Free access
Research Article
21 December 2017

Validation of Putative Apicoplast-Targeting Drugs Using a Chemical Supplementation Assay in Cultured Human Malaria Parasites

ABSTRACT

Malaria parasites contain a relict plastid, the apicoplast, which is considered an excellent drug target due to its bacterial-like ancestry. Numerous parasiticidals have been proposed to target the apicoplast, but few have had their actual targets substantiated. Isopentenyl pyrophosphate (IPP) production is the sole required function of the apicoplast in the blood stage of the parasite life cycle, and IPP supplementation rescues parasites from apicoplast-perturbing drugs. Hence, any drug that kills parasites when IPP is supplied in culture must have a nonapicoplast target. Here, we use IPP supplementation to discriminate whether 23 purported apicoplast-targeting drugs are on- or off-target. We demonstrate that a prokaryotic DNA replication inhibitor (ciprofloxacin), several prokaryotic translation inhibitors (chloramphenicol, doxycycline, tetracycline, clindamycin, azithromycin, erythromycin, and clarithromycin), a tRNA synthase inhibitor (mupirocin), and two IPP synthesis pathway inhibitors (fosmidomycin and FR900098) have apicoplast targets. Intriguingly, fosmidomycin and FR900098 leave the apicoplast intact, whereas the others eventually result in apicoplast loss. Actinonin, an inhibitor of bacterial posttranslational modification, does not produce a typical delayed-death response but is rescued with IPP, thereby confirming its apicoplast target. Parasites treated with putative apicoplast fatty acid pathway inhibitors could not be rescued, demonstrating that these drugs have their primary targets outside the apicoplast, which agrees with the dispensability of the apicoplast fatty acid synthesis pathways in the blood stage of malaria parasites. IPP supplementation provides a simple test of whether a compound has a target in the apicoplast and can be used to screen novel compounds for mode of action.

INTRODUCTION

Malaria is caused by the protozoan parasite Plasmodium, and six species of Plasmodium infect humans. In 2015, 3.2 billion people in ∼100 countries were at risk for malaria, and there were 212 million infections and 429,000 deaths (1). Malaria also causes economic losses of billions of dollars in parts of the world that cannot afford it (2). Drugs are a major element of malaria control, but the specter of drug resistance is a constant worry and provides an ongoing impetus to identify new drug leads in order to stay one step ahead of the parasites.
Identification of a relict plastid (apicoplast) in Plasmodium parasites provided a new set of potential drug targets for the battle against malaria. Plastids, which ultimately derive from endosymbiotic bacteria, maintain a small genome (∼35 kb in the case of malaria parasites) that is separate from the nucleus and is prokaryotic in its structure and mode of expression (37). The apicoplast was acquired by secondary endosymbiosis prior to the separation of phylum Apicomplexa (intracellular parasites) from chromerids and dinoflagellates (photosynthetic algae) around 450 million years ago (811). The apicoplast genome encodes large subunit and small subunit rRNAs, a complete set of tRNAs, 18 ribosomal proteins, three subunits of RNA polymerase, a protein implicated in DNA replication, a translation elongation factor Tu, and a subunit of Clp protease (37, 12). Similar to other plastids, the majority of the original apicoplast DNA has undergone endosymbiotic gene transfer to the nucleus, which encodes ∼450 proteins that are targeted to the apicoplast (13).
The Plasmodium apicoplast lacks enzymes or pigments required for photosynthesis; however, it retains a number of other anabolic pathways that are indispensable at some stage of the life cycle for parasite growth or viability. These include isoprenoid precursor biosynthesis, fatty acid biosynthesis, Fe-S cluster assembly, and heme biosynthesis (1316). The apicoplast is thus indispensable, and either genetic or pharmaceutical perturbation of its activities kills parasites, making the apicoplast a valid drug target (1730).
Over the course of 20 years of Plasmodium apicoplast research, numerous apicoplast inhibitors have been postulated. Although these compounds kill parasites, few have been validated as actually perturbing the apicoplast. For instance, apicoplast type II fatty acid biosynthesis (FASII) is dispensable in the malaria parasite blood stage, which casts doubt on the mode of activity of a range of parasiticidal compounds alleged to have targets in fatty acid biosynthesis (31). Similarly, heme biosynthesis also appears to be dispensable in blood stages, yet the heme biosynthesis inhibitor succinylacetone still kills parasites (32). It is also unclear whether all the tested protein translation inhibitors postulated to inhibit apicoplast protein synthesis have sole targets in the apicoplast or whether they also inhibit translation in other compartments, such as the mitochondrion or cytosol. Furthermore, some drugs with bona fide apicoplast targets, such as the translation inhibitor azithromycin (33), also have secondary targets, namely, the blocking of host cell invasion by the merozoite stage of the parasite (34). There is thus a rather patchy understanding of how these drugs actually kill parasites, even though several are in clinical use (35, 36).
An ideal way to approach this dilemma would be to examine the effect of these compounds on parasites not dependent on their apicoplast. Yeh and DeRisi (37) showed that isopentenyl pyrophosphate (IPP) production is the sole required function of the apicoplast in the asexual blood stage, and the apicoplast could be lost by Plasmodium falciparum as long as IPP is supplied in the culture medium. This unique feature allows us to separate out the effect of any drug on the apicoplast from effects on any alternative target during the asexual blood stage of P. falciparum. Here, we used a chemical supplementation approach (37), a technique now routinely in use (30, 3842), to test the target of 23 presumed apicoplast drugs, including compounds with confirmed apicoplast targets, confirmed nonapicoplast targets, and compounds with putative apicoplast targets.

RESULTS

IPP supplementation rescues parasites only from validated apicoplast-targeting drugs.

Although IPP is now used increasingly to discriminate whether or not a drug has a target in the apicoplast, we performed IPP supplementation trials on parasites exposed to two definite nonapicoplast drugs (chloroquine and atovaquone) and two validated apicoplast drugs (azithromycin and fosmidomycin) to establish a comprehensive set of assays focused on apicoplast target validation (Table 1 and Fig. 1) (30, 3742). Chloroquine targets the food vacuole in which the parasite digests ingested hemoglobin (43, 44), and atovaquone targets the cytochrome bc1 complex in the mitochondrion (45, 46). For bona fide apicoplast-targeting drugs, we used azithromycin (which inhibits apicoplast protein synthesis by binding to the large subunit of apicoplast ribosomes) (33) and fosmidomycin, which inhibits 1-deoxy-d-xylulose 5-phosphate reductoisomerase (DXR), an enzyme of the nonmevalonate apicoplast IPP synthesis pathway (19, 4750). Our growth assays across two cycles (Table 1) confirm previous reports of immediate death (no difference between 1st- and 2nd-cycle half-maximal inhibitory concentrations [IC50s]) for chloroquine, atovaquone, and fosmidomycin, in contrast to delayed death for azithromycin, for which the IC50 is more than 100-fold lower in the second cycle (51).
TABLE 1
TABLE 1 IC50s of drugs by growth cyclea
DrugNo. of exptsIC50 (mean ± SD) (μM)
Cycle 1, 48 hCycle 2, 120 h
Chloroquine20.032 ± 0.0020.018 ± 0.002
Atovaquone20.0008 ± 0.00030.0007 ± 0.0001
Azithromycin39.8 ± 1.00.06 ± 0.02
Fosmidomycin31.0 ± 0.10.8 ± 0.2
a
A drug targeting apicoplast housekeeping functions (azithromycin) has a substantially lower IC50 in the 2nd asexual erythrocytic growth cycle. Drugs with targets outside the apicoplast (chloroquine and atovaquone) or targeting apicoplast metabolism (fosmidomycin) show little change with prolonged exposure to the drug. Each drug concentration was assayed in triplicate.
FIG 1
FIG 1 IPP supplementation only rescues parasites from validated apicoplast-targeting drugs. (A) IPP supplementation rescues parasite growth across four asexual erythrocyte cycles from bona fide apicoplast inhibitors (azithromycin [AZM] and fosmidomycin [FOS]) but not drugs with nonapicoplast targets (chloroquine [CQ] and atovaquone [ATQ]). Drug-free controls with IPP supplementation demonstrate that 200 μM IPP does not affect growth. Data are normalized to an untreated control. Each drug concentration was performed in triplicate, and the standard deviation (SD) values are shown. (B) IPP rescue from the housekeeping inhibitor azithromycin results in loss of the apicoplast genome, but the IPP synthesis inhibitor fosmidomycin did not perturb the apicoplast genome when rescued by IPP. Ratios of the organellar genome to nuclear genome are normalized to ratios determined in an untreated control. Each drug concentration was performed in triplicate, and the standard error of the mean (SEM) values are shown; 1 cycle = 48 h. (C) IPP rescue from azithromycin treatment results in the loss of apicoplast protein import capacity, as measured by proteolytic processing, while similar rescue of fosmidomycin-treated parasites does not perturb apicoplast protein import. (D) IPP rescue from azithromycin treatment results in the loss of apicoplast structure. The application of fosmidomycin with IPP supplementation does not alter apicoplast morphology. CQ, 0.02 μM, n = 2; ATQ, 0.001 μM, n = 2; AZM, 0.02 μM, n = 3; FOS, 1.0 μM, n = 3. Scale bars are 2 μm.
We tracked parasite growth for four red blood cell asexual cycles (4 × 48 h/cycle) in the presence of our four test drugs, with and without IPP (Fig. 1A). IPP supplementation clearly rescues parasites from the confirmed apicoplast drugs azithromycin and fosmidomycin but not from chloroquine or atovaquone (nonapicoplast drugs), thus validating the use of IPP to confirm apicoplast targets in growth assays (Fig. 1B and see Fig. S1A and B in the supplemental material) (37). Drug-free controls with and without IPP supplementation demonstrate that 200 μM IPP does not significantly inhibit growth (Fig. 1).

Parasites rescued with IPP lose their apicoplast genome when targeted with the housekeeping inhibitor azithromycin.

We used quantitative PCR to amplify single-copy genes on the apicoplast, mitochondrial, and nuclear genomes to monitor the ratio of organellar to nuclear genomes during the course of drug treatment and IPP rescue (37). Figure 1B demonstrates a marked decline in the apicoplast-to-nuclear genome ratio after the 2nd cycle in azithromycin-treated parasites, regardless of supplementation with IPP. At the end of the fourth cycle, the apicoplast-to-nuclear genome ratio was reduced almost 100-fold by azithromycin treatment (Fig. 1B). We conclude that the disruption of apicoplast protein synthesis by azithromycin results in a loss of the organelle DNA, similar to the effects of the protein synthesis inhibitor doxycycline (37). The mitochondrial genome-to-nuclear genome ratio did not decline (Fig. 1B), which strongly suggests that azithromycin does not target housekeeping functions in the parasite mitochondrion. In contrast, there was no change in the apicoplast-to-nuclear genome ratio (Fig. 1B) or the mitochondrial genome-to-nuclear genome ratio (Fig. 1B) in fosmidomycin-treated parasites rescued with IPP, confirming previous findings (37, 38, 52).

Parasites rescued with IPP have impaired protein import capacity when targeted with the housekeeping inhibitor azithromycin.

Apicoplast transit peptide processing is a marker of successful protein import into the apicoplast (53, 54). In the D10 ACPLGFP parasite line, the 33-kDa transit peptide/green fluorescent protein (GFP) precursor protein is cleaved to produce a 30-kDa mature (processed) protein as a consequence of being transported into apicoplast (53). Canonically, the amount of unprocessed protein is minimal, often being just barely detectable (53, 54), and our nondrugged parasites (with or without IPP supplementation) contain predominantly processed GFP (Fig. 1C). In contrast, azithromycin-treated, IPP-rescued parasites contain predominantly the unprocessed 33-kDa transit peptide/GFP precursor (Fig. 1C). Fosmidomycin-treated, IPP-rescued parasites exhibit normal protein processing equivalent to untreated parasites (Fig. 1C), which is consistent with them retaining their apicoplast genomes (Fig. 1B).

Parasites rescued with IPP have disrupted apicoplasts when targeted with the housekeeping inhibitor azithromycin.

Visualization of the apicoplast during the 4th cycle after azithromycin treatment in conjunction with IPP rescue reveals substantial disruption of apicoplast integrity (Fig. 1D). Nondrugged cells (either with or without IPP) have a single punctate apicoplast at the late-ring/early trophozoite stage (Fig. 1D). However, parasites treated with azithromycin and rescued with IPP have very diffuse GFP throughout the parasite (Fig. 1D). Conversely, fosmidomycin treatment in conjunction with IPP rescue produced parasites with healthy-looking apicoplasts (Fig. 1D), again in agreement with the other assays (38). Combined with our previous data showing the loss of the apicoplast genome (Fig. 1B) and impairment of apicoplast-specific protein processing (Fig. 1C) following azithromycin treatment, the loss of an identifiable apicoplast demonstrates that the apicoplast translation inhibitor azithromycin disrupts apicoplast integrity.
Our assays with four test compounds demonstrate the utility of IPP supplementation for discriminating between compounds that perturb the apicoplast (azithromycin and fosmidomycin) and those that do not (chloroquine and atovaquone). Tracking the survival of apicoplast DNA, assaying apicoplast protein import, and visualizing the compound's effect on GFP-labeled apicoplasts permit a detailed investigation of how a compound perturbs this vital organelle (Fig. 1). We next set out to screen a suite of compounds with alleged targets in the apicoplast to explore whether or not they indeed impact the apicoplast.

Effect of bacterial housekeeping inhibitors on the apicoplast.

The apicoplast genome must be copied, transcribed, and translated to generate the ∼30 proteins it encodes (4). Ciprofloxacin inhibits bacterial DNA gyrase A and perturbs apicoplast genome duplication (18). We observe delayed death with this drug (Table 2), confirming previous reports (18, 55). IPP rescued growth in the presence of ciprofloxacin (Table 2), and similar to azithromycin, the apicoplast genome was gradually lost (Fig. 2A), as were apicoplast protein import (Fig. 2B) and apicoplast integrity (Fig. 2C). We conclude that ciprofloxacin exclusively targets the apicoplast, likely the nucleus-encoded apicoplast-targeted DNA gyrase A (13, 56).
TABLE 2
TABLE 2 List of drugs assayed, IC50s, IPP rescue, and impact on the apicoplasta
NameNo. of exptsIC50 (mean ± SD) (μM)Growth rescue by IPP supplementationLoss of apicoplastb:Known/putative target(s)cReference(s)
Cycle 1, 48 hCycle 2, 120 hGenomeProtein importStructure
Chloroquine20.032 ± 0.0020.018 ± 0.002NANANAHeme polymerization, food vacuole43
Atovaquone20.0008 ± 0.00030.0007 ± 0.0001NANANACytochrome b, mitochondria46
Ciprofloxacin333.7 ± 3.69.1 ± 3.2++++DNA gyrase, prokaryotic DNA synthesis, apicoplast103, 104
Rifampin32.3 ± 0.31.06 ± 0.3NANANAPlastid RNA polymerase β-subunit (rpoB), apicoplast (predicted)125
Chloramphenicol2847.6 ± 58.431.4 ± 4.3++++Prokaryotic protein synthesis, apicoplast37, 94
Doxycycline512.7 ± 1.21.9 ± 0.9++++Prokaryotic protein synthesis, plastid 16S rRNA (rrnS), apicoplast126
Tetracycline364.4 ± 2.82.4 ± 1.7++++70S ribosomes, prokaryotic protein synthesis, apicoplast126
Clindamycin3262.5 ± 44.20.04 ± 0.01++++Prokaryotic protein synthesis, apicoplast121
Azithromycin39.8 ± 1.00.06 ± 0.02++++Prokaryotic protein synthesis, apicoplast18, 33, 34
Erythromycin4130.4 ± 5.65.8 ± 0.7++++Prokaryotic protein synthesis, apicoplast34, 91, 127
Clarithromycin233.0 ± 1.16.4 ± 0.3++++Prokaryotic protein synthesis, apicoplast128
Fusidic acid257.6 ± 8.932.9 ± 3.6NANANAProkaryotic protein synthesis, apicoplast (predicted)59, 60
Toltrazuril5318.8 ± 40.7108.2 ± 31.4NANANAProkaryotic protein synthesis, D1-water-splitter protein of photosystem II (psbA), apicoplast (predicted)71
Mupirocin4313.4 ± 44.40.14 ± 0.06++++Isoleucyl-tRNA synthetase (IleRS) inhibitor109, 110
Borrelidin20.0018 ± 0.00090.0017 ± 0.0008NANANABacterial and eukaryotic threonyl-tRNA synthetase (ThrRS) enzymes111114
Actinonin34.9 ± 1.11.9 ± 0.7++++Prokaryotic protein synthesis, PDF64, 69, 70
Fosmidomycin31.0 ± 0.20.8 ± 0.2+DOXP reductoisomerase and MEP cytidyltransferase (IspD) pathway, apicoplast19, 47, 48, 50, 129
FR90009821.0 ± 0.10.5 ± 0.1+DOXP reductoisomerase and MEP cytidyltransferase (IspD) pathway, apicoplast19, 39
Triclosan41.3 ± 0.30.4 ± 0.1NANANAEnoyl-ACP reductase/Fab I, type II fatty acid synthesis, apicoplast (predicted)75
Cerulenin313.4 ± 1.713.9 ± 0.2NANANAFab B/F, type II fatty acid synthesis, apicoplast (predicted)76, 77
Hexachlorophene210.9 ± 3.34.3 ± 1.5NANANAFabG inhibitor, inhibit liver stage parasite development in vitro, apicoplast (predicted)78, 79
Succinylacetone3>1,600>1,600NANANAAminolevulinic acid dehydratase, heme synthesis, apicoplast (predicted)32
Brefeldin A32.3 ± 0.51.3 ± 0.3NANANAGolgi export81, 84, 130, 131
a
Each drug concentration was assayed in triplicate.
b
NA, not applicable.
c
PDF, peptide deformylase; DOXP, 1-deoxy-d-xylulose 5-phosphate; MEP, methylerythritol phosphate; ACP, acyl carrier protein.
FIG 2
FIG 2 The effect of bacterial housekeeping inhibitors on the apicoplast. IPP rescues parasite growth from inhibitors of apicoplast housekeeping, but the parasites lose their apicoplast DNA (A), lose the ability to import apicoplast proteins (B), and lose apicoplast integrity (C). In contrast, FR900098 (an inhibitor of IPP synthesis that causes immediate death)-treated parasites maintain their apicoplast DNA (A), apicoplast protein import (B), and apicoplast integrity (C) when rescued with IPP. Genome ratios are normalized to an untreated control. Each drug concentration was performed in triplicate, and the SEM values are shown; 1 cycle = 48 h. Ciprofloxacin (CIP), 10.0 μM, n = 3; chloramphenicol (CHL), 35.0 μM, n = 2; doxycycline (DOX), 2.0 μM, n = 5; tetracycline (TET), 2.5 μM, n = 3; clindamycin (CLI), 0.05 μM, n = 3; clarithromycin (CLR), 6.5 μM, n = 2; erythromycin (ERY), 10 to 30 μM, n = 4; mupirocin (MUP), 0.2 μM, n = 4; FR980008 (FR), 1.0 μM, n = 2. Scale bars are 2 μm.
Rifampin is a bacterial transcription inhibitor proposed to act by perturbing apicoplast transcription (57, 58). We confirm a previous report that rifampin causes immediate death (51) and find that IPP supplementation does not rescue parasites from rifampin (Table 2). These data strongly imply that rifampin has a nonapicoplast target in P. falciparum. Although rifampin may interfere with apicoplast transcription, there appears to be a more immediate mode of action that effectively masks any apicoplast-specific inhibition. Because IPP cannot rescue parasites from rifampin (Table 2 and Fig. S1C), we were unable to analyze apicoplast genome perseverance, apicoplast protein import, or apicoplast morphological integrity.
Doxycycline is widely prescribed as a malaria prophylactic and causes delayed death in P. falciparum, presumably by binding to the apicoplast small subunit rRNA and blocking protein synthesis, as it does in bacteria (55). Here, we confirm previous reports (37, 38, 52) of rescue by IPP from doxycycline (Table 2), associated loss of the apicoplast genome (Fig. 2A), loss of apicoplast protein import (Fig. 2B), and apicoplast integrity (Fig. 2C), and we extend these same observations to the related compound tetracycline (Table 2 and Fig. 2).
Similar responses were seen with five other drugs that putatively target apicoplast translation, regardless of their mechanism of action. Chloramphenicol is bacteriostatic and inhibits the peptidyl transferase activity of the bacterial ribosome by binding to the small subunit rRNA, preventing peptide bond formation. Clindamycin prevents protein synthesis by binding to the 23S subunit of prokaryotic rRNA, thus inhibiting prokaryotic ribosomal translocation. Erythromycin and its derivative clarithromycin also bind to the 23S rRNA but interfere with aminoacyl translocation. Growth during treatment with any of these drugs could be rescued by IPP supplementation (Table 2). Long-term treatment with these drugs in the presence of IPP resulted in a gradual loss of the apicoplast genome (Fig. 2A), a reduction in apicoplast protein import (Fig. 2B), and a loss of apicoplast integrity (Fig. 2C). We conclude that all these bacterial translation inhibitors have their primary target in the P. falciparum apicoplast, most likely in the components of the apicoplast ribosome that are also the targets in bacteria.
Fusidic acid is a fungus-derived prokaryotic protein synthesis inhibitor that prevents the turnover of elongation factor G (EF-G) from the bacterial ribosome. We previously showed immediate death with fusidic acid (59), and Gupta et al. (60) provided evidence that it inhibits both apicoplast ribosomes and mitochondrial ribosomes. Here, we corroborate immediate death, and we were unable to rescue parasites with IPP (Table 2 and Fig. S1D), which confirms that the drug has a target beyond the apicoplast, likely the mitochondrion. IPP-supplemented rescue showed a negative impact on parasite growth with fusidic acid, although the difference is not significant (Fig. S1D). Given that 200 μM IPP supplementation is nontoxic for the parasite (Fig. 1), one explanation is that fusidic acid somehow sensitizes the parasite to IPP, but further investigation will be required to draw any firm conclusion. Immediate death from a target outside the apicoplast prevents any insight as to whether fusidic acid targets the apicoplast. Because any such inhibition would presumably cause delayed death, it is effectively masked by the immediate death, which we suspect is caused by an inhibition of mitochondrial protein synthesis, as previously inferred (60).
Mupirocin binds reversibly to the bacterial isoleucyl t-RNA synthetase preventing protein synthesis. Istvan et al. (61) identified mutations and/or copy number variations of an apicoplast-targeted isoleucyl t-RNA synthetase as conferring resistance to mupirocin. We confirm a previous report of delayed death on P. falciparum (61), and we show rescue by IPP (Table 2), loss of apicoplast DNA (Fig. 2A), impairment of apicoplast protein import (Fig. 2B), and corruption of apicoplast integrity by mupirocin (Fig. 2C), thereby reaffirming an apicoplast target.
Borrelidin is also a tRNA synthetase inhibitor, but it targets threonine tRNA synthetases. Borrelidin causes immediate death in P. falciparum, and IPP supplementation could not rescue parasites exposed to borrelidin (Table 2 and Fig. S1E). Indeed, borrelidin resembles fusidic acid in sensitizing the parasite to IPP (Fig. S1E). The data are thus consistent with a cytosolic target for borrelidin. If borrelidin impacts the apicoplast threonine tRNA synthesis, the effect could be masked by immediate death, likely through the inhibition of cytosolic translation (27).

IPP rescues parasites from the immediate death inhibitor actinonin.

Actinonin is an antibacterial that inhibits the activity of peptide deformylase, an enzyme that removes the formyl group from the formyl methionine used to initiate many bacterial proteins (6265). Actinonin also inhibits a human mitochondrial peptide deformylase and is being assessed as an antitumor agent (66). Apicoplasts harbor a peptide deformylase (13, 67), but whether or not it is the target of actinonin in malaria parasites is unclear. We confirm previous reports of antimalarial activity for actinonin (68, 69), with an IC50 in the low micromolar range (Table 2). Importantly, we demonstrate that while actinonin does not exhibit delayed death, the growth of actinonin-treated parasites can be rescued by IPP supplementation (Table 2 and Fig. 3A). We also show that actinonin-treated, IPP-rescued parasites suffer a loss of apicoplast DNA (Fig. 3B), have impaired apicoplast protein import (Fig. 3C), and have aberrant apicoplast structure (Fig. 3D). Actinonin is thus starkly different from the collection of bona fide antiapicoplast compounds described above, all of which exhibit delayed death, apparently by perturbing apicoplast housekeeping activities. We previously showed that actinonin specifically retards growth and division of the apicoplast but does not impact growth and division of the mitochondrion or nucleus (69), a finding confirmed here by our quantitative PCR (qPCR) genome analyses (Fig. 3B). Since IPP rescued malaria parasites exposed to actinonin, we tentatively conclude that actinonin primarily targets the P. falciparum apicoplast and not the parasite mitochondrion. Given that actinonin exhibits a different death kinetic to all the established apicoplast housekeeping inhibitors, it seems unlikely that it inhibits apicoplast housekeeping peptide deformylase (67). Rather, recent data demonstrate that actinonin inhibits apicoplast biogenesis in Toxoplasma gondii, and probably P. falciparum, by targeting the apicoplast membrane protein FtsH1 (70), and our results are concordant.
FIG 3
FIG 3 IPP rescues parasites from the immediate-death inhibitor actinonin. (A) IPP rescues parasite growth from actinonin (a presumed housekeeping inhibitor that is notable for exerting immediate death); however, the parasites lose their apicoplast DNA (B), lose their ability to import apicoplast proteins (C), and lose integrity of their apicoplasts (D). Genome ratios are normalized to an untreated control. Each drug concentration was performed in triplicate, and the SEM values are shown; 1 cycle = 48 h. Actinonin (ACT), 2.0 μM, n = 3; AZM, 0.02 μM, n = 3; FOS, 1.0 μM, n = 3. Scale bars are 2 μm.

IPP does not rescue parasites from a photosynthesis inhibitor.

Having explored IPP rescue as a way to verify apicoplast targets for various antibacterials with housekeeping targets, we next turned our attention to apicoplast anabolism targets. Toltrazuril, an herbicide that also kills Plasmodium parasites, is postulated to interact with the D1 (PsbA) protein of a relict photosynthetic reaction center in the apicoplast (71). Toltrazuril is also parasiticidal against the apicomplexan parasites Eimeria and Toxoplasma gondii, and in vivo against intestinal and hepatic coccidiosis in rabbits (7274). However, no psbA gene candidates have been identified in any apicomplexan genome, and there is no evidence for photosynthesis in these parasites. IPP supplementation did not rescue parasites from toltrazuril, which in any case does not exert delayed death and requires high concentrations to kill parasites (Table 2 and Fig. S1F). Our data demonstrate that this herbicide does not target the apicoplast in P. falciparum and confirm that photosynthesis is not a valid malaria drug target.

IPP supplementation rescues parasites from isoprenoid biosynthesis inhibitors but not fatty acid biosynthesis inhibitors.

As described earlier (37, 38, 41) and confirmed above, fosmidomycin inhibition could be rescued by IPP (Fig. 1A). Here, we extend these observations to the fosmidomycin analogue FR900098 (Table 2), which is also posited to target IPP synthesis in the apicoplast (19, 39, 49). Both fosmidomycin and FR900098 exhibit immediate death, and IPP supplementation restored growth (Table 2 and Fig. 4). FR900098 mimics fosmidomycin in that treated parasites rescued by IPP suffer no loss of apicoplast DNA (Fig. 2A), they maintain apicoplast protein import (Fig. 2B), and they preserve apicoplast integrity (Fig. 2C). We conclude that inhibition of the anabolic IPP synthesis pathway, either by fosmidomycin or FR900098, is an apicoplast-specific effect but results in immediate death.
FIG 4
FIG 4 IPP supplementation rescues parasites from isoprenoid biosynthesis inhibitors but not fatty acid biosynthesis inhibitors. IPP rescues parasite growth from fosmidomycin (an inhibitor of IPP synthesis that causes immediate death) but could not rescue parasites from the fatty acid biosynthesis inhibitors triclosan, cerulenin, and hexachlorophene. Data are normalized to an untreated control. Each drug concentration was performed in triplicate, and the SD values are shown; 1 cycle = 48 h. AZM, 0.02 μM, n = 3; FOS, 1.0 μM, n = 3; triclosan (TRI), 0.5 μM, n = 4; cerulenin (CRU), 14.0 μM, n = 3; hexachlorophene (HEX), 5.0 μM, n = 2.
We next turned our attention to apicoplast fatty acid biosynthesis. We confirm that the presumed fatty acid biosynthesis (FASII) inhibitors triclosan (75), cerulenin (76, 77), and hexachlorophene (78, 79) are parasiticidal (Table 2). However, IPP supplementation could not recue the parasites from these compounds (Table 2 and Fig. 4), strongly implying that the primary target of these three compounds is outside the apicoplast. Since genetic knockdown of various FASII enzymes (31) has shown that fatty acid biosynthesis is dispensable in the asexual blood stage of P. falciparum, Plasmodium berghei, and Plasmodium yoelii, our results further confirm that these compounds are off-target.

Heme biosynthesis and protein transport inhibitors.

Gene knockouts indicate that the Plasmodium apicoplast/mitochondrion heme synthesis pathway is also dispensable at the blood stage (32, 80). Unfortunately, the only known inhibitor of heme biosynthesis, succinylacetone, requires extremely high concentrations (>600 μM) to kill P. falciparum parasites in vitro, which obviated rigorous testing for IPP rescue (Table 2 and Fig. S2).
The fungal metabolite brefeldin A (BFA) disrupts protein trafficking from the endoplasmic reticulum (ER) to the Golgi in many organisms (81, 82). It has been debated whether or not protein targeting to the apicoplast is routed via the Golgi in P. falciparum (83, 84). We observe immediate death with BFA, and IPP failed to rescue the parasites (Table 2 and Fig. S1G). We conclude that BFA impacts other nonapicoplast processes, as previously reported, namely, disruption of the Golgi, distension of the nuclear envelope, and export of proteins (85), and this immediate effect masks any perturbation of apicoplast protein targeting.

DISCUSSION

The goal of a safe, effective, and cheap malaria vaccine is yet to be realized, which places chemotherapy as our primary defense against the disease. Parasite drug resistance has been a chronic issue with antimalarials, and it is clear that a larger arsenal of compounds would allow more flexibility in managing resistance (86, 87). Huge investments are required to find new drugs and identify their targets, so a better understanding of the mode of action of existing antimalarials is an effective use of resources. The use of antibacterial drugs against malaria started long before the apicoplast was identified in the malaria parasite (8895). Nowadays, we appreciate that the bacteria-like housekeeping machinery of the apicoplast, such as DNA replication, transcription, translation, and posttranslational modification, as well as metabolic pathways for synthesis of fatty acids, isoprenoid precursors, heme, and iron-sulfur complexes in the organelle make it an attractive drug target (1730, 51, 96102). However, an important facet of this strategy is knowing when particular pathways are essential to the parasite and being certain that the compounds in question do indeed have an apicoplast target. Moreover, it is strategic to understand the kinetics of drug effect in considering their use. Our approach of screening parasiticidal compounds with IPP rescue, along with a suite of apicoplast viability assays, unequivocally discriminates between compounds whose primary target is in the apicoplast and those that target other aspects of the parasite. These assays further define the mode of action and extend our understanding of drug-target interactions to optimize and prioritize a collection of existing clinically used antimalarials and sundry leads (Fig. 5).
FIG 5
FIG 5 Summary of the effects of 22 antimalarials. Drugs in black text are confirmed here as primarily targeting the apicoplast, while those in magenta have primary targets outside the apicoplast. The kinetics of parasite death (delayed or immediate), whether or not IPP rescues parasites from the drug, and whether the drug results in loss of the apicoplast (according to apicoplast genome qPCR, assays of apicoplast protein import, and visualization of apicoplast integrity) are indicated. All delayed-death drugs are rescued by IPP and have primary targets in the apicoplast. Three IPP-rescued compounds cause immediate death. Actinonin is the only apicoplast-targeting compound to cause immediate death and apicoplast loss.
Our data confirm that drugs disrupting the basic housekeeping functions in the apicoplast result in delayed-death drug kinetics (Fig. 5). This is not surprising, as two bacterial protein synthesis inhibitors, azithromycin and doxycycline, have confirmed apicoplast targets and delayed death (33). Inhibiting apicoplast genome replication with drugs specifically targeting prokaryotic DNA gyrase activity, such as the fluoroquinolone ciprofloxacin (103, 104), or protein translation with any of four classes of antibacterials (chloramphenicol, tetracyclines, lincosamides, and macrolides) (12, 18, 33, 55, 94, 105107) or a tRNA synthesis inhibitor (mupirocin) all cause characteristic delayed death and were confirmed to primarily target the apicoplast in our assays (Table 2 and Fig. 2 and 5) (37). Until now, rifampin has presented us with something of a conundrum. Rifampin inhibits transcription from the 35-kb apicoplast genome by targeting the plastid-encoded RNA polymerase (57) but causes immediate death that is not rescued by IPP (Table 2). Rifampin apparently has another target outside the apicoplast, which prevents us from drawing specific conclusions about the drug response kinetics of specifically inhibiting apicoplast transcription. Similarly, our inability to rescue parasites from the effects of the steroid fusidic acid imply a strong inhibition of a nonapicoplast target, likely the mitochondrion, which can also be targeted by this drug (59, 108).
Encouragingly, our IPP rescue assays successfully discriminate between aminoacyl-tRNA synthetase inhibitors, like mupirocin (an isoleucyl-tRNA synthetase inhibitor that specifically blocks apicoplast division [109, 110]) and borrelidin (a noncompetitive selective inhibitor first isolated from Streptomyces spp.) that binds to a unique hydrophobic cluster near the active sites of some bacterial and eukaryotic threonyl-tRNA synthetases. Plasmodium possesses only one threonyl-tRNA synthetase gene with isoforms trafficked to both the apicoplast and cytosol (111114). IPP rescue indicates an exclusively apicoplast target for mupirocin but a target outside the apicoplast for borrelidin. This indicates that the cytosolic isoform of threonyl-tRNA synthetase is the primary target of borrelidin. The apicoplast isoform may also be inhibited, but the drug concentrations required for this inhibition are not significantly lower than those producing immediate death induced by targeting of cytosolic threonyl-tRNA synthetase isoform, so apicoplast-specific activity may be masked.
Actinonin clearly targets the apicoplast, based on our IPP rescue and previous data that showed an interruption of apicoplast development with exposure to this drug (69). Curiously, actinonin, whose primary target in bacteria is a posttranslational modification enzyme involved in protein synthesis, induces immediate death, whereas the other bona fide apicoplast housekeeping inhibitors all induce delayed death (Fig. 5). Actinonin resistance in Toxoplasma gondii is conferred by a point mutation in the apicoplast membrane-associated protein FtsH1, and an homologous target is inferred for P. falciparum with protease inhibition rather than posttranslational modification proposed as the mode of action (70).
Immediate-death apicoplast drugs, such as actinonin, are of particular therapeutic interest, as they circumvent the delayed action that limits the usefulness of many apicoplast drugs in clinical applications. Given that actinonin exhibits a different death kinetic from all the established apicoplast housekeeping inhibitors (Fig. 5), it is unlikely that it inhibits apicoplast housekeeping. Rather, treatment with actinonin appears to immediately impact apicoplast development and division, suggesting that it may target apicoplast biogenesis. Confirmation that the target of actinonin in malaria parasites is an apicoplast FtsH homologue (70) will be an important next step in dissecting the mode of action of a potentially significant new class of antimalarials with immediate death and a bona fide apicoplast target.
The IPP rescue assay facilitates the definitive identification of off-target compounds. We show clearly that IPP cannot rescue parasites from the effects of putative FASII inhibitors but can rescue parasites from inhibitors of the IPP synthesis pathway (Fig. 5). This is entirely consistent with the asexual blood stage essentiality of isoprenoid precursor synthesis (37) and the dispensability of apicoplast fatty acid biosynthesis at this life stage (31, 115117), and it definitively shows that apicoplast fatty acid synthesis is not a drug target during the parasite asexual blood stages. IPP rescue assays thus present an efficient means of screening new compounds and will hopefully eliminate the misplaced effort in drug development that has occurred previously.
In sum, we show that simple IPP supplementation of in vitro-grown asexual P. falciparum readily identifies whether a compound has an exclusive target in the apicoplast, thus providing further intelligence about drugs already in use (35, 36) or in clinical trials (36, 118) in malaria patients. IPP supplementation can also inform us about new compounds, allowing deeper characterization of their mode of action and readily defining if they target the apicoplast.

MATERIALS AND METHODS

Drugs.

The drugs screened for apicoplast targets and controls are listed in Table 1.

P. falciparum cultures and chemical rescue assay.

P. falciparum D10 ACPLGFP parasites (53) were grown in human red blood cells at 2% hematocrit in RPMI 1640 supplemented with 0.5% AlbuMAX (GibcoBRL) and 0.1 μM pyrimethamine (Sigma) and gassed with 5% CO2 and 1% O2 in N2 at 37°C (53, 119). The apicoplasts of the parasite D10 ACPLGFP line express green fluorescent protein (GFP), which allowed us to visualize any disruption of the apicoplast by drug treatment. The half-maximal inhibitory concentration (IC50) of each drug was measured using tightly synchronized parasites and a standard SYBR green assay to determine immediate (48 h, 1st cycle) and any possible delayed (120 h, after 2nd cycle) death effects (120122). The IC50 determined at 120 h of parasite growth inhibition was used in the IPP supplementation assays. The culture medium was supplemented with 200 μM IPP to assess whether parasite growth could be rescued from the inhibitors used (37). Supplementation continued for four (48-h) parasite life cycles, and samples were collected after each life cycle (48, 96, 144, and 192 h). Cultures otherwise received equivalent medium changes and addition of blood cells. Data were analyzed and graphs were generated using the GraphPad Prism software.

Quantitative PCR.

Parasites from 200 μl of culture were used to isolate genomic DNA (gDNA; Bioline Isolate II genomic DNA kit). We used primer pairs to specifically amplify apicoplast genes (PF3D7_API02900, elongation factor Tu), mitochondrial genes (mal_mito_3, cytochrome b), and nuclear genes (PF3D7_1252200, chitinase; PF3D7_0717700, serine-tRNA ligase [putative]; and PF3D7_1462800, glyceraldehyde-3-phosphate dehydrogenase) to determine the presence or absence of organelle genomes (Table 3) (37, 52). PCR mixtures contained template gDNA, 0.15 μM each primer, and 1× SensiMix (SYBR No-ROX kit). The reactions were performed at 56°C for primer annealing and 65°C for template extension for 39 cycles on a Bio-Rad qPCR machine. Relative quantification of target genes was determined using the comparative method (threshold cycle [2−ΔΔCT]) (37, 52, 123).
TABLE 3
TABLE 3 Primer sequences used for quantitative real-time PCR
Gene IDaCommon namePrimer sequence (5′ to 3′)
Forward primerReverse primer
PF3D7_API02900Elongation factor TuGATATTGATTCAGCTCCAGAAGAAAATATCCATTTGTGTGGCTCCTATAA
mal_mito_3Cytochrome bAGATACATGCACGCAACAGGTCATTTGACCCCATGGTAAGA
PF3D7_1252200ChitinaseTGTTTCCTTCAACCCCTTTTTAATCCAAACCCGTCTGCTC
PF3D7_0717700Serine-tRNA ligase (putative)AAGTAGCAGG TCATCGTGGTTGTTCGGCACATTCTTCCATAA
PF3D7_1462800Glyceraldehyde-3-phosphate dehydrogenaseATCAAAGGGTGGTAAGGACTGGAGTGGACCTTCAGCAGCTTTTT
a
ID, identifier.

Immunoblotting.

Parasites (D10 ACPLGFP) from 200 μl of culture were isolated by 0.15% saponin lysis, washed twice with phosphate-buffered saline (PBS) (pH 7.4), and resuspended in NuPAGE LDS sample buffer (Invitrogen). Parasite proteins were separated by SDS-PAGE and transferred to a nitrocellulose membrane (Amersham), and then the membrane was blocked in 5% skim milk powder in Tris buffer solution with 0.05% Tween 20 for at least 1 h at room temperature or overnight at 4°C. The membrane was probed with mouse anti-GFP (1:500; Roche) primary antibody, followed by goat anti-mouse-horseradish peroxidase (1:1,000; Thermo Scientific) to allow for detection with enhanced chemiluminescence Western blotting substrate (Pierce). Imaging was performed with a ChemiDoc (Bio-Rad).

Fluorescence microscopy.

Parasites (D10 ACPLGFP) were incubated in 2 μg/ml Hoechst 33342 stain for 10 min at 37°C. Cells in culture media were allowed to settle onto a glass slide (MakTek) coated with 1% polyethylenimine (Sigma), and they were then mounted with coverslips using fluorescence mounting medium (Dako) and imaged using a Leica DMIRB-TCS SP2 inverted confocal laser scanning microscope with a PL APO 63×/1.4 λBL oil immersion objective. Images were merged and global contrast adjusted where necessary using the ImageJ software package (124).

ACKNOWLEDGMENTS

We thank the Australian Red Cross Blood Services, Melbourne, Australia, for supplying human erythrocytes. We also thank Stuart Ralph, University of Melbourne, for supplying borrelidin and Danny Wilson, University of Adelaide, for supplying erythromycin.
This work was supported by an Australian National Health and Medical Research Project Grant and an Australian Research Council Discovery Project Grant and Laureate Fellowship.
We declare no conflicts of interest.

Supplemental Material

File (zac001186827s1.pdf)
ASM does not own the copyrights to Supplemental Material that may be linked to, or accessed through, an article. The authors have granted ASM a non-exclusive, world-wide license to publish the Supplemental Material files. Please contact the corresponding author directly for reuse.

REFERENCES

1.
World Health Organization. 2016. World malaria report. World Health Organization, Geneva, Switzerland. http://apps.who.int/iris/bitstream/10665/252038/1/9789241511711-eng.pdf?ua=1.
2.
Murray CJ, Rosenfeld LC, Lim SS, Andrews KG, Foreman KJ, Haring D, Fullman N, Naghavi M, Lozano R, Lopez AD. 2012. Global malaria mortality between 1980 and 2010: a systematic analysis. Lancet 379:413–431.
3.
Gardner MJ, Hall N, Fung E, White O, Berriman M, Hyman RW, Carlton JM, Pain A, Nelson KE, Bowman S, Paulsen IT, James K, Eisen JA, Rutherford K, Salzberg SL, Craig A, Kyes S, Chan M-S, Nene V, Shallom SJ, Suh B, Peterson J, Angiuoli S, Pertea M, Allen J, Selengut J, Haft D, Mather MW, Vaidya AB, Martin DMA, Fairlamb AH, Fraunholz MJ, Roos DS, Ralph SA, McFadden GI, Cummings LM, Subramanian GM, Mungall C, Venter JC, Carucci DJ, Hoffman SL, Newbold C, Davis RW, Fraser CM, Barrell B. 2002. Genome sequence of the human malaria parasite Plasmodium falciparum. Nature 419:498–511.
4.
Wilson IRJM, Denny PW, Preiser PR, Rangachari K, Roberts K, Roy A, Whyte A, Strath M, Moore DJ, Moore PW, Williamson DH. 1996. Complete gene map of the plastid-like DNA of the malaria parasite Plasmodium falciparum. J Mol Biol 261:155–172.
5.
Gardner MJ, Bates PA, Ling IT, Moore DJ, McCready S, Gunasekera MBR, Wilson RJM, Williamson DH. 1988. Mitochondrial DNA of the human malarial parasite Plasmodium falciparum. Mol Biochem Parasitol 31:11–17.
6.
Conway DJ, Fanello C, Lloyd JM, Al-Joubori BM, Baloch AH, Somanath SD, Roper C, Oduola AM, Mulder B, Povoa MM, Singh B, Thomas AW. 2000. Origin of Plasmodium falciparum malaria is traced by mitochondrial DNA. Mol Biochem Parasitol 111:163–171.
7.
Williamson DH, Gardner MJ, Preiser P, Moore DJ, Rangachari K, Wilson RJM. 1994. The evolutionary origin of the 35 kb circular DNA of Plasmodium falciparum: new evidence supports a possible rhodophyte ancestry. Mol Gen Genet 243:249–252.
8.
McFadden GI, Yeh E. 2017. The apicoplast: now you see it, now you don't. Int J Parasitol 47:137–144.
9.
van Dooren GG, Striepen B. 2013. The algal past and parasite present of the apicoplast. Annu Rev Microbiol 67:271–289.
10.
McFadden GI, Waller RF, Reith ME, Lang-Unnasch N. 1997. Plastids in apicomplexan parasites, p 261–287. In Bhattacharya D (ed), Origins of algae and their plastids. Springer Vienna, Vienna, Austria.
11.
Janouškovec J, Horák A, Oborník M, Lukes J, Keeling PJ. 2010. A common red algal origin of the apicomplexan, dinoflagellate, and heterokont plastids. Proc Natl Acad Sci U S A 107:10949–10954.
12.
Wilson RJ, Williamson DH. 1997. Extrachromosomal DNA in the Apicomplexa. Microbiol Mol Biol Rev 61:1–16.
13.
Ralph SA, van Dooren GG, Waller RF, Crawford MJ, Fraunholz MJ, Foth BJ, Tonkin CJ, Roos DS, McFadden GI. 2004. Tropical infectious diseases: metabolic maps and functions of the Plasmodium falciparum apicoplast. Nat Rev Microbiol 2:203–216.
14.
Seeber F. 2002. Biogenesis of iron-sulphur clusters in amitochondriate and apicomplexan protists. Int J Parasitol 32:1207–1217.
15.
Waller RF, Keeling PJ, Donald RG, Striepen B, Handman E, Lang-Unnasch N, Cowman AF, Besra GS, Roos DS, McFadden GI. 1998. Nuclear-encoded proteins target to the plastid in Toxoplasma gondii and Plasmodium falciparum. Proc Natl Acad Sci U S A 95:12352–12357.
16.
Sato S. 2004. Enzymes for heme biosynthesis are found in both the mitochondrion and plastid of the malaria parasite. Protist 155:117–125.
17.
McFadden GI, Roos DS. 1999. Apicomplexan plastids as drug targets. Trends Microbiol 7:328–333.
18.
Fichera ME, Roos DS. 1997. A plastid organelle as a drug target in apicomplexan parasites. Nature 390:407–409.
19.
Jomaa H, Wiesner J, Sanderbrand S, Altincicek B, Weidemeyer C, Hintaz M, Turbachova I, Eberl M, Zeidler J, Lichtenthaler HK, Soldati D, Beck E. 1999. Inhibitors of the nonmevalonate pathway of isoprenoid biosynthesis as antimalarial drugs. Science 285:1573–1576.
20.
Ralph SA, D'Ombrain MC, McFadden GI. 2001. The apicoplast as an antimalarial drug target. Drug Resist Updat 4:145–151.
21.
Foth BJ, McFadden GI. 2003. The apicoplast: a plastid in Plasmodium falciparum and other Apicomplexan parasites. Int Rev Cytol 224:57–110.
22.
Seeber F. 2003. Biosynthetic pathways of plastid-derived organelles as potential drug targets against parasitic apicomplexa. Curr Drug Targets Immune Endocr Metabol Disord 3:99–109.
23.
Dahl EL, Rosenthal PJ. 2008. Apicoplast translation, transcription and genome replication: targets for antimalarial antibiotics. Trends Parasitol 24:279–284.
24.
Wiesner J, Reichenberg A, Heinrich S, Schlitzer M, Jomaa H. 2008. The plastid-like organelle of apicomplexan parasites as drug target. Curr Pharm Des 14:855–871.
25.
Botté CY, Dubar F, McFadden GI, Maréchal E, Biot C. 2012. Plasmodium falciparum apicoplast drugs: targets or off-targets? Chem Rev 112:1269–1283.
26.
Hoen R, Novoa EM, López A, Camacho N, Cubells L, Vieira P, Santos M, Marín-García P, Bautista JM, Cortés A, Ribas de Pouplana L, Royo M. 2013. Selective inhibition of an apicoplastic aminoacyl-tRNA synthetase from Plasmodium falciparum. Chembiochem 14:499–509.
27.
Pham JS, Sakaguchi R, Yeoh LM, De Silva NS, McFadden GI, Hou Y-M, Ralph SA. 2014. A dual-targeted aminoacyl-tRNA synthetase in Plasmodium falciparum charges cytosolic and apicoplast tRNACys. Biochem J 458:513–523.
28.
Haider A, Allen SM, Jackson KE, Ralph SA, Habib S. 2015. Targeting and function of proteins mediating translation initiation in organelles of Plasmodium falciparum. Mol Microbiol 96:796–814.
29.
Khan S. 2016. Recent advances in the biology and drug targeting of malaria parasite aminoacyl-tRNA synthetases. Malar J 15:203.
30.
Pasaje CFA, Cheung V, Kennedy K, Lim EE, Baell JB, Griffin MDW, Ralph SA. 2016. Selective inhibition of apicoplast tryptophanyl-tRNA synthetase causes delayed death in Plasmodium falciparum. Sci Rep 6:27531.
31.
Shears MJ, Botté CY, McFadden GI. 2015. Fatty acid metabolism in the Plasmodium apicoplast: drugs, doubts and knockouts. Mol Biochem Parasitol 199:34–50.
32.
Ke H, Sigala PA, Miura K, Morrisey JM, Mather MW, Crowley JR, Henderson JP, Goldberg DE, Long CA, Vaidya AB. 2014. The heme biosynthesis pathway is essential for Plasmodium falciparum development in mosquito stage but not in blood stages. J Biol Chem 289:34827–34837.
33.
Sidhu ABS, Sun Q, Nkrumah LJ, Dunne MW, Sacchettini JC, Fidock DA. 2007. In vitro efficacy, resistance selection, and structural modeling studies implicate the malarial parasite apicoplast as the target of azithromycin. J Biol Chem 282:2494–2504.
34.
Wilson DW, Goodman CD, Sleebs BE, Weiss GE, de Jong NW, Angrisano F, Langer C, Baum J, Crabb BS, Gilson PR, McFadden GI, Beeson JG. 2015. Macrolides rapidly inhibit red blood cell invasion by the human malaria parasite, Plasmodium falciparum. BMC Biol 13:52.
35.
Centers for Disease Control and Prevention. 2013. Guidelines for treatment of malaria in the United States. Centers for Disease Control and Prevention, Atlanta, GA.
36.
Rosenthal PJ. 2016. Azithromycin for malaria? Am J Trop Med Hyg 95:2–4.
37.
Yeh E, DeRisi JL. 2011. Chemical rescue of malaria parasites lacking an apicoplast defines organelle function in blood-stage Plasmodium falciparum. PLoS Biol 9:e1001138.
38.
Bowman JD, Merino EF, Brooks CF, Striepen B, Carlier PR, Cassera MB. 2014. Antiapicoplast and gametocytocidal screening to identify the mechanisms of action of compounds within the malaria box. Antimicrob Agents Chemother 58:811–819.
39.
Wu W, Herrera Z, Ebert D, Baska K, Cho SH, DeRisi JL, Yeh E. 2015. A chemical rescue screen identifies a Plasmodium falciparum apicoplast inhibitor targeting MEP isoprenoid precursor biosynthesis. Antimicrob Agents Chemother 59:356–364.
40.
Yao Z-K, Krai PM, Merino EF, Simpson ME, Slebodnick C, Cassera MB, Carlier PR. 2015. Determination of the active stereoisomer of the MEP pathway-targeting antimalarial agent MMV008138, and initial structure-activity studies. Bioorganic Med Chem Lett 25:1515–1519.
41.
Imlay LS, Armstrong CM, Masters MC, Li T, Price KE, Edwards RL, Mann KM, Li LX, Stallings CL, Berry NG, O'Neill PM, Odom AR. 2015. Plasmodium IspD (2-C-methyl-d-erythritol 4-phosphate cytidyltransferase), an essential and druggable antimalarial target. ACS Infect Dis 1:157–167.
42.
Price KE, Armstrong CM, Imlay LS, Hodge DM, Pidathala C, Roberts NJ, Park J, Mikati M, Sharma R, Lawrenson AS, Tolia NH, Berry NG, O'Neill PM, John ARO. 2016. Molecular mechanism of action of antimalarial benzoisothiazolones: species-selective inhibitors of the Plasmodium spp. MEP pathway enzyme, IspD. Sci Rep 6:36777.
43.
Krogstad DJ, Gluzman IY, Kyle DE, Oduola AM, Martin SK, Milhous WK, Schlesinger PH. 1987. Efflux of chloroquine from Plasmodium falciparum: mechanism of chloroquine resistance. Science 238:1283–1285.
44.
Gluzman IY, Schlesinger PH, Krogstad DJ. 1987. Inoculum effect with chloroquine and Plasmodium falciparum. Antimicrob Agents Chemother 31:32–36.
45.
Syafruddin D, Siregar JE, Marzuki S. 1999. Mutations in the cytochrome b gene of Plasmodium berghei conferring resistance to atovaquone. Mol Biochem Parasitol 104:185–194.
46.
Korsinczky M, Chen N, Kotecka B, Saul A, Rieckmann K, Cheng Q. 2000. Mutations in Plasmodium falciparum cytochrome b that are associated with atovaquone resistance are located at a putative drug-binding site. Antimicrob Agents Chemother 44:2100–2108.
47.
Zeidler J, Schwender J, Müller C, Wiesner J, Weidemeyer C, Beck E, Jomaa H, Lichtenthaler HK. 1998. Inhibition of the non-mevalonate 1-deoxy-d-xylulose-5-phosphate pathway of plant isoprenoid biosynthesis by fosmidomycin. Zeitschrift für Naturforschung C 53:980–986.
48.
Kuzuyama T, Shimizu T, Takahashi S, Seto H. 1998. Fosmidomycin, a specific inhibitor of 1-deoxy-d-xylulose 5-phosphate reductoisomerase in the nonmevalonate pathway for terpenoid biosynthesis. Tetrahedron Lett 39:7913–7916.
49.
Steinbacher S, Kaiser J, Eisenreich W, Huber R, Bacher A, Rohdich F. 2003. Structural basis of fosmidomycin action revealed by the complex with 2-C-methyl-d-erythritol 4-phosphate synthase (IspC). Implications for the catalytic mechanism and anti-malaria drug development. J Biol Chem 278:18401–18407.
50.
Zhang B, Watts KM, Hodge D, Kemp LM, Hunstad DA, Hicks LM, Odom AR. 2011. A second target of the antimalarial and antibacterial agent fosmidomycin revealed by cellular metabolic profiling. Biochemistry 50:3570–3577.
51.
Goodman CD, Su V, McFadden GI. 2007. The effects of anti-bacterials on the malaria parasite Plasmodium falciparum. Mol Biochem Parasitol 152:181–191.
52.
Wiley JD, Merino EF, Krai PM, McLean KJ, Tripathi AK, Vega-Rodríguez J, Jacobs-Lorena M, Klemba M, Cassera MB. 2015. Isoprenoid precursor biosynthesis is the essential metabolic role of the apicoplast during gametocytogenesis in Plasmodium falciparum. Eukaryot Cell 14:128–139.
53.
Waller RF, Reed MB, Cowman AF, McFadden GI. 2000. Protein trafficking to the plastid of Plasmodium falciparum is via the secretory pathway. EMBO J 19:1794–1802.
54.
van Dooren GG, Su V, D'Ombrain MC, McFadden GI. 2002. Processing of an apicoplast leader sequence in Plasmodium falciparum and the identification of a putative leader cleavage enzyme. J Biol Chem 277:23612–23619.
55.
Dahl EL, Rosenthal PJ. 2007. Multiple antibiotics exert delayed effects against the Plasmodium falciparum apicoplast. Antimicrob Agents Chemother 51:3485–3490.
56.
Dar MA, Sharma A, Mondal N, Dhar SK. 2007. Molecular cloning of apicoplast-targeted Plasmodium falciparum DNA gyrase genes: unique intrinsic ATPase activity and ATP-independent dimerization of PfGyrB subunit. Eukaryot Cell 6:398–412.
57.
McConkey GA, Rogers MJ, McCutchan TF. 1997. Inhibition of Plasmodium falciparum protein synthesis. Targeting the plastid-like organelle with thiostrepton. J Biol Chem 272:2046–2049.
58.
Lin Q, Katakura K, Suzuki M. 2002. Inhibition of mitochondrial and plastid activity of Plasmodium falciparum by minocycline. FEBS Lett 515:71–74.
59.
Johnson RA, McFadden GI, Goodman CD. 2011. Characterization of two malaria parasite organelle translation elongation factor G proteins: the likely targets of the anti-malarial fusidic acid. PLoS One 6:e20633.
60.
Gupta A, Mir SS, Saqib U, Biswas S, Vaishya S, Srivastava K, Siddiqi MI, Habib S. 2013. The effect of fusidic acid on Plasmodium falciparum elongation factor G (EF-G). Mol Biochem Parasitol 192:39–48.
61.
Istvan ES, Dharia NV, Bopp SE, Gluzman I, Winzeler EA, Goldberg DE. 2011. Validation of isoleucine utilization targets in Plasmodium falciparum. Proc Natl Acad Sci U S A 108:1627–1632.
62.
Giglione C, Meinnel T. 2001. Organellar peptide deformylases: universality of the N-terminal methionine cleavage mechanism. Trends Plant Sci 6:566–572.
63.
Sangshetti JN, Khan FAK, Kulkarni AA, Arote R, Patil RH. 2015. Antileishmanial drug discovery: comprehensive review of the last 10 years. RSC Adv 5:32376–32415.
64.
Yoon HJ, Kim HL, Lee SK, Kim HW, Kim HW, Lee JY, Mikami B, Suh SW. 2004. Crystal structure of peptide deformylase from Staphylococcus aureus in complex with actinonin, a naturally occurring antibacterial agent. Proteins 57:639–642.
65.
Giglione C, Serero A, Pierre M, Boisson B, Meinnel T. 2000. Identification of eukaryotic peptide deformylases reveals universality of N-terminal protein processing mechanisms. EMBO J 19:5916–5929.
66.
Escobar-Alvarez S, Goldgur Y, Yang G, Ouerfelli O, Li Y, Scheinberg DA. 2009. Structure and activity of human mitochondrial peptide deformylase, a novel cancer target. J Mol Biol 387:1211–1228.
67.
Tonkin CJ, van Dooren GG, Spurck TP, Struck NS, Good RT, Handman E, Cowman AF, McFadden GI. 2004. Localization of organellar proteins in Plasmodium falciparum using a novel set of transfection vectors and a new immunofluorescence fixation method. Mol Biochem Parasitol 137:13–21.
68.
Wiesner J, Sanderbrand S, Altincicek B, Beck E, Jomaa H. 2001. Seeking new targets for antiparasitic agents. Trends Parasitol 17:7–8.
69.
Goodman CD, McFadden GI. 2014. Ycf93 (Orf105), a small apicoplast-encoded membrane protein in the relict plastid of the malaria parasite Plasmodium falciparum that is conserved in Apicomplexa. PLoS One 9:e91178.
70.
Amberg-Johnson K, Hari SB, Ganesan SM, Lorenzi HA, Sauer RT, Niles JC, Yeh E. 2017. Small molecule inhibition of apicomplexan FtsH1 disrupts plastid biogenesis in human pathogens. eLife 6:e29865.
71.
Hackstein JHP, Mackenstedt U, Mehlhorn H, Meijerink JPP, Schubert H, Leunissen JAM. 1995. Parasitic apicomplexans harbor a chlorophyll a-D1 complex, the potential target for therapeutic triazines. Parasitol Res 81:207–216.
72.
Peeters JE, Geeroms R. 1986. Efficacy of toltrazuril against intestinal and hepatic coccidiosis in rabbits. Vet Parasitol 22:21–35.
73.
Chapman HD. 1987. Control of a line of E. tenella, partly resistant to monensin, by including toltrazuril discontinuously in the drinking water of chickens. J Comp Pathol 97:21–27.
74.
Mitchell SM, Zajac AM, Davis WL, Lindsay DS. 2003. Mode of action of ponazuril against Toxoplasma gondii tachyzoites in cell culture. J Eukaryot Microbiol 50(Suppl):689–690.
75.
Surolia N, Surolia A. 2001. Triclosan offers protection against blood stages of malaria by inhibiting enoyl-ACP reductase of Plasmodium falciparum. Nat Med 7:167–173.
76.
Tasdemir D, Kaiser M, Brun R, Yardley V, Schmidt TJ, Tosun F, Ruedi P. 2006. Antitrypanosomal and antileishmanial activities of flavonoids and their analogues: in vitro, in vivo, structure-activity relationship, and quantitative structure-activity relationship studies. Antimicrob Agents Chemother 50:1352–1364.
77.
Tasdemir D, Lack G, Brun R, Ruedi P, Scapozza L, Perozzo R. 2006. Inhibition of Plasmodium falciparum fatty acid biosynthesis: evaluation of FabG, FabZ, and FabI as drug targets for flavonoids. J Med Chem 49:3345–3353.
78.
Wickramasinghe SR, Inglis KA, Urch JE, Müller S, van Aalten DMF, Fairlamb AH. 2006. Kinetic, inhibition and structural studies on 3-oxoacyl-ACP reductase from Plasmodium falciparum, a key enzyme in fatty acid biosynthesis. Biochem J 393:447–457.
79.
Tarun AS, Peng X, Dumpit RF, Ogata Y, Silva-Rivera H, Camargo N, Daly TM, Bergman LW, Kappe SHI. 2008. A combined transcriptome and proteome survey of malaria parasite liver stages. Proc Natl Acad Sci U S A 105:305–310.
80.
Sigala PA, Goldberg DE. 2014. The peculiarities and paradoxes of Plasmodium heme metabolism. Annu Rev Microbiol 68:259–278.
81.
Klausner RD, Donaldson JG, Lippincott-Schwartz J. 1992. Brefeldin A: insights into the control of membrane traffic and organelle structure. J Cell Biol 116:1071–1080.
82.
Donaldson JG, Finazzi D, Klausner RD. 1992. Brefeldin A inhibits Golgi membrane-catalysed exchange of guanine nucleotide onto ARF protein. Nature 360:350–352.
83.
Heiny SR, Pautz S, Recker M, Przyborski JM. 2014. Protein traffic to the Plasmodium falciparum apicoplast: evidence for a sorting branch point at the Golgi. Traffic 15:1290–1304.
84.
Tonkin CJ, Struck NS, Mullin KA, Stimmler LM, McFadden GI. 2006. Evidence for Golgi-independent transport from the early secretory pathway to the plastid in malaria parasites. Mol Microbiol 61:614–630.
85.
Hager KM, Striepen B, Tilney LG, Roos DS. 1999. The nuclear envelope serves as an intermediary between the ER and Golgi complex in the intracellular parasite Toxoplasma gondii. J Cell Sci 112:2631–2638.
86.
Wells TNC, Hooft van Huijsduijnen R, Van Voorhis WC. 2015. Malaria medicines: a glass half full? Nat Rev Drug Discov 14:424–442.
87.
Cui L, Mharakurwa S, Ndiaye D, Rathod PK, Rosenthal PJ. 2015. Antimalarial drug resistance: literature review and activities and findings of the ICEMR network. Am J Trop Med Hyg 93:57–68.
88.
Pukrittayakamee S, Viravan C, Charoenlarp P, Yeamput C, Wilson RJ, White NJ. 1994. Antimalarial effects of rifampin in Plasmodium vivax malaria. Antimicrob Agents Chemother 38:511–514.
89.
Clyde DF, Miller RM, DuPont HL, Hornick RB. 1971. Antimalarial effects of tetracyclines in man. J Trop Med Hyg 74:238–242.
90.
Divo AA, Sartorelli AC, Patton CL, Bia FJ. 1988. Activity of fluoroquinolone antibiotics against Plasmodium falciparum in vitro. Antimicrob Agents Chemother 32:1182–1186.
91.
Geary TG, Jensen JB. 1983. Effects of antibiotics on Plasmodium falciparum in vitro. Am J Trop Med Hyg 32:221–225.
92.
Kremsner PG, Zotter GM, Feldmeier H, Graninger W, Rocha RM, Wiedermann G. 1988. A comparative trial of three regimens for treating uncomplicated falciparum malaria in Acre, Brazil. J Infect Dis 158:1368–1371.
93.
Divo AA, Geary TG, Jensen JB. 1985. Oxygen- and time-dependent effects of antibiotics and selected mitochondrial inhibitors on Plasmodium falciparum in culture. Antimicrob Agents Chemother 27:21–27.
94.
Ruiz-Sánchez F, Quezada M, Paredes M, Casillas J, Riebeling R. 1952. Chloramphenicol in malaria. Am J Trop Med Hyg 1:936–940.
95.
Coatney GR, Greenberg J. 1952. The use of antibiotics in the treatment of malaria. Ann N Y Acad Sci 55:1075–1081.
96.
McFadden GI. 2014. Apicoplast. Curr Biol 24:R262–R263.
97.
Gornicki P. 2003. Apicoplast fatty acid biosynthesis as a target for medical intervention in apicomplexan parasites. Int J Parasitol 33:885–896.
98.
Ramya TNC, Mishra S, Karmodiya K, Surolia N, Surolia A. 2007. Inhibitors of nonhousekeeping functions of the apicoplast defy delayed death in Plasmodium falciparum. Antimicrob Agents Chemother 51:307–316.
99.
McFadden GI. 2011. The apicoplast. Protoplasma 248:641–650.
100.
MacRae JI, Maréchal E, Biot C, Botté CY. 2012. The apicoplast: a key target to cure malaria. Curr Pharm Des 18:3490–3504.
101.
Qidwai T, Jamal F, Khan MY, Sharma B. 2014. Exploring drug targets in isoprenoid biosynthetic pathway for Plasmodium falciparum. Biochem Res Int 2014:657189.
102.
Miller ME, Parrott EE, Singh R, Nelson SW. 2014. A high-throughput assay to identify inhibitors of the apicoplast DNA polymerase from Plasmodium falciparum. J Biomol Screen 19:966–972.
103.
Furet YX, Pechere JC. 1991. Newly documented antimicrobial activity of quinolones. Eur J Clin Microbiol Infect Dis 10:249–254.
104.
Lewis RJ, Tsai FT, Wigley DB. 1996. Molecular mechanisms of drug inhibition of DNA gyrase. Bioessays 18:661–671.
105.
Beckers CJ, Roos DS, Donald RG, Luft BJ, Schwab JC, Cao Y, Joiner KA. 1995. Inhibition of cytoplasmic and organellar protein synthesis in Toxoplasma gondii. Implications for the target of macrolide antibiotics. J Clin Invest 95:367–376.
106.
Goodman CD, McFadden GI. 2007. Fatty acid biosynthesis as a drug target in apicomplexan parasites. Curr Drug Targets 8:15–30.
107.
Burkhardt D, Wiesner J, Stoesser N, Ramharter M, Uhlemann A-C, Issifou S, Jomaa H, Krishna S, Kremsner PG, Borrmann S. 2007. Delayed parasite elimination in human infections treated with clindamycin parallels “delayed death” of Plasmodium falciparum in vitro. Int J Parasitol 37:777–785.
108.
Gupta A, Mir SS, Jackson KE, Lim EE, Shah P, Sinha A, Siddiqi MI, Ralph SA, Habib S. 2013. Recycling factors for ribosome disassembly in the apicoplast and mitochondrion of Plasmodium falciparum. Mol Microbiol 88:891–905.
109.
Ward A, Campoli-Richards DM. 1986. Mupirocin. A review of its antibacterial activity, pharmacokinetic properties and therapeutic use. Drugs 32:425–444.
110.
Gurney R, Thomas CM. 2011. Mupirocin: biosynthesis, special features and applications of an antibiotic from a Gram-negative bacterium. Appl Microbiol Biotechnol 90:11–21.
111.
Khan S, Sharma A, Jamwal A, Sharma V, Pole AK, Thakur KK, Sharma A. 2011. Uneven spread of cis- and trans-editing aminoacyl-tRNA synthetase domains within translational compartments of P. falciparum. Sci Rep 1:188.
112.
Jackson KE, Pham JS, Kwek M, De Silva NS, Allen SM, Goodman CD, McFadden GI, Ribas de Pouplana L, Ralph SA. 2012. Dual targeting of aminoacyl-tRNA synthetases to the apicoplast and cytosol in Plasmodium falciparum. Int J Parasitol 42:177–186.
113.
Nass G, Hasenbank R. 1970. Effect of borrelidin on the threonyl-tRNA-synthetase activity and the regulation of threonine-biosynthetic enzymes in Saccharomyces cerevisiae. Mol Gen Genet 108:28–32.
114.
Ruan B, Bovee ML, Sacher M, Stathopoulos C, Poralla K, Francklyn CS, Soll D. 2004. A unique hydrophobic cluster near the active site contributes to differences in borrelidin inhibition among threonyl-tRNA synthetases. J Biol Chem 280:571–577.
115.
Shears MJ, MacRae JI, Mollard V, Goodman CD, Sturm A, Orchard LM, Llinás M, McConville MJ, Botté CY, McFadden GI. 2017. Characterization of the Plasmodium falciparum and P. berghei glycerol 3-phosphate acyltransferase involved in FASII fatty acid utilization in the malaria parasite apicoplast. Cell Microbiol 19:e12633.
116.
van Schaijk BCL, Kumar TRS, Vos MW, Richman A, van Gemert GJ, Li T, Eappen AG, Williamson KC, Morahan BJ, Fishbaugher M, Kennedy M, Camargo N, Khan SM, Janse CJ, Sim KL, Hoffman SL, Kappe SHI, Sauerwein RW, Fidock DA, Vaughan AM. 2014. Type II fatty acid biosynthesis is essential for Plasmodium falciparum sporozoite development in the midgut of anopheles mosquitoes. Eukaryot Cell 13:550–559.
117.
Vaughan AM, O'Neill MT, Tarun AS, Camargo N, Phuong TM, Aly ASI, Cowman AF, Kappe SHI. 2009. Type II fatty acid synthesis is essential only for malaria parasite late liver stage development. Cell Microbiol 11:506–520.
118.
Lell B, Kremsner PG. 2002. Clindamycin as an antimalarial drug: review of clinical trials. Antimicrob Agents Chemother 46:2315–2320.
119.
Trager W, Jensen JB. 1976. Human malaria parasites in continuous culture. Science 193:673–675.
120.
Smilkstein M, Sriwilaijaroen N, Kelly JX, Wilairat P, Riscoe M. 2004. Simple and inexpensive fluorescence-based technique for high-throughput antimalarial drug screening. Antimicrob Agents Chemother 48:1803–1806.
121.
Fichera ME, Bhopale MK, Roos DS. 1995. In vitro assays elucidate peculiar kinetics of clindamycin action against Toxoplasma gondii. Antimicrob Agents Chemother 39:1530–1537.
122.
Pfefferkorn ER, Borotz SE. 1994. Comparison of mutants of Toxoplasma gondii selected for resistance to azithromycin, spiramycin, or clindamycin. Antimicrob Agents Chemother 38:31–37.
123.
Pfaffl MW. 2001. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 29:e45.
124.
Schindelin J, Arganda-Carreras I, Frise E, Kaynig V, Longair M, Pietzsch T, Preibisch S, Rueden C, Saalfeld S, Schmid B, Tinevez J-Y, White DJ, Hartenstein V, Eliceiri K, Tomancak P, Cardona A. 2012. Fiji: an open-source platform for biological-image analysis. Nat Methods 9:676–682.
125.
Strath M, Scott-Finnigan T, Gardner M, Williamson D, Wilson I. 1993. Antimalarial activity of rifampicin in vitro and in rodent models. Trans R Soc Trop Med Hyg 87:211–216.
126.
Budimulja AS, Syafruddin Tapchaisri P, Wilairat P, Marzuki S. 1997. The sensitivity of Plasmodium protein synthesis to prokaryotic ribosomal inhibitors. Mol Biochem Parasitol 84:137–141.
127.
Goodman CD, McFadden GI. 2013. Targeting apicoplasts in malaria parasites. Expert Opin Ther Targets 17:167–177.
128.
Gunjan S, Singh SK, Chauhan BS, Pandey SK, Ahmad H, Dwivedi AK, Tripathi R. 2015. Clarithromycin enhances the antimalarial efficacy of mefloquine via its increased bioavailability and disrupting P. falciparum apicoplast. Life Sci 136:126–132.
129.
Koppisch AT, Fox DT, Blagg BSJ, Poulter CD. 2002. E. coli MEP synthase: steady-state kinetic analysis and substrate binding. Biochemistry 41:236–243.
130.
DeRocher A, Gilbert B, Feagin JE, Parsons M. 2005. Dissection of brefeldin A-sensitive and -insensitive steps in apicoplast protein targeting. J Cell Sci 118:565–574.
131.
Bracho C, Dunia I, Romano M, Benedetti EL, Perez HA. 2001. Plasmodium vivax and Plasmodium chabaudi: intraerythrocytic traffic of antigenically homologous proteins involves a brefeldin A-sensitive secretory pathway. Eur J Cell Biol 80:164–170.

Information & Contributors

Information

Published In

cover image Antimicrobial Agents and Chemotherapy
Antimicrobial Agents and Chemotherapy
Volume 62Number 1January 2018
eLocator: e01161-17
PubMed: 29109165

History

Received: 5 June 2017
Returned for modification: 7 July 2017
Accepted: 18 October 2017
Published online: 21 December 2017

Permissions

Request permissions for this article.

Keywords

  1. IPP
  2. Plasmodium falciparum
  3. antimalarials
  4. apicoplast
  5. drug targets

Contributors

Authors

Taher Uddin
School of BioSciences, University of Melbourne, Melbourne, Victoria, Australia
School of BioSciences, University of Melbourne, Melbourne, Victoria, Australia
Christopher Dean Goodman https://orcid.org/0000-0002-8923-7594
School of BioSciences, University of Melbourne, Melbourne, Victoria, Australia

Notes

Address correspondence to Christopher Dean Goodman, [email protected].
G.I.M. and C.D.G. contributed equally to this article.

Metrics & Citations

Metrics

Note: There is a 3- to 4-day delay in article usage, so article usage will not appear immediately after publication.

Citation counts come from the Crossref Cited by service.

Citations

If you have the appropriate software installed, you can download article citation data to the citation manager of your choice. Simply select your manager software from the list below and click Download.

View Options

View options

PDF/ePub

PDF/ePub

Get Access

Buy Article
Antimicrobial Agents and Chemotherapy Vol.62 • Issue 1 • ASM Journals Pay Per View, PPV 25
Journal Subscription
Antimicrobial Agents and Chemotherapy
ASM members can purchase subscriptions to journals.
Join or renew

Figures and Media

Figures

Media

Tables

Share

Share

Share the article link

Share with email

Email a colleague

Share on social media

American Society for Microbiology ("ASM") is committed to maintaining your confidence and trust with respect to the information we collect from you on websites owned and operated by ASM ("ASM Web Sites") and other sources. This Privacy Policy sets forth the information we collect about you, how we use this information and the choices you have about how we use such information.
FIND OUT MORE about the privacy policy