 
    ForwardATGAATAAAATCCTGTTAGTTGATGATGACCGAGAGCTGGTGTAGGCTGGAGCTGCTTC
    ReverseTTAACTCCGCTTATACAGCGGCAACCAAATCACCAGCCGTCATATGAATATCCTCCTTAG
cpxRA confirmation 
    ForwardACTGCCAGCGTTGAGGCCATGA
    ReverseGAGTGTAGGCCTGATAAGACGCTATCAGC
fieF KO 
    ForwardATGAATCAATCTTATGGACGGCTGGTCAGTCGGGCGGCTGTGTAGGCTGGAGCTGCTTCG
    ReverseTTATGAAAGCATAGACCGTTTACCCTCCCTGGGTACGACGCATATGAATATCCTCCTTAG
fieF confirmation 
    ForwardCCTTGCCATAGACACCATC
    ReverseTCAGGTCAGGCCAAATGG
pJLJ41p 
    Forward (PstI)AATCCTGCAGATTGTTTAAATACCTCCGAGGC
    Reverse (SalI)TAGAGTCGACTACCAGCGCGGCGAGAATAC
pJLJ42 
    Forward (PstI)TGCTCTGCAGTCATTTGCTCCCAAAATCTTTCT
    Reverse (SalI)GCTAGTCGACAGCGGCAAGATCGAAGATTTTT
a
Added restriction sites underlined. KO, knockout.
Expression constructs were made using the low-copy-number plasmid pGEN-MCS and standard molecular biology techniques (61). The cpxP gene and the cpxRA operon were cloned by PCR from the UTI89 chromosome. The primers used (Table 2) to amplify each locus were designed to include 250 bp of upstream and 100 bp of downstream sequences, along with terminal PstI and SalI restriction sites. PCR products were cut using PstI and SalI and ligated into pGEN-MCS to create the CpxP and CpxRA expression constructs pJLJ41p and pJLJ42, respectively.

Growth curves.

Bacteria were grown from frozen stocks at 37°C with shaking overnight in 5 ml of LB broth or modified M9 minimal medium (6 g/liter Na2HPO4, 3 g/liter KH2PO4, 1 g/liter NH4Cl, 0.5 g/liter NaCl, 1 mM MgSO4, 0.1 mM CaCl2, 0.1% glucose, 0.0025% nicotinic acid, 16.5 μg/ml thiamine, and 0.2% casein amino acids). Cultures were then diluted 1:100 into the indicated medium, and the growth of quadruplicate 200-μl samples in shaking 100-well honeycomb plates at 37°C was assessed using a Bioscreen C instrument (Growth Curves USA). For competition assays, wild-type and mutant strains diluted 1:200 were mixed at a 1-to-1 ratio in 5 ml modified M9 medium and grown with shaking at 37°C. After 2, 4, and 6 h of growth, titers of the mutant and wild-type strains were determined by plating serial dilutions on LB agar with or without chloramphenicol (to distinguish wild-type and mutant strains). Competitive indices were calculated as follows: log10[(mutantoutput/wild-typeoutput)/(mutantinput/wild-typeinput)]. Media and other reagents used in these assays were purchased from Sigma-Aldrich.

Amikacin susceptibility assays.

Bacteria were grown from frozen stocks with shaking at 37°C in 5 ml modified M9 medium with or without 100 μg/ml ampicillin (used to maintain plasmids). Overnight cultures were diluted 1:100 into 1 ml modified M9 medium containing amikacin at concentrations ranging from 1 to 40 μg/ml. Each culture was then grown with shaking at 37°C for 24 h. The MIC of each strain was determined as the lowest concentration of amikacin needed to prevent growth.

cpxP promoter activity assays.

Bacteria carrying pNLP10-lux or pJW1-cpxP-lux were grown from frozen stocks at 37°C with shaking overnight in 5 ml modified M9 medium containing 50 μg/ml kanamycin (39). Overnight cultures were diluted 1:100 into 5 ml modified M9 medium containing 50 μg/ml kanamycin and incubated with shaking at 37°C for 4 h to reach stationary phase (optical density at 600 nm, ≈1.0). Triplicate 100-μl aliquots of each sample were then transferred into a 96-well white, opaque-walled polystyrene microplate (Dynex Technologies), and luminescence was measured immediately with a Synergy HT multidetection microplate reader (BioTek Instruments, Inc.).

Hemagglutination assays.

Hemagglutination titers were determined using guinea pig red blood cells (Colorado Serum Company) as described previously (62). Bacteria used in these assays were grown statically from frozen stocks in 20 ml modified M9 medium or LB broth for 48 h at 37°C.

Mouse UTI model.

Seven- to 8-week-old female CBA/J mice (Jackson Laboratory) were used, following IACUC-approved protocols as previously described (5, 63, 64). Wild-type and mutant bacterial strains were grown from frozen stocks in 20 ml static modified M9 medium for 24 h at 37°C. Prior to inoculation, bacteria were pelleted by centrifugation for 10 min at 8,000 × g and then resuspended in phosphate-buffered saline (PBS). Mice were anesthetized by using isoflurane inhalation and carefully inoculated by transurethral catheterization with 50 μl of a bacterial suspension containing 1 × 107 CFU. For competitive assays, wild-type UTI89 was mixed 1:1 with either the ΔcpxP or ΔcpxRA mutant prior to inoculation. For noncompetitive assays, each strain was inoculated separately. Bladders were harvested aseptically at 3 days postinoculation, weighed, and homogenized in sterile PBS containing 0.02% Triton X-100. Bacterial titers present in the input pools and in the bladder homogenates were determined by plating serial dilutions on LB agar plates. For competitive assays, LB agar plates with or without chloramphenicol (20 μg/ml) were used to distinguish the wild-type and mutant strains. Competitive indices were calculated as follows: log10[(mutant CFU inoculated/wild-type CFU inoculated)/(mutant CFU recovered/wild-type CFU recovered)]; based on this equation, values of less than 0 indicated that the wild-type strain outcompeted the mutant. Experiments were repeated two to three times, and combined data are shown.

Zebrafish infections.

Zebrafish used in this study were handled in accordance with IACUC-approved protocols and following standard procedures (www.zfin.org), as previously described (65). *AB zebrafish embryos were collected from mixed egg clutches in a breeding colony that was maintained on a 14-h light/10-h dark cycle. Embryos were grown at 28.5°C in E3 medium (5 mM NaCl, 0.27 mM KCl, 0.4 mM CaCl2, 0.16 mM MgSO4) containing 0.000016% methylene blue as an antifungal agent. At 48 h postfertilization (hpf), embryos were manually dechorianated, briefly anesthetized with 0.77 mM ethyl 3-aminobenzoate methanesulfonate salt (Tricaine; Sigma-Aldrich), and embedded in low-melting-point agarose (Mo Bio Laboratories) without Tricaine. Agarose-embedded embryos were then transferred to E3 medium lacking methylene blue and infected individually with wild-type CFT073 or the cpx mutants. Bacteria were grown from frozen stocks, held static in 12 ml modified M9 medium at 37°C for 24 h. One milliliter from each culture was pelleted, washed once with 1 ml PBS, and resuspended in PBS prior to inoculation into either the pericardial cavity or circulation valley by using an Olympus SZ61 or SZX10 stereomicroscope together with a YOU-1 micromanipulator (Narishige), a Narishige IM-200 microinjector, and a JUN-AIR model 3 compressor setup. For each bacterial strain, 500 to 1,000 CFU suspended in 1 nl PBS was injected per fish. Inoculation titers were determined by adding 10 drops (1 nl each) to 1 ml 0.7% NaCl, which was then serially diluted and plated on LB agar plates. Following injection, embryos were carefully removed from the agar, placed individually into wells of a 48-well plate (Nunc) containing E3 medium, and incubated at 28.5°C. Fish viability was assessed at regular intervals for 72 h following injection by monitoring heart beats and blood flow.

Bacterial host cell association and invasion assays.

Host cell association and gentamicin protection-based invasion assays were performed as previously described (66, 67). Strains used in these assays were grown at 37°C for 48 h in static LB broth to induce expression of type 1 pili. Human bladder epithelial cells, designated 5637 (HTB-9; ATCC), were grown at 37°C in 5% CO2 using RPMI 1640 medium (Invitrogen) supplemented with 10% heat-inactivated fetal bovine serum (HyClone). Bladder cells were infected with a multiplicity of infection of ∼15 bacteria per host cell.

Serum resistance assays.

Frozen aliquots of pooled human sera, taken from 7 healthy volunteers by using standard protocols approved by the University of Utah Institutional Review Board, were provided by Andrew Weyrich. Care was taken to not freeze and thaw samples multiple times. Bacteria from overnight cultures grown with shaking at 37°C in modified M9 medium were pelleted by spinning at 8,000 × g for 5 min, washed twice, and resuspended in PBS to obtain ∼1 × 106 CFU/ml. About 5 × 104 CFU of each bacterial strain was mixed individually with modified M9 medium containing 20% serum, and 200-μl aliquots of each suspension were immediately placed in a 96-well microtiter plate and incubated with gentle shaking for 2.5 h at 37°C. Plates were then placed on ice, and surviving bacteria were enumerated by plating serial dilutions on LB agar. Results were normalized to input titers. Heat-inactivated serum (treated at 55°C for 30 min) was used as a negative control.

Statistical analysis.

The Mann-Whitney U test, Wilcoxon matched pair test, log-rank (Mantel-Cox) test, and Student's t test were performed using Prism 5.01 software (GraphPad Software). P values of less than 0.05 were defined as significant.

RESULTS

The Cpx system modulates UPEC resistance to amikacin.

By using lambda Red-mediated linear recombination, the cpxRA operon and the cpxP gene were individually deleted from two reference UPEC strains, the cystitis isolate UTI89 and the urosepsis isolate CFT073. As the first step in our efforts to phenotypically characterize these mutants, we assessed their sensitivities to the aminoglycoside antibiotic amikacin. Previous studies showed that laboratory K-12 E. coli strains lacking cpxA or cpxRA have increased sensitivity to amikacin, whereas induction of the Cpx pathway or the expression of constitutively active cpxA mutants (cpxA*) provides strains with improved resistance to amikacin (6870). Resistance has been attributed to the ability of the Cpx system to activate transcription of drug exporters as well as factors that help alleviate the stress of mistranslated proteins that may accumulate within the bacterial envelope due to amikacin effects on ribosome activity (25, 70, 71).
In agreement with results obtained using K-12 strains (68, 69), we observed that both UTI89ΔcpxRA and CFT073ΔcpxRA were highly sensitive to amikacin relative to their wild-type counterparts, as determined by MIC assays (Table 3). Plasmid pJLJ42, which carries the cpxRA operon under the control of its native promoter, complemented both ΔcpxRA mutants, whereas the empty vector pGEN-MCS had no effect (Table 3 and unpublished observations). Deletion of cpxP, which leaves CpxA less repressed (40, 45), rendered UTI89 and CFT073 notably more resistant to amikacin (Table 3). Expression of recombinant cpxP using plasmid pJLJ41 restored the resistance of the ΔcpxP mutants to wild-type levels. Of note, deletion of the gene yiiP (fieF) located immediately downstream of cpxP did not affect the sensitivity of either UTI89 or CFT073 to amikacin (unpublished observations).
Table 3
Table 3 Amikacin MIC assay resultsa
StrainMIC (μg/ml)
UTI8918
UTI89ΔcpxRA6
UTI89ΔcpxP28
UTI89(pGEN-MCS)16
UTI89ΔcpxRA(pJLJ42)30
UTI89ΔcpxP(pJLJ41p)18
CFT07320
CFT073ΔcpxRA6
CFT073ΔcpxP30
CFT073(pGEN-MCS)20
CFT073ΔcpxRA(pJLJ42)16
CFT073ΔcpxP(pJLJ41p)20
a
The assay was repeated three times and the same results were obtained.
These results indicate that the Cpx response in the UPEC isolates operates, not unexpectedly, similarly to the Cpx response in K-12 strains. To further address this point, we utilized a low-copy-number reporter construct containing the cpxP promoter fused to a promoterless luxCDABE operon (39). In both CFT073 and UTI89, the deletion of cpxRA ablated expression of the cpxP reporter in early-stationary-phase cultures, whereas deletion of cpxP greatly enhanced expression (Fig. 1). These data parallel those reported for similar assays carried out with K-12 strains, supporting models in which CpxP functions in part as a negative regulator of Cpx activation (40, 45).
Fig 1
Fig 1 Deletion of cpxP enhances Cpx activation in both CFT073 and UTI89. Graphs indicate expression levels (± standard deviations) of the luxCDABE operon driven by the cpxP promoter in wild-type UTI89 (A) and wild-type CFT073 (B) and their mutant derivatives, following growth to early stationary phase in modified M9 medium. The pNLP1-lux plasmid carries a promoterless luxCDABE operon. Each graph shows the means ± standard errors of the means of three independent experiments performed in triplicate.

The Cpx system provides UPEC with a fitness advantage within the bladder.

To address whether or not the Cpx system can affect the fitness of UPEC within the urinary tract, we utilized a well-established UTI model system, focusing on bladder colonization by the cystitis isolate UTI89. Adult female CBA/J mice were inoculated via transurethral catheterization with wild-type UTI89, UTI89ΔcpxRA or UTI89ΔcpxP, and 3 days later bacterial titers within the bladder were determined. In noncompetitive assays, in which equal numbers of the wild-type and mutant strains were inoculated separately into different mice, the ΔcpxRA mutant was recovered in significantly lower numbers than wild-type UTI89 (Fig. 2A). In contrast, no significant difference was observed between wild-type UTI89 and the ΔcpxP mutant. Similar results were obtained in competitive assays, in which the wild-type strain was mixed 1:1 with each mutant strain prior to inoculation (Fig. 2B and C). These results indicated that cpxRA, but not cpxP, is required by UTI89 to effectively colonize the bladder.
Fig 2
Fig 2 The Cpx system promotes UPEC fitness within the bladder. Adult female CBA/J mice were infected via catheterization with wild-type UTI89, UTI89ΔcpxP, or UTI89ΔcpxRA in noncompetitive (A) and competitive (B and C) assays. Graphs show bacterial titers present in the bladder at 3 days postinoculation. Bars denote median values for each group (n ≥ 12 mice). The data in panel B are graphed in panel C as competitive indices. P values were determined using the Mann-Whitney U test (A) or Wilcoxon-matched paired signed rank test (B). ns, no significant difference.
During the course of a UTI, UPEC comes across a variety of environmental stresses that can potentially limit its survival and growth within the host (1015). These stresses include reactive nitrogen and oxygen radicals and numerous membrane-damaging substances. In LB broth and modified M9 medium, the cpxRA and cpxP deletion mutants grew normally, whether on their own in monoculture or in direct competition with the wild-type strains (Fig. 3). Likewise, no defects were observed with the ΔcpxRA or ΔcpxP mutants when challenged in vitro with nitrosative stress (1 mM acidified sodium nitrite), oxidative stress (0.5 or 1 M methyl viologen), or envelope stress generated by addition of 0.1% sodium dodecyl sulfate (unpublished observations). These findings indicate that deletion of cpxRA or cpxP does not alter the ability of UPEC to handle generalized stresses.
Fig 3
Fig 3 CFT073 and UTI89 mutants lacking either cpxP or cpxRA grow normally in LB broth and modified M9 medim. (A and B) Growth of wild-type UTI89 and associated ΔcpxP and ΔcpxRA mutants grown in LB broth (A) and modified M9 medium (B). Graphs are representative of at least three independent experiments performed in quadruplicate. (C to F) Results of competitive growth assays carried out in modified M9 medium with wild-type CFT073 and UTI89 versus isogenic ΔcpxRA or ΔcpxP mutants, as indicated. Data are presented as box-and-whiskers plots, with means ± the minimum and maximum values from three independent experiments.

Divergent effects of the Cpx system on host cell invasion by UPEC.

Effective colonization of the bladder by UPEC generally requires the expression of functional type 1 pili (63, 7275). These filamentous adhesive organelles mediate bacterial attachment to and invasion of bladder epithelial cells, promoting the establishment and persistence of UPEC within the urinary tract (5, 6, 63, 76). In yeast agglutination assays, as well as hemagglutination assays performed using guinea pig red blood cells, we observed no overt differences in the expression of type 1 pili by the ΔcpxRA or ΔcpxP mutants relative to the wild-type UPEC isolates (unpublished observations). However, UTI89ΔcpxRA did show a slight, but significant (∼20%), decrease in its ability to adhere to human bladder epithelial cells in culture (Fig. 4A). This reduction in adherence corresponded with a similar (∼30%) decrease in host cell invasion by UTI89ΔcpxRA, as determined in gentamicin protection assays (Fig. 4B). These modest defects in host cell adherence and invasion could be rescued by complementation of the ΔcpxRA mutant with pJLJ42. In contrast to UTI89ΔcpxRA, the ΔcpxP mutant had no defect in its ability to bind bladder epithelial cells (Fig. 4A), but it was able to invade the host cells at a much higher frequency than either wild-type UTI89 or the ΔcpxRA mutant (Fig. 4B). Complementation of UTI89ΔcpxP with pJLJ42 reduced the invasion frequencies of this mutant to wild-type levels. Importantly, wild-type UTI89 and the ΔcpxRA and ΔcpxP mutants grew similarly in the cell culture medium, and all three strains were equally susceptible to killing by gentamicin at the concentration (100 μg/ml) used in these invasion assays.
Fig 4
Fig 4 Cpx effects on bladder cell invasion by UTI89. Human bladder epithelial cells were infected with the indicated strains for 2 h, followed by an additional 2-h incubation in medium containing gentamicin (100 μg/ml). Graphs show the total cell-associated bacterial titers prior to addition of gentamicin (A) and for gentamicin-protected, intracellular bacteria (B). Data are expressed relative to wild-type UTI89 (black bars) or UTI89 carrying the control plasmid pGEN-MCS (gray bars) as the means ± standard errors of the means of at least three independent experiments performed in triplicate. The indicated P values were calculated using Student's t test.

Cpx components promote UPEC virulence in zebrafish.

To assess effects of the Cpx system on UPEC virulence, and not fitness per se, we next focused on CFT073 in a zebrafish infection model that was recently developed in our laboratory (65). In this model system, bacteria are microinjected into 48-hpf zebrafish embryos via either a fluid-filled sac surrounding the heart, known as the pericardial cavity (PC), or directly into the bloodstream through the circulation valley. UPEC does not usually spread from the PC, whereas the pathogens rapidly disseminate systemically following inoculation of the bloodstream. At 48 hpf, zebrafish are dependent upon innate host defenses that include phagocytes, antimicrobial peptides, and complement—the same sort of defenses that mammalian hosts employ against UPEC (7781). The use of zebrafish has proven to be an effective way to identify and functionally define virulence factors of relevance to UPEC and related pathogens that can colonize an assorted array of hosts and host tissues (unpublished observations and references 65 and 82).
Relative to UTI89 and many other UPEC isolates, CFT073 is especially lethal to zebrafish embryos (65). Here, we compared the lethality of wild-type CFT073 to CFT073ΔcpxRA and CFT073ΔcpxP following inoculation of 500 to 1,000 CFU of each strain individually into the PC or blood. In this infection model, increased bacterial growth correlates with decreased host survival (65). Wild-type CFT073 killed most of the zebrafish embryos within 24 h, irrespective of the site of inoculation (Fig. 5). In comparison to the wild-type strain, the virulence of both the ΔcpxRA and ΔcpxP mutants was significantly decreased. Virulence defects associated with CFT073ΔcpxRA and CFT073ΔcpxP were particularly evident following inoculation of the blood (Fig. 5B), which in general appears to be a more challenging and stressful environment than the PC (65). Wild-type CFT073 and the ΔcpxRA and ΔcpxP mutants grew similarly in modified M9 minimal medium at 28.5°C, the temperature at which the zebrafish embryos are maintained. Plasmid pJLJ42 (cpxRA) and pJLJ41 (cpxP) rescued the virulence defects associated with CFT073ΔcpxRA and CFT073ΔcpxP, respectively, but the wild-type strain carrying empty vector was attenuated, complicating interpretation of our in vivo complementation assays (unpublished observations).
Fig 5
Fig 5 The Cpx system is required for full virulence of CFT073 in zebrafish embryos. The PC (A) or blood (B) of 48-hpf zebrafish embryos was inoculated with 500 to 1,000 CFU of wild-type CFT073, CFT073ΔcpxP, or CFT073ΔcpxRA, as indicated. Fish were scored for death at 0, 24, 48, and 72 h postinoculation. Data are expressed as the percent survival over time (n ≥ 17 embryos). P ≤ 0.0008 for the ΔcpxP and ΔcpxRA mutants versus control wild-type CFT073, as determined using Mantel-Cox log rank tests.

Strain-dependent effects of Cpx components on serum resistance.

Urine, like serum, contains numerous antibacterial factors, including heat-labile components of the complement system that can mediate bacterial opsonization and the formation of membrane attack complexes (14, 8385). By modulating the composition and resilience of the bacterial envelope, we hypothesized that the Cpx system can alter the sensitivity of UPEC to serum components. To examine this possibility, serum resistance assays were performed using wild-type UTI89 and CFT073 along with the ΔcpxRA and ΔcpxP mutants. In these assays, both UTI89ΔcpxRA and CFT073ΔcpxRA were significantly more sensitive to pooled human sera than their wild-type counterparts (Fig. 6A). UTI89ΔcpxP was likewise sensitive, whereas CFT073ΔcpxP showed no decrease in serum resistance relative to wild-type CFT073. Serum resistance defects associated with UTI89ΔcpxRA, CFT073ΔcpxRA, and UTI89ΔcpxP were rescued by plasmids carrying CpxRA (pJLJ42) or CpxP (pJLJ41), as appropriate (Fig. 6B). In assays that used heat-inactivated serum, which lacks functional complement, no differences were observed between the wild-type and mutant strains (Fig. 6C). Together, these data indicate that CpxRA, with strain-dependent input from CpxP, can enhance UPEC resistance to serum and, specifically, complement.
Fig 6
Fig 6 Cpx components have strain-dependent effects on serum resistance. About 5 × 104 CFU of wild-type UTI89 or CFT073 or their mutant derivatives were incubated at 37°C with gentle shaking in modified M9 medium containing 20% human serum (A) or 20% heat-inactivated serum (C). After 2.5 h, surviving bacteria were enumerated by plating serial dilutions. (B) Similar assays with 20% serum were performed using strains carrying plasmids pJLJ41 or pJLJ42 or the control empty vector, pGEN-MCS, as indicated. Data are presented relative to the wild-type strains as the means ± standard errors of the means of at least four independent experiments. In panel B, the control wild-type strains carried pGEN-MCS. *, P < 0.007; **, P = 0.02 (determined with Student's t test).

DISCUSSION

This study was aimed at delineating the impact of the Cpx envelope stress response system on the fitness and virulence of UPEC. Our results demonstrated that CpxRA and the auxiliary factor CpxP can affect the ability of UPEC to colonize distinct host environments. Employing a well-established mouse UTI model, we found that deletion of cpxRA limited the ability of the reference cystitis isolate UTI89 to effectively colonize the bladder, whereas deletion of cpxP had only modest effects. In laboratory K-12 E. coli strains, CpxP is not an essential regulator of the Cpx system, and instead it appears to modulate how quickly CpxA can be activated or inactivated in response to changing levels of envelope stress (20, 40, 43, 45). Within the bladder, the regulatory effects of CpxP are apparently dispensable to UTI89, at least at the 3-day time point that was analyzed. In contrast, deletion of either cpxRA or cpxP markedly attenuated the virulence of the urosepsis isolate CFT073 during both localized and systemic infections in zebrafish embryos. These data suggest that CpxP is differentially required by UPEC, depending upon strain background and the host environment. This idea was further supported by in vitro assays that showed that the resistance of UTI89 to complement-mediated killing was dependent upon both CpxRA and CpxP, while CFT073 required only CpxRA.
The Cpx system is intercalated within a complex web of signaling cascades and linked up with multiple biosynthetic and metabolic pathways (25, 38, 39, 41, 45, 8688), making it difficult to discern with clarity the specific mechanisms by which Cpx components moderate UPEC stress resistance and virulence phenotypes. It is clear, however, that basic regulation of the Cpx system in UPEC functions similarly to the Cpx system in nonpathogenic K-12 E. coli strains. In K-12 strains, CpxP regulates Cpx activation via a negative feedback loop (40), and this also appears to be the case in UPEC (Fig. 1). Furthermore, deletion of cpxRA rendered both UTI89 and CFT073 highly sensitive to the aminoglycoside amikacin (at 3 μg/ml), whereas deletion of cpxP increased amikacin resistance. These data are in agreement with work carried out in K-12 strains (6870) and support the notion that activation of the Cpx system safeguards against aminoglycoside antibiotics. Protection is likely afforded by Cpx-mediated upregulation of proteases and other factors that alleviate envelope stress initiated by the mistranslation of inner membrane proteins in the presence of amikacin (70). Cpx activation may also heighten bacterial resistance to antibiotics via effects on the expression of drug transporters (25, 71).
The protective effects of Cpx activation are limited and will not shield against all concentrations and types of antibiotics, including the aminoglycoside gentamicin, used in our host cell invasion assays (70). This means that the slight but significant decrease in host cell invasion by UTI89ΔcpxRA and the elevated invasion frequencies seen with UTI89ΔcpxP are likely not attributable to Cpx-regulated effects on the susceptibility of UTI89 to gentamicin. Instead, the Cpx system may affect bacterial survival during or immediately after internalization or, alternatively, modulate the efficacy of the invasion process directly by affecting the surface characteristics of UPEC. The latter possibility is buoyed indirectly by observations showing that disruption of the Cpx system can alter bacterial interactions with hydrophobic abiotic surfaces (89). Of note, UPEC mutants lacking either cpxRA or cpxP were not obviously different from the wild-type strains with respect to motility, biofilm formation in microtiter plate assays, or the expression of curli or type 1 pili (unpublished observations). This indicates that many of the phenotypes commonly associated with UPEC virulence are unaffected by disruption of the Cpx system.
The reduced capacity of UTI89ΔcpxRA to bind and invade bladder epithelial cells may contribute to the inability of this mutant to effectively colonize the bladder. However, it is probable that additional CpxRA-regulated activities also play a role. These activities may include Cpx-mediated alterations of the bacterial envelope and peptidoglycan layer that enable bacteria to better deal with antimicrobial peptides and proteins like complement (90). The complement system can mediate bacterial opsonization and the formation of membrane attack complexes, thereby facilitating the clearance of bacteria during both localized and systemic infections (83). The strain-dependent requirement for CpxP in UPEC resistance to complement-mediated killing, as reported here (Fig. 6), highlights the individuality of UPEC isolates, which are often genetically diverse, while also raising questions regarding the functionality of highly conserved proteins like CpxP.
In addition to modulating the activity of CpxA, CpxP can function as a periplasmic chaperone and may act as a sensor for metal ions, like zinc and copper (43, 44, 91, 92). UTI89 is apparently more dependent upon one or more of these activities when challenged with complement, whereas CFT073 can make do without CpxP. It is feasible that structural homologues of CpxP, such as Spy and ZraP (9294), can substitute for CpxP under specific conditions in strains like CFT073. The Cpx system is best known for its effects on the expression of periplasmic chaperones and proteases in response to envelope stress, and the misregulation of these and other factors likely contribute to the myriad defects observed with the ΔcpxP and ΔcpxRA mutants in our assays.

ACKNOWLEDGMENTS

We thank Tamara Smith in the laboratory of Andrew Weyrich (University of Utah, Department of Human Genetics) for providing the human serum samples and Travis Wiles from our laboratory for initial assistance with the serum resistance assays. We are also grateful to Jacqueline Engel for help with characterization of the yiiP (fieF) mutants and Tracy Raivio for providing plasmids pNLP10-lux and pJW1-cpxP-lux.
This work was supported by grants AI095647, AI090369, and AI088086 from the National Institute of Allergy and Infectious Diseases. A.E.B. and R.R.K. were supported by NIH Microbial Pathogenesis Training Grant T32 AI055434, while J.P.N. was supported by NIH Genetics Training Grant T32-GM007464.

REFERENCES

1.
Foxman B. 2010. The epidemiology of urinary tract infection. Nature Rev. Urol. 7:653–660.
2.
Dhakal BK, Kulesus RR, and Mulvey MA. 2008. Mechanisms and consequences of bladder cell invasion by uropathogenic Escherichia coli. Eur. J. Clin. Invest. 38(Suppl. 2):2–11.
3.
Hunstad DA and Justice SS. 2010. Intracellular lifestyles and immune evasion strategies of uropathogenic Escherichia coli. Annu. Rev. Microbiol. 64:203–221.
4.
Jorgensen I and Seed PC. 2012. How to make it in the urinary tract: a tutorial by Escherichia coli. PLoS Pathog. 8:e1002907. doi:https://doi.org/10.1371/journal.ppat.1002907.
5.
Blango MG and Mulvey MA. 2010. Persistence of uropathogenic Escherichia coli in the face of multiple antibiotics. Antimicrob. Agents Chemother. 54:1855–1863.
6.
Mulvey MA, Schilling JD, and Hultgren SJ. 2001. Establishment of a persistent Escherichia coli reservoir during the acute phase of a bladder infection. Infect. Immun. 69:4572–4579.
7.
Sobel JD. 1997. Pathogenesis of urinary tract infection. Role of host defenses. Infect. Dis. Clin. North Am. 11:531–549.
8.
Muhldorfer I, Ziebuhr W, and Hacker J. 2001. Escherichia coli in urinary tract infections, p 1739–1748. In Sussman M (ed), Molecular medical microbiology. Academic Press, London, England.
9.
Smith JL, Fratamico PM, and Gunther NW. 2007. Extraintestinal pathogenic Escherichia coli. Foodborne Pathog. Dis. 4:134–163.
10.
Ragnarsdottir B, Lutay N, Gronberg-Hernandez J, Koves B, and Svanborg C. 2011. Genetics of innate immunity and UTI susceptibility. Nat. Rev. Urol. 8:449–468.
11.
Zasloff M. 2007. Antimicrobial peptides, innate immunity, and the normally sterile urinary tract. J. Am. Soc. Nephrol. 18:2810–2816.
12.
Bower JM, Gordon-Raagas HB, and Mulvey MA. 2009. Conditioning of uropathogenic Escherichia coli for enhanced colonization of host. Infect. Immun. 77:2104–2112.
13.
Alteri CJ and Mobley HL. 2012. Escherichia coli physiology and metabolism dictates adaptation to diverse host microenvironments. Curr. Opin. Microbiol. 15:3–9.
14.
Li K, Feito MJ, Sacks SH, and Sheerin NS. 2006. CD46 (membrane cofactor protein) acts as a human epithelial cell receptor for internalization of opsonized uropathogenic Escherichia coli. J. Immunol. 177:2543–2551.
15.
Mulvey MA, Schilling JD, Martinez JJ, and Hultgren SJ. 2000. Bad bugs and beleaguered bladders: interplay between uropathogenic Escherichia coli and innate host defenses. Proc. Natl. Acad. Sci. U. S. A. 97:8829–8835.
16.
MacRitchie DM, Buelow DR, Price NL, and Raivio TL. 2008. Two-component signaling and gram negative envelope stress response systems. Adv. Exp. Med. Biol. 631:80–110.
17.
Raivio TL. 2005. Envelope stress responses and Gram-negative bacterial pathogenesis. Mol. Microbiol. 56:1119–1128.
18.
Ruiz N and Silhavy TJ. 2005. Sensing external stress: watchdogs of the Escherichia coli cell envelope. Curr. Opin. Microbiol. 8:122–126.
19.
Joly N, Engl Jovanovic CG, Huvet M, Toni T, Sheng X, Stumpf MP, and Buck M. 2010. Managing membrane stress: the phage shock protein (Psp) response, from molecular mechanisms to physiology. FEMS Microbiol. Rev. 34:797–827.
20.
Vogt SL and Raivio TL. 2012. Just scratching the surface: an expanding view of the Cpx envelope stress response. FEMS Microbiol. Lett. 326:2–11.
21.
Weber RF and Silverman PM. 1988. The cpx proteins of Escherichia coli K12. Structure of the cpxA polypeptide as an inner membrane component. J. Mol. Biol. 203:467–478.
22.
Dong J, Iuchi S, Kwan S, Lu Z, and Lin EC. 1993. The deduced amino-acid sequence of the cloned cpxR gene suggests the protein is the cognate regulator for the membrane sensor, CpxA, in a two-component signal transduction system of Escherichia coli. Gene 136:227–230.
23.
Otto K and Silhavy TJ. 2002. Surface sensing and adhesion of Escherichia coli controlled by the Cpx-signaling pathway. Proc. Natl. Acad. Sci. U. S. A. 99:2287–2292.
24.
Prigent-Combaret C, Brombacher E, Vidal O, Ambert A, Lejeune P, Landini P, and Dorel C. 2001. Complex regulatory network controls initial adhesion and biofilm formation in Escherichia coli via regulation of the csgD gene. J. Bacteriol. 183:7213–7223.
25.
Dorel C, Lejeune P, and Rodrigue A. 2006. The Cpx system of Escherichia coli, a strategic signaling pathway for confronting adverse conditions and for settling biofilm communities? Res. Microbiol. 157:306–314.
26.
Dorel C, Vidal O, Prigent-Combaret C, Vallet I, and Lejeune P. 1999. Involvement of the Cpx signal transduction pathway of E. coli in biofilm formation. FEMS Microbiol. Lett. 178:169–175.
27.
Hung DL, Raivio TL, Jones CH, Silhavy TJ, and Hultgren SJ. 2001. Cpx signaling pathway monitors biogenesis and affects assembly and expression of P pili. EMBO J. 20:1508–1518.
28.
Hernday AD, Braaten BA, Broitman-Maduro G, Engelberts P, and Low DA. 2004. Regulation of the pap epigenetic switch by CpxAR: phosphorylated CpxR inhibits transition to the phase ON state by competition with Lrp. Mol. Cell 16:537–547.
29.
Inoue T, Shingaki R, Hirose S, Waki K, Mori H, and Fukui K. 2007. Genome-wide screening of genes required for swarming motility in Escherichia coli K-12. J. Bacteriol. 189:950–957.
30.
De Wulf P, Kwon O, and Lin EC. 1999. The CpxRA signal transduction system of Escherichia coli: growth-related autoactivation and control of unanticipated target operons. J. Bacteriol. 181:6772–6778.
31.
Gal-Mor O and Segal G. 2003. Identification of CpxR as a positive regulator of icm and dot virulence genes of Legionella pneumophila. J. Bacteriol. 185:4908–4919.
32.
Nevesinjac AZ and Raivio TL. 2005. The Cpx envelope stress response affects expression of the type IV bundle-forming pili of enteropathogenic Escherichia coli. J. Bacteriol. 187:672–686.
33.
Nakayama S and Watanabe H. 1995. Involvement of cpxA, a sensor of a two-component regulatory system, in the pH-dependent regulation of expression of Shigella sonnei virF gene. J. Bacteriol. 177:5062–5069.
34.
Nakayama S and Watanabe H. 1998. Identification of cpxR as a positive regulator essential for expression of the Shigella sonnei virF gene. J. Bacteriol. 180:3522–3528.
35.
Mitobe J, Arakawa E, and Watanabe H. 2005. A sensor of the two-component system CpxA affects expression of the type III secretion system through posttranscriptional processing of InvE. J. Bacteriol. 187:107–113.
36.
Mulvey MA. 2002. Adhesion and entry of uropathogenic Escherichia coli. Cell. Microbiol. 4:257–271.
37.
Herbert EE, Cowles KN, and Goodrich-Blair H. 2007. CpxRA regulates mutualism and pathogenesis in Xenorhabdus nematophila. Appl. Environ. Microbiol. 73:7826–7836.
38.
De Wulf P, McGuire AM, Liu X, and Lin EC. 2002. Genome-wide profiling of promoter recognition by the two-component response regulator CpxR-P in Escherichia coli. J. Biol. Chem. 277:26652–26661.
39.
Price NL and Raivio TL. 2009. Characterization of the Cpx regulon in Escherichia coli strain MC4100. J. Bacteriol. 191:1798–1815.
40.
Raivio TL, Popkin DL, and Silhavy TJ. 1999. The Cpx envelope stress response is controlled by amplification and feedback inhibition. J. Bacteriol. 181:5263–5272.
41.
Hunke S, Keller R, and Muller VS. 2012. Signal integration by the Cpx-envelope stress system. FEMS Microbiol. Lett. 326:12–22.
42.
DiGiuseppe PA and Silhavy TJ. 2003. Signal detection and target gene induction by the CpxRA two-component system. J. Bacteriol. 185:2432–2440.
43.
Buelow DR and Raivio TL. 2005. Cpx signal transduction is influenced by a conserved N-terminal domain in the novel inhibitor CpxP and the periplasmic protease DegP. J. Bacteriol. 187:6622–6630.
44.
Isaac DD, Pinkner JS, Hultgren SJ, and Silhavy TJ. 2005. The extracytoplasmic adaptor protein CpxP is degraded with substrate by DegP. Proc. Natl. Acad. Sci. U. S. A. 102:17775–17779.
45.
Buelow DR and Raivio TL. 2010. Three (and more) component regulatory systems: auxiliary regulators of bacterial histidine kinases. Mol. Microbiol. 75:547–566.
46.
Leclerc GJ, Tartera C, and Metcalf ES. 1998. Environmental regulation of Salmonella typhi invasion-defective mutants. Infect. Immun. 66:682–691.
47.
Humphreys S, Rowley G, Stevenson A, Anjum MF, Woodward MJ, Gilbert S, Kormanec J, and Roberts M. 2004. Role of the two-component regulator CpxAR in the virulence of Salmonella enterica serotype Typhimurium. Infect. Immun. 72:4654–4661.
48.
Altman E and Segal G. 2008. The response regulator CpxR directly regulates expression of several Legionella pneumophila icm/dot components as well as new translocated substrates. J. Bacteriol. 190:1985–1996.
49.
MacRitchie DM, Acosta N, and Raivio TL. 2012. DegP is involved in Cpx-mediated posttranscriptional regulation of the type III secretion apparatus in enteropathogenic Escherichia coli. Infect. Immun. 80:1766–1772.
50.
Leuko S and Raivio TL. 2012. Mutations that impact the enteropathogenic Escherichia coli Cpx envelope stress response attenuate virulence in Galleria mellonella. Infect. Immun. 80:3077–3085.
51.
Ojha S, Lacouture S, Gottschalk M, and MacInnes JI. 2010. Characterization of colonization-deficient mutants of Actinobacillus suis. Vet. Microbiol. 140:122–130.
52.
Labandeira-Rey M, Brautigam CA, and Hansen EJ. 2010. Characterization of the CpxRA regulon in Haemophilus ducreyi. Infect. Immun. 78:4779–4791.
53.
Spinola SM, Fortney KR, Baker B, Janowicz DM, Zwickl B, Katz BP, Blick RJ, and Munson RS Jr. 2010. Activation of the CpxRA system by deletion of cpxA impairs the ability of Haemophilus ducreyi to infect humans. Infect. Immun. 78:3898–3904.
54.
Herbert Tran EE and Goodrich-Blair H. 2009. CpxRA contributes to Xenorhabdus nematophila virulence through regulation of lrhA and modulation of insect immunity. Appl. Environ. Microbiol. 75:3998–4006.
55.
Liu J, Obi IR, Thanikkal EJ, Kieselbach T, and Francis MS. 2011. Phosphorylated CpxR restricts production of the RovA global regulator in Yersinia pseudotuberculosis. PLoS One 6:e23314. doi:https://doi.org/10.1371/journal.pone.0023314.
56.
Carlsson KE, Liu J, Edqvist PJ, and Francis MS. 2007. Influence of the Cpx extracytoplasmic-stress-responsive pathway on Yersinia sp.-eukaryotic cell contact. Infect. Immun. 75:4386–4399.
57.
Liu J, Thanikkal EJ, Obi IR, and Francis MS. 2012. Elevated CpxR∼P levels repress the Ysc-Yop type III secretion system of Yersinia pseudotuberculosis. Res. Microbiol. 163:518–530.
58.
Jones CH, Danese PN, Pinkner JS, Silhavy TJ, and Hultgren SJ. 1997. The chaperone-assisted membrane release and folding pathway is sensed by two signal transduction systems. EMBO J. 16:6394–6406.
59.
Datsenko KA and Wanner BL. 2000. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. U. S. A. 97:6640–6645.
60.
Murphy KC and Campellone KG. 2003. Lambda Red-mediated recombinogenic engineering of enterohemorrhagic and enteropathogenic E. coli. BMC Mol. Biol. 4:11. doi:https://doi.org/10.1186/1741-2199-4-11.
61.
Lane MC, Alteri CJ, Smith SN, and Mobley HL. 2007. Expression of flagella is coincident with uropathogenic Escherichia coli ascension to the upper urinary tract. Proc. Natl. Acad. Sci. U. S. A. 104:16669–16674.
62.
Slonim LN, Pinkner JS, Branden CI, and Hultgren SJ. 1992. Interactive surface in the PapD chaperone cleft is conserved in pilus chaperone superfamily and essential in subunit recognition and assembly. EMBO J. 11:4747–4756.
63.
Mulvey MA, Lopez-Boado YS, Wilson CL, Roth R, Parks WC, Heuser J, and Hultgren SJ. 1998. Induction and evasion of host defenses by type 1-piliated uropathogenic Escherichia coli. Science 282:1494–1497.
64.
Norton JP and Mulvey MA. 2012. Toxin-antitoxin systems are important for niche-specific colonization and stress resistance of uropathogenic Escherichia coli. PLoS Pathog. 8:e1002954. doi:https://doi.org/10.1371/journal.ppat.1002954.
65.
Wiles TJ, Bower JM, Redd MJ, and Mulvey MA. 2009. Use of zebrafish to probe the divergent virulence potentials and toxin requirements of extraintestinal pathogenic Escherichia coli. PLoS Pathog. 5:e1000697. doi:https://doi.org/10.1371/journal.ppat.1000697.
66.
Dhakal BK and Mulvey MA. 2009. Uropathogenic Escherichia coli invades host cells via an HDAC6-modulated microtubule-dependent pathway. J. Biol. Chem. 284:446–454.
67.
Eto DS, Gordon HB, Dhakal BK, Jones TA, and Mulvey MA. 2008. Clathrin, AP-2, and the NPXY-binding subset of alternate endocytic adaptors facilitate FimH-mediated bacterial invasion of host cells. Cell. Microbiol. 10:2553–2567.
68.
Rainwater S and Silverman PM. 1990. The Cpx proteins of Escherichia coli K-12: evidence that cpxA, ecfB, ssd, and eup mutations all identify the same gene. J. Bacteriol. 172:2456–2461.
69.
Mileykovskaya E and Dowhan W. 1997. The Cpx two-component signal transduction pathway is activated in Escherichia coli mutant strains lacking phosphatidylethanolamine. J. Bacteriol. 179:1029–1034.
70.
Mahoney TF and Silhavy TJ. 18 1 2013. The Cpx stress response confers resistance to some, but not all, bactericidal antibiotics. J. Bacteriol. https://doi.org/10.1128/JB02197-12.
71.
Hirakawa H, Nishino K, Hirata T, and Yamaguchi A. 2003. Comprehensive studies of drug resistance mediated by overexpression of response regulators of two-component signal transduction systems in Escherichia coli. J. Bacteriol. 185:1851–1856.
72.
Langermann S, Palaszynski S, Barnhart M, Auguste G, Pinkner JS, Burlein J, Barren P, Koenig S, Leath S, Jones CH, and Hultgren SJ. 1997. Prevention of mucosal Escherichia coli infection by FimH-adhesin-based systemic vaccination. Science 276:607–611.
73.
Connell I, Agace W, Klemm P, Schembri M, Marild S, and Svanborg C. 1996. Type 1 fimbrial expression enhances Escherichia coli virulence for the urinary tract. Proc. Natl. Acad. Sci. U. S. A. 93:9827–9832.
74.
Thankavel K, Madison B, Ikeda T, Malaviya R, Shah AH, Arumugam PM, and Abraham SN. 1997. Localization of a domain in the FimH adhesin of Escherichia coli type 1 fimbriae capable of receptor recognition and use of a domain-specific antibody to confer protection against experimental urinary tract infection. J. Clin. Invest. 100:1123–1136.
75.
Langermann S, Mollby R, Burlein JE, Palaszynski SR, Auguste CG, DeFusco A, Strouse R, Schenerman MA, Hultgren SJ, Pinkner JS, Winberg J, Guldevall L, Soderhall M, Ishikawa K, Normark S, and Koenig S. 2000. Vaccination with FimH adhesin protects cynomolgus monkeys from colonization and infection by uropathogenic Escherichia coli. J. Infect. Dis. 181:774–778.
76.
Martinez JJ, Mulvey MA, Schilling JD, Pinkner JS, and Hultgren SJ. 2000. Type 1 pilus-mediated bacterial invasion of bladder epithelial cells. EMBO J. 19:2803–2812.
77.
Trede NS, Langenau DM, Traver D, Look AT, and Zon LI. 2004. The use of zebrafish to understand immunity. Immunity 20:367–379.
78.
Li X, Wang S, Qi J, Echtenkamp SF, Chatterjee R, Wang M, Boons GJ, Dziarski R, and Gupta D. 2007. Zebrafish peptidoglycan recognition proteins are bactericidal amidases essential for defense against bacterial infections. Immunity 27:518–529.
79.
Jault C, Pichon L, and Chluba J. 2004. Toll-like receptor gene family and TIR-domain adapters in Danio rerio. Mol. Immunol. 40:759–771.
80.
Lieschke GJ, Oates AC, Crowhurst MO, Ward AC, and Layton JE. 2001. Morphologic and functional characterization of granulocytes and macrophages in embryonic and adult zebrafish. Blood 98:3087–3096.
81.
van der Vaart M, Spaink HP, and Meijer AH. 2012. Pathogen recognition and activation of the innate immune response in zebrafish. Adv. Hematol. 2012:159807. doi:https://doi.org/10.1155/2012/159807.
82.
Vigil PD, Wiles TJ, Engstrom MD, Prasov L, Mulvey MA, and Mobley HL. 2012. The repeat-in-toxin family member TosA mediates adherence of uropathogenic Escherichia coli and survival during bacteremia. Infect. Immun. 80:493–505.
83.
Rus H, Cudrici C, and Niculescu F. 2005. The role of the complement system in innate immunity. Immunol. Res. 33:103–112.
84.
Li K, Sacks SH, and Sheerin NS. 2008. The classical complement pathway plays a critical role in the opsonisation of uropathogenic Escherichia coli. Mol. Immunol. 45:954–962.
85.
Li K, Zhou W, Hong Y, Sacks SH, and Sheerin NS. 2009. Synergy between type 1 fimbriae expression and C3 opsonisation increases internalisation of E. coli by human tubular epithelial cells. BMC Microbiol. 9:64. doi:https://doi.org/10.1186/1471-2180-9-64.
86.
Gerken H, Leiser OP, Bennion D, and Misra R. 2010. Involvement and necessity of the Cpx regulon in the event of aberrant beta-barrel outer membrane protein assembly. Mol. Microbiol. 75:1033–1046.
87.
Wolfe AJ, Parikh N, Lima BP, and Zemaitaitis B. 2008. Signal integration by the two-component signal transduction response regulator CpxR. J. Bacteriol. 190:2314–2322.
88.
Jung K, Fried L, Behr S, and Heermann R. 2012. Histidine kinases and response regulators in networks. Curr. Opin. Microbiol. 15:118–124.
89.
Otto K, Norbeck J, Larsson T, Karlsson KA, and Hermansson M. 2001. Adhesion of type 1-fimbriated Escherichia coli to abiotic surfaces leads to altered composition of outer membrane proteins. J. Bacteriol. 183:2445–2453.
90.
Weatherspoon-Griffin N, Zhao G, Kong W, Kong Y, Morigen, Andrews-Polymenis H, McClelland M, and Shi Y. 2011. The CpxR/CpxA two-component system up-regulates two Tat-dependent peptidoglycan amidases to confer bacterial resistance to antimicrobial peptide. J. Biol. Chem. 286:5529–5539.
91.
Yamamoto K and Ishihama A. 2005. Transcriptional response of Escherichia coli to external copper. Mol. Microbiol. 56:215–227.
92.
Thede GL, Arthur DC, Edwards RA, Buelow DR, Wong JL, Raivio TL, and Glover JN. 2011. Structure of the periplasmic stress response protein CpxP. J. Bacteriol. 193:2149–2157.
93.
Kwon E, Kim DY, Gross CA, Gross JD, and Kim KK. 2010. The crystal structure Escherichia coli Spy. Protein Sci. 19:2252–2259.
94.
Appia-Ayme C, Hall A, Patrick E, Rajadurai S, Clarke TA, and Rowley G. 2012. ZraP is a periplasmic molecular chaperone and a repressor of the zinc-responsive two-component regulator ZraSR. Biochem. J. 442:85–93.
95.
Chen SL, Hung CS, Xu J, Reigstad CS, Magrini V, Sabo A, Blasiar D, Bieri T, Meyer RR, Ozersky P, Armstrong JR, Fulton RS, Latreille JP, Spieth J, Hooton TM, Mardis ER, Hultgren SJ, and Gordon JI. 2006. Identification of genes subject to positive selection in uropathogenic strains of Escherichia coli: a comparative genomics approach. Proc. Natl. Acad. Sci. U. S. A. 103:5977–5982.
96.
Welch RA, Burland V, Plunkett G III, Redford P, Roesch P, Rasko D, Buckles EL, Liou SR, Boutin A, Hackett J, Stroud D, Mayhew GF, Rose DJ, Zhou S, Schwartz DC, Perna NT, Mobley HL, Donnenberg MS, and Blattner FR. 2002. Extensive mosaic structure revealed by the complete genome sequence of uropathogenic Escherichia coli. Proc. Natl. Acad. Sci. U. S. A. 99:17020–17024.

Information & Contributors

Information

Published In

cover image Infection and Immunity
Infection and Immunity
Volume 81Number 5May 2013
Pages: 1450 - 1459
Editor: S. M. Payne
PubMed: 23429541

History

Received: 1 November 2012
Returned for modification: 11 December 2012
Accepted: 12 February 2013
Published online: 15 April 2013

Permissions

Request permissions for this article.

Contributors

Authors

Irina Debnath
Division of Microbiology and Immunology, Pathology Department, University of Utah, Salt Lake City, Utah, USA
J. Paul Norton
Division of Microbiology and Immunology, Pathology Department, University of Utah, Salt Lake City, Utah, USA
Amelia E. Barber
Division of Microbiology and Immunology, Pathology Department, University of Utah, Salt Lake City, Utah, USA
Elizabeth M. Ott
Division of Microbiology and Immunology, Pathology Department, University of Utah, Salt Lake City, Utah, USA
Bijaya K. Dhakal
Division of Microbiology and Immunology, Pathology Department, University of Utah, Salt Lake City, Utah, USA
Richard R. Kulesus
Division of Microbiology and Immunology, Pathology Department, University of Utah, Salt Lake City, Utah, USA
Matthew A. Mulvey
Division of Microbiology and Immunology, Pathology Department, University of Utah, Salt Lake City, Utah, USA

Editor

S. M. Payne
Editor

Notes

Address correspondence to Matthew A. Mulvey, [email protected].

Metrics & Citations

Metrics

VIEW ALL METRICS

Citations

If you have the appropriate software installed, you can download article citation data to the citation manager of your choice. Simply select your manager software from the list below and click Download.

View Options

View options

PDF/ePub

PDF/ePub

Get Access

Buy Article
Infection and Immunity Vol.81 • Issue 5 • ASM Journals Pay Per View, PPV 25
Journal Subscription
Infection and Immunity
ASM members can purchase subscriptions to journals.
Join or renew

Figures and Media

Figures

Media

Tables

Share

Share

Share the article link

Share with email

Email a colleague

Share on social media

American Society for Microbiology ("ASM") is committed to maintaining your confidence and trust with respect to the information we collect from you on websites owned and operated by ASM ("ASM Web Sites") and other sources. This Privacy Policy sets forth the information we collect about you, how we use this information and the choices you have about how we use such information.
FIND OUT MORE about the privacy policy